ID: 1163662727 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:18588502-18588524 |
| Sequence | CTTGAAGCGGGTACTGAGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163662727_1163662733 | 20 | Left | 1163662727 | 19:18588502-18588524 | CCACGCTCAGTACCCGCTTCAAG | No data | ||
| Right | 1163662733 | 19:18588545-18588567 | CAAGCATAGGAACGAACTCAAGG | 0: 1 1: 0 2: 0 3: 7 4: 92 |
||||
| 1163662727_1163662732 | 7 | Left | 1163662727 | 19:18588502-18588524 | CCACGCTCAGTACCCGCTTCAAG | No data | ||
| Right | 1163662732 | 19:18588532-18588554 | CGGTGTTGAGATACAAGCATAGG | 0: 1 1: 0 2: 0 3: 3 4: 46 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163662727 | Original CRISPR | CTTGAAGCGGGTACTGAGCG TGG (reversed) | Intronic | ||