ID: 1163657829

View in Genome Browser
Species Human (GRCh38)
Location 19:18557965-18557987
Sequence GGACCGGTTCCCCGCGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163657829_1163657840 4 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657840 19:18557992-18558014 CGGGCGCGGCCCCCGGGCTGCGG No data
1163657829_1163657846 13 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657846 19:18558001-18558023 CCCCCGGGCTGCGGTGGGGTGGG No data
1163657829_1163657842 8 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657842 19:18557996-18558018 CGCGGCCCCCGGGCTGCGGTGGG No data
1163657829_1163657851 25 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657851 19:18558013-18558035 GGTGGGGTGGGGTGCGCCACTGG No data
1163657829_1163657841 7 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657841 19:18557995-18558017 GCGCGGCCCCCGGGCTGCGGTGG No data
1163657829_1163657835 -10 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657835 19:18557978-18558000 GAACCGGTCCGGGTCGGGCGCGG No data
1163657829_1163657843 9 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657843 19:18557997-18558019 GCGGCCCCCGGGCTGCGGTGGGG No data
1163657829_1163657839 -2 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657839 19:18557986-18558008 CCGGGTCGGGCGCGGCCCCCGGG No data
1163657829_1163657837 -3 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657829_1163657844 12 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657844 19:18558000-18558022 GCCCCCGGGCTGCGGTGGGGTGG No data
1163657829_1163657848 14 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657848 19:18558002-18558024 CCCCGGGCTGCGGTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163657829 Original CRISPR GGACCGGTTCCCCGCGGCCC TGG (reversed) Intronic