ID: 1163662727

View in Genome Browser
Species Human (GRCh38)
Location 19:18588502-18588524
Sequence CTTGAAGCGGGTACTGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163662727_1163662733 20 Left 1163662727 19:18588502-18588524 CCACGCTCAGTACCCGCTTCAAG No data
Right 1163662733 19:18588545-18588567 CAAGCATAGGAACGAACTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1163662727_1163662732 7 Left 1163662727 19:18588502-18588524 CCACGCTCAGTACCCGCTTCAAG No data
Right 1163662732 19:18588532-18588554 CGGTGTTGAGATACAAGCATAGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163662727 Original CRISPR CTTGAAGCGGGTACTGAGCG TGG (reversed) Intronic