ID: 1163663277

View in Genome Browser
Species Human (GRCh38)
Location 19:18591003-18591025
Sequence CTGGCAGAGGGTTCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163663277_1163663288 30 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663288 19:18591056-18591078 CAGATGTACACTTCCCCAGAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
1163663277_1163663282 0 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663282 19:18591026-18591048 TGCACAATGGTGTTCTCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1163663277_1163663287 29 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663287 19:18591055-18591077 TCAGATGTACACTTCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 137
1163663277_1163663283 3 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663283 19:18591029-18591051 ACAATGGTGTTCTCACCTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163663277 Original CRISPR CTGGCAGAGGGTTCCTCTGC TGG (reversed) Intronic