ID: 1163657837

View in Genome Browser
Species Human (GRCh38)
Location 19:18557985-18558007
Sequence TCCGGGTCGGGCGCGGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163657817_1163657837 29 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657829_1163657837 -3 Left 1163657829 19:18557965-18557987 CCAGGGCCGCGGGGAACCGGTCC No data
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657832_1163657837 -9 Left 1163657832 19:18557971-18557993 CCGCGGGGAACCGGTCCGGGTCG No data
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657821_1163657837 23 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163657837 Original CRISPR TCCGGGTCGGGCGCGGCCCC CGG Intronic