ID: 1163657832

View in Genome Browser
Species Human (GRCh38)
Location 19:18557971-18557993
Sequence CGACCCGGACCGGTTCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163657832_1163657841 1 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657841 19:18557995-18558017 GCGCGGCCCCCGGGCTGCGGTGG No data
1163657832_1163657848 8 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657848 19:18558002-18558024 CCCCGGGCTGCGGTGGGGTGGGG No data
1163657832_1163657837 -9 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657832_1163657843 3 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657843 19:18557997-18558019 GCGGCCCCCGGGCTGCGGTGGGG No data
1163657832_1163657842 2 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657842 19:18557996-18558018 CGCGGCCCCCGGGCTGCGGTGGG No data
1163657832_1163657852 29 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657852 19:18558023-18558045 GGTGCGCCACTGGCCACATCTGG No data
1163657832_1163657846 7 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657846 19:18558001-18558023 CCCCCGGGCTGCGGTGGGGTGGG No data
1163657832_1163657839 -8 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657839 19:18557986-18558008 CCGGGTCGGGCGCGGCCCCCGGG No data
1163657832_1163657851 19 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657851 19:18558013-18558035 GGTGGGGTGGGGTGCGCCACTGG No data
1163657832_1163657840 -2 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657840 19:18557992-18558014 CGGGCGCGGCCCCCGGGCTGCGG No data
1163657832_1163657844 6 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657844 19:18558000-18558022 GCCCCCGGGCTGCGGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163657832 Original CRISPR CGACCCGGACCGGTTCCCCG CGG (reversed) Intronic