ID: 1163663277

View in Genome Browser
Species Human (GRCh38)
Location 19:18591003-18591025
Sequence CTGGCAGAGGGTTCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163663277_1163663282 0 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663282 19:18591026-18591048 TGCACAATGGTGTTCTCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1163663277_1163663283 3 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663283 19:18591029-18591051 ACAATGGTGTTCTCACCTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 127
1163663277_1163663287 29 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663287 19:18591055-18591077 TCAGATGTACACTTCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 137
1163663277_1163663288 30 Left 1163663277 19:18591003-18591025 CCAGCAGAGGAACCCTCTGCCAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1163663288 19:18591056-18591078 CAGATGTACACTTCCCCAGAGGG 0: 1
1: 0
2: 2
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163663277 Original CRISPR CTGGCAGAGGGTTCCTCTGC TGG (reversed) Intronic
900491317 1:2950475-2950497 AGGGCAGAGGGTTTCTCTGGTGG + Intergenic
901929033 1:12584810-12584832 CTGGCACAGGGATGCTCAGCAGG - Intronic
903657987 1:24960582-24960604 CTGGCAGTGGGTGCCCCTCCAGG - Intronic
904448507 1:30595633-30595655 CTGTCAGGGGGTTCCTCTAATGG + Intergenic
904807047 1:33139685-33139707 TTTGCAGGGGCTTCCTCTGCAGG - Intergenic
905445963 1:38028674-38028696 CTGGCAGAGGGTTCTTGAGGTGG + Intergenic
906634164 1:47397188-47397210 CCTGCAGAGGGCTTCTCTGCTGG + Intergenic
906782025 1:48581041-48581063 CTGGCAGAGGGGAACTCTGCTGG - Intronic
906886128 1:49650866-49650888 GTAGCAGAGGCTTTCTCTGCTGG + Intronic
908165257 1:61451105-61451127 ATGGCAGAAGGTACCTCTGACGG - Intronic
909274625 1:73667859-73667881 CTGTCTGATGGTTCCTCTGGAGG + Intergenic
910154700 1:84201709-84201731 ATGGTAGAGGGTACCTCTGAGGG + Intronic
911497568 1:98650212-98650234 CTGCAAGTGGGTTCCACTGCTGG + Intergenic
912160394 1:106976056-106976078 CTGGCAGTGGGTTCCTGCCCAGG - Intergenic
914004583 1:143721087-143721109 CCGCCAGAAGGTTCCTCCGCAGG - Intergenic
917356994 1:174136046-174136068 CTACTAGTGGGTTCCTCTGCTGG + Intergenic
917688198 1:177439901-177439923 ATTGCAGAGGTTTCATCTGCTGG - Intergenic
917808556 1:178636066-178636088 GTGACAGATGCTTCCTCTGCAGG + Intergenic
920443782 1:206000563-206000585 GTGGCTGTGGCTTCCTCTGCAGG + Intronic
922810865 1:228414844-228414866 TGGGCAGCAGGTTCCTCTGCGGG + Exonic
924451485 1:244182711-244182733 GTGGCAGAGTGTGCCTCTGTGGG - Intergenic
1063193067 10:3716292-3716314 CACACAGAGGTTTCCTCTGCAGG - Intergenic
1065326570 10:24555077-24555099 CCTGCCCAGGGTTCCTCTGCTGG - Intergenic
1065367671 10:24951985-24952007 CTGGCAGTGGAGGCCTCTGCAGG - Intronic
1065574735 10:27105813-27105835 CTGGCATAGGACTCCTCTACAGG + Intergenic
1067522759 10:47020659-47020681 CTGGCAGAGCCTTCCTGGGCTGG - Intergenic
1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG + Intronic
1068548957 10:58385185-58385207 GGAGCAGTGGGTTCCTCTGCCGG - Exonic
1070267055 10:74913770-74913792 CTGGGAGATGGCTCCCCTGCAGG - Intronic
1070466938 10:76733097-76733119 GTGGCAGAGGGGTCCTCTGTTGG - Intergenic
1070609874 10:77926136-77926158 CTGGCCGAGGGTACCTCGCCGGG - Intronic
1070844764 10:79513158-79513180 CTGGGGGAGGGGGCCTCTGCAGG - Exonic
1070929040 10:80247153-80247175 CTGGGGGAGGGGGCCTCTGCAGG + Intergenic
1075462757 10:122629608-122629630 CTCGCAGAGGGTTGCTGTCCAGG + Intronic
1076770380 10:132659645-132659667 CGTGCAGAGGTCTCCTCTGCAGG - Intronic
1077225378 11:1437111-1437133 CTGGCAGAGAGATCCAGTGCGGG + Intronic
1077253334 11:1570317-1570339 CCGGCAGAGGGGGCCTCAGCGGG + Intronic
1078355676 11:10629865-10629887 CAGACAGTGGCTTCCTCTGCAGG + Intronic
1078551783 11:12286138-12286160 CTGGCAGAGGGGTCTTCCACAGG + Intronic
1078749360 11:14145235-14145257 CTGGCACAGGCTGCCTTTGCTGG + Intronic
1079373290 11:19870319-19870341 CTGGTAGAGAGTTCTTGTGCTGG + Intronic
1080387911 11:31820351-31820373 CTGGCAGAGGCATCCTCTCTAGG + Intronic
1081610552 11:44560510-44560532 CTGGAGGAGGGTTTCTCTGATGG - Intergenic
1082599235 11:55128632-55128654 CTGGCTGATTGTTCCTCTGGAGG - Intergenic
1084319235 11:68364168-68364190 TCTGCAGAGGGGTCCTCTGCAGG - Intronic
1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG + Intergenic
1089640080 11:119842192-119842214 CTCGCAGTGGAATCCTCTGCAGG - Intergenic
1090334245 11:125952002-125952024 CTGGCAGAGAGTTCACCTGCCGG + Intergenic
1091218466 11:133917674-133917696 TTGACAGTGGGGTCCTCTGCAGG - Intronic
1091603648 12:1932769-1932791 CTGGCAGAGGTTTGTTCCGCAGG + Intergenic
1095641928 12:44495325-44495347 CTGCCAGTGTGTTCTTCTGCCGG + Intergenic
1095912408 12:47442008-47442030 CTGGCACAGTGTTACTCTGAAGG + Intergenic
1096278167 12:50228490-50228512 CTGGCACTTGTTTCCTCTGCTGG + Intronic
1097779903 12:63690006-63690028 CTAGAAGAGGTTGCCTCTGCAGG + Intergenic
1098006950 12:66007620-66007642 TGGGCTGAGGGTTCCTGTGCAGG - Intergenic
1102768555 12:115453252-115453274 CTGGCAGAGGCTTGCACTGCAGG - Intergenic
1102774052 12:115503530-115503552 CTGGCTGAGGGTTTCTCAGAAGG + Intergenic
1103212359 12:119176206-119176228 GAGGCAGAGGGGTCCTCTGGAGG + Intergenic
1104241029 12:126989877-126989899 GTGGCAGTGGCTTCCTCTGGTGG - Intergenic
1106230474 13:27817383-27817405 CTGTGAGAGGGTCCCTCTTCTGG - Intergenic
1109711414 13:66165321-66165343 CTGCCCGTGTGTTCCTCTGCTGG + Intergenic
1109881017 13:68476562-68476584 CTTGTGGAGGGTTCCTCTGCAGG - Intergenic
1110491383 13:76112501-76112523 CTGGCAATGGGTTCATGTGCAGG - Intergenic
1110964541 13:81676284-81676306 CTGCCAGAGTGTTCGTCTGCTGG + Intergenic
1111541342 13:89671062-89671084 CTTTCAGAGGGGTCCTATGCTGG - Intergenic
1116771624 14:49132655-49132677 GTTGCAGTGGGTTCCTCTACAGG - Intergenic
1116821661 14:49633705-49633727 CTGGCGTGGGGTTCTTCTGCGGG - Exonic
1118505873 14:66411288-66411310 CTGGCAGAGCTTTCCTCAACAGG + Intergenic
1119926799 14:78502229-78502251 ATGGCAGGGTGTTCCTGTGCTGG - Intronic
1120592400 14:86391204-86391226 CTGCCAGAGGCTTTCACTGCGGG - Intergenic
1121112450 14:91321470-91321492 GTGCCCGAGGGCTCCTCTGCAGG + Intronic
1122693187 14:103541133-103541155 CTGGCCCAGCATTCCTCTGCAGG - Intergenic
1122978305 14:105180041-105180063 CTGGCAGAGGGGAGATCTGCTGG + Intronic
1123038260 14:105480037-105480059 CTGGCAGAGGGCTTCCCTCCGGG + Intronic
1123942801 15:25224700-25224722 CTTGGAGAGGGTGCCTCGGCGGG + Intergenic
1126451153 15:48810874-48810896 CTGGCTGAGGGTTCCTGGGGGGG - Intronic
1128178565 15:65579827-65579849 CTGGGAAGTGGTTCCTCTGCAGG + Intronic
1129489325 15:75908204-75908226 CTTGCTGAGGGTTATTCTGCTGG + Intronic
1130121312 15:81050001-81050023 CTGGCAGATGCCTCCTTTGCAGG - Intronic
1131335075 15:91541166-91541188 ATGGAAGAGAGTTCTTCTGCTGG + Intergenic
1132355592 15:101169097-101169119 CCGGCAGAATGTCCCTCTGCAGG - Intergenic
1132625554 16:889910-889932 GAGGCAGAGGGGTCCTCAGCTGG - Intronic
1133413756 16:5589862-5589884 CCTGCAGAGGGTTGCTTTGCTGG + Intergenic
1134195304 16:12155071-12155093 CTGCCAGTGGCTGCCTCTGCTGG + Intronic
1135254883 16:20933262-20933284 GGTGGAGAGGGTTCCTCTGCGGG + Exonic
1137007201 16:35287978-35288000 CTGCCTGATGGTTCCTCTGGAGG - Intergenic
1137765902 16:50977448-50977470 CTGTCAGTGGGCTGCTCTGCTGG - Intergenic
1138357218 16:56392016-56392038 CTGTCTGATGGTTCCTCTGGAGG - Intronic
1139705299 16:68737208-68737230 TTGGCTGAGGGTTCACCTGCCGG - Exonic
1142010548 16:87711782-87711804 CGGGCGGAGGGTCCCTGTGCAGG - Intronic
1142241372 16:88948377-88948399 CTGGGAGAGGGTGACTGTGCAGG + Intronic
1144625692 17:16843419-16843441 CAGGTAGAGGGAGCCTCTGCGGG + Intergenic
1144880739 17:18429301-18429323 CAGGTAGAGGGAGCCTCTGCGGG - Intergenic
1145151496 17:20515086-20515108 CAGGTAGAGGGAGCCTCTGCGGG + Intergenic
1146162846 17:30569336-30569358 CAGGTAGAGGGAGCCTCTGCGGG + Intergenic
1148549756 17:48543447-48543469 CTGGCCGCGGGTTCCTCGGCAGG + Exonic
1152411250 17:80124462-80124484 CCGCCAGAGGGCTTCTCTGCAGG - Intergenic
1152561947 17:81083052-81083074 CTGGCAGAGGAAGCCTCTCCGGG - Intronic
1152750048 17:82058490-82058512 CTGGCAGAGGCTTCCCCAGTGGG - Intronic
1156186595 18:34670761-34670783 CTGTCTGATGGTTCCTCTGGAGG + Intronic
1157444606 18:47735263-47735285 CTGGCAGAGGGGTGCCATGCTGG - Intergenic
1159353111 18:67300171-67300193 CTGGAAGAGGGTTCTTTTTCTGG - Intergenic
1159640656 18:70859627-70859649 CTAGCAGAGGTTTCCTATGAGGG - Intergenic
1160055157 18:75472036-75472058 CTTGCACGGGGTTCCACTGCCGG - Intergenic
1160127705 18:76193210-76193232 CTGTCAGTGGATTTCTCTGCAGG - Intergenic
1162124783 19:8493603-8493625 AAGGCAGGGGGCTCCTCTGCAGG - Intronic
1163008127 19:14408985-14409007 GGGGCAGAGGGTTCCTCCCCCGG - Intronic
1163470935 19:17496586-17496608 CAGGCTGAGGGTTGCCCTGCGGG + Intronic
1163663277 19:18591003-18591025 CTGGCAGAGGGTTCCTCTGCTGG - Intronic
1167386276 19:49166034-49166056 CTGGCACAAGGTCCCTCTGGGGG - Exonic
924971988 2:136764-136786 CTGTCAGCGGGTCCCTCTCCTGG + Intergenic
925155717 2:1647843-1647865 CTGGCAGAGGGGTTGACTGCAGG - Intronic
925662921 2:6221899-6221921 CTGGCACTGGGTCCCTCTCCTGG - Intergenic
928278049 2:29920494-29920516 CTGCCAGACTCTTCCTCTGCAGG + Exonic
928335965 2:30398427-30398449 CTGGCATAGATTTCCACTGCGGG + Intergenic
930755042 2:54965201-54965223 GAGGGAGAGGGTTCCACTGCTGG + Intronic
931141248 2:59460409-59460431 ATGGGAGAAGATTCCTCTGCTGG - Intergenic
931899085 2:66767975-66767997 CAGGCAGAGGTGTCCTCTCCTGG - Intergenic
934651076 2:96091720-96091742 CTGGGAGACGGTTTCCCTGCAGG - Intergenic
937325921 2:120989534-120989556 CTGGGAGGGGGCTCCGCTGCGGG - Exonic
940446012 2:153778186-153778208 CTGTCTGTGTGTTCCTCTGCTGG + Intergenic
941486316 2:166086629-166086651 CTGTCAGAAGGTCACTCTGCAGG + Intronic
947578671 2:231297155-231297177 CTGGGAGATGCTTCCTCAGCAGG + Intronic
948151907 2:235751290-235751312 CTGGCAGAGGGTCCCCTTGCTGG + Intronic
1170968297 20:21095876-21095898 CTGGCTGAGGGCTACTCTGCTGG - Intergenic
1171210882 20:23316095-23316117 CTGGCAGGGAGTGGCTCTGCTGG - Intergenic
1171275875 20:23856044-23856066 CTGGGGGAGGTCTCCTCTGCAGG + Intergenic
1171393023 20:24813617-24813639 ATGGCTGAGGGCTCTTCTGCTGG - Intergenic
1171458467 20:25285155-25285177 ACGGCAGAGGGGTCCTCAGCGGG - Intronic
1172442512 20:34976191-34976213 GTGGCAGAGTGGTCCTCTGAGGG - Intronic
1173046844 20:39520989-39521011 CTGGCAGAGCGGCCCTCTGCAGG - Intergenic
1173061434 20:39665366-39665388 AGGACAGAGGGTTCCTATGCTGG + Intergenic
1176984712 21:15422521-15422543 CTGGCAGGGGGTTGCTGGGCTGG - Intergenic
1177037296 21:16060204-16060226 CTGCAAGAGGCTTCCACTGCAGG + Intergenic
1177087042 21:16718789-16718811 TTGGCTGAGGGCTACTCTGCAGG + Intergenic
1178875791 21:36413065-36413087 CTGGCAGGGGTTCCCTCTACCGG - Exonic
1179802302 21:43816702-43816724 CTGGTGGGGGGTGCCTCTGCAGG + Intergenic
1180007317 21:45028736-45028758 CAGACAGACGGTCCCTCTGCAGG - Intergenic
1180965162 22:19784410-19784432 CTGGCAGTGGGTGTCCCTGCAGG - Exonic
1181314467 22:21962561-21962583 CTGGCAGAGCGTGCCCCTGGAGG - Exonic
1181616125 22:24055496-24055518 CTGGCAGAGGTCCCCTCTTCTGG + Intronic
1181720859 22:24773300-24773322 AGGGAAGAGGGTTCCTGTGCAGG - Intronic
1182116327 22:27758513-27758535 CTGGCAGAGGGGTGTTCTGAGGG + Intronic
1184422378 22:44389551-44389573 CTGGCAGAGCTCTCCTCTCCTGG + Intergenic
950111180 3:10419721-10419743 GAGGCACAGGGTTCTTCTGCTGG + Intronic
950546746 3:13642592-13642614 CTGGAAGGGGGTTCCTTTGATGG + Intergenic
954811961 3:53254266-53254288 CTGGCACACGGTAGCTCTGCAGG - Intronic
957445244 3:80308030-80308052 CTGCCAGAGGCTCCCCCTGCAGG + Intergenic
961336679 3:126184537-126184559 CGGGCAGAGGCTCTCTCTGCAGG - Intronic
961433197 3:126897858-126897880 CATGCAGAGGGCTCCTATGCTGG - Intronic
964721899 3:159775588-159775610 CTAGCACAGGGTGCCTCTGGTGG + Intronic
965769780 3:172169605-172169627 CTGTAAGAAGGTTTCTCTGCCGG - Intronic
966141248 3:176758828-176758850 CTGACAGAGGATTTCTCAGCTGG - Intergenic
968517562 4:1021245-1021267 CTGGCAGAGGCCTCCTTTCCTGG - Intronic
969149077 4:5153048-5153070 ATGGCAGTGGGGTCCTCTCCAGG - Intronic
969207133 4:5655486-5655508 CTGGCACACGTTCCCTCTGCTGG + Intronic
969956213 4:10893598-10893620 CAGGAAAAGGGTGCCTCTGCAGG - Intergenic
970485931 4:16524841-16524863 ATTGCAAAGGGTTCCTATGCTGG - Intronic
973974035 4:56244280-56244302 CTGGAAGGGGGTTCATATGCTGG + Intronic
974471836 4:62329193-62329215 AGGGTAGAGAGTTCCTCTGCTGG + Intergenic
977354666 4:95930518-95930540 CCGACACAGGGTTCCTATGCTGG - Intergenic
978363276 4:107953819-107953841 CTGGCAGGGGGTCCCTCCACAGG - Intergenic
985879650 5:2628610-2628632 CTGGCAGTGAGTTGCTCTGCTGG + Intergenic
986798247 5:11233018-11233040 ATGGCAGAAGGTACCTCTTCAGG - Intronic
989498502 5:42138167-42138189 CTGTCAGTGTGTTCTTCTGCTGG + Intergenic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
993569361 5:89517980-89518002 CTGGCAGAAGAATCCGCTGCTGG + Intergenic
995079375 5:108030425-108030447 CAGACAGTGGGTACCTCTGCAGG + Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996067149 5:119091760-119091782 CTGGCTAAGGGTTCATGTGCTGG + Intronic
997456009 5:134018094-134018116 CTGGCTCATGGTTCTTCTGCAGG + Intergenic
1001097922 5:168790257-168790279 CTGGCAGTGTGTTCCTCATCTGG + Intronic
1001159463 5:169300729-169300751 CTGGAGGAGGCTGCCTCTGCGGG + Exonic
1001330694 5:170760415-170760437 AAGGGAGAGGGTTGCTCTGCTGG - Intergenic
1001561959 5:172675587-172675609 CTGGCAGAAGCTTCCTCTCCTGG - Intronic
1001760446 5:174203814-174203836 ATGGCAGAGGGTCCCTCAGGAGG - Intronic
1002701718 5:181129491-181129513 CTGGGAGACCGTTCTTCTGCTGG - Intergenic
1004903325 6:20212859-20212881 GCCGTAGAGGGTTCCTCTGCCGG + Intergenic
1005029270 6:21493909-21493931 CTGTCAGTGTGTTCTTCTGCCGG - Intergenic
1005259918 6:24047885-24047907 TTGGCAGTGGTTCCCTCTGCTGG - Intergenic
1005831277 6:29673010-29673032 CTGACAGAGGGTTCCAGTGATGG + Exonic
1007405649 6:41634720-41634742 CTGGCAGAGGGCCAGTCTGCTGG - Intergenic
1009803544 6:68573311-68573333 ATGGCAAAGGGTTCATCTCCTGG - Intergenic
1017324538 6:153130800-153130822 CTGGCCGAGCGTTCCCCGGCGGG + Intronic
1018650092 6:165986134-165986156 CAGGCAGTGGGTTCCTCCTCTGG + Intronic
1019135663 6:169906148-169906170 CTGGCTGGAGGTTCCTCTCCAGG - Intergenic
1019441251 7:1048362-1048384 GGAGCAGAGGATTCCTCTGCTGG + Intronic
1021530570 7:21640336-21640358 TGGGCAGAGGGTTCAGCTGCTGG - Intronic
1021887839 7:25157439-25157461 CCGGCAGAGGTGTCCTCAGCAGG - Intronic
1022108625 7:27214126-27214148 CTGCCCGAGGGCTTCTCTGCGGG + Intergenic
1022938494 7:35206096-35206118 CTAGAAGAGGTTGCCTCTGCAGG + Intronic
1023181758 7:37492054-37492076 CTGGCCAAGGCTCCCTCTGCTGG + Intergenic
1024055100 7:45655240-45655262 CTGGCAGAGGGGGCCACTGTTGG - Intronic
1024609657 7:51053722-51053744 CTGGCACAGGGCCCCTCGGCCGG + Intronic
1025247673 7:57329232-57329254 CTTGGAGAGGGTTTCTCAGCAGG - Intergenic
1026207740 7:68272824-68272846 CTGGCAGAAGTTTTCTTTGCAGG - Intergenic
1027869181 7:83684999-83685021 CTGCCCGAGGGTTCCTCCACAGG - Intergenic
1030255431 7:107505377-107505399 CTGGCAGAAAATTCATCTGCAGG + Intronic
1030710048 7:112739437-112739459 ATGGGAGTGGGTTCCTATGCTGG + Intergenic
1032766560 7:134999577-134999599 CTGGAAGAGTGTTCTTCTGGTGG + Intronic
1034338171 7:150336799-150336821 CTGTCACAGGGTTCCACTGGGGG - Exonic
1035287844 7:157817455-157817477 CAGGCAGATGGTGCCACTGCCGG + Intronic
1035358803 7:158296269-158296291 CTGTCAGTGAGTTCTTCTGCCGG - Intronic
1036070301 8:5435234-5435256 CTGGCAAACGATTTCTCTGCAGG + Intergenic
1041834544 8:62196944-62196966 CTGTCAGAAGGATACTCTGCTGG + Intergenic
1043238482 8:77899827-77899849 CTGGCAGTGTGCTCTTCTGCTGG + Intergenic
1044856988 8:96486314-96486336 AAGGCTGAGGGTTTCTCTGCAGG - Intergenic
1050611531 9:7359071-7359093 GTGGCAGAGGCTCCCTCTCCAGG - Intergenic
1052581049 9:30354401-30354423 CTGACAGAGGCTTCAGCTGCTGG - Intergenic
1056101174 9:83301891-83301913 CTGGCTGCGGGTTCCCCTGGAGG + Intronic
1059055555 9:110975665-110975687 CTGTCTCAGGGTTACTCTGCAGG - Intronic
1060733070 9:126050076-126050098 CTGGCAGAGAGGACCCCTGCTGG - Intergenic
1061580043 9:131530966-131530988 CTGGCAGGGGGCCCCTCGGCCGG + Intronic
1062608201 9:137358219-137358241 CAGGGAGGTGGTTCCTCTGCAGG - Intronic
1186472647 X:9833422-9833444 CTGGGAGATGTTTGCTCTGCAGG + Intronic
1186667474 X:11732663-11732685 CAGGGTGTGGGTTCCTCTGCAGG + Intergenic
1187138502 X:16571032-16571054 CTGTCAGTGTGTTCTTCTGCTGG - Intergenic
1190325459 X:49204600-49204622 TAGGCAGAGGGGTCCTCTGACGG - Intergenic
1193607688 X:83588613-83588635 CTGTCAGTGGGTTCCTCTCGAGG + Intergenic
1197792352 X:130268641-130268663 CTGGCTGAGGGTCTCTATGCCGG - Intronic
1198374678 X:136026919-136026941 CTGGAAGAGGGGGCCTCTGCTGG + Intronic
1199596803 X:149512440-149512462 CTGGGAGTGGGTCCCTCTGCTGG - Intronic