ID: 1163665719

View in Genome Browser
Species Human (GRCh38)
Location 19:18603401-18603423
Sequence AGTGGGAGCTGCAAGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 7, 3: 70, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163665719 Original CRISPR AGTGGGAGCTGCAAGTGCCA AGG Intronic
900195020 1:1371691-1371713 AGTGGGAGGTGCTACTGGCATGG - Intergenic
900867776 1:5280708-5280730 AGAGTGAGCAGCAAGTGCAAAGG - Intergenic
901677193 1:10892415-10892437 AGAGGCACCTGCAAGTGCAAAGG - Intergenic
901752777 1:11421662-11421684 AGGCGGAGCAGCAAGTGCCAAGG - Intergenic
901793844 1:11669001-11669023 TGTGGGAATTGCAAGTGCCAAGG - Intronic
901874578 1:12160023-12160045 AGAGGGAACTGCCAGTGCGAAGG + Intergenic
902191960 1:14770000-14770022 AGTGGGAGCAGGATGTGCAAAGG + Intronic
902278937 1:15360346-15360368 AGAGGGAACTGCATGTGCTAAGG + Intronic
902606144 1:17570422-17570444 AGTGGGAACAGCAAGTGCAAAGG + Intronic
902707942 1:18219314-18219336 GGTGGGAGCAGCAAGGGCAAAGG + Intronic
902962528 1:19974964-19974986 AGTAGGAGCTGCTATTGCCTAGG + Intergenic
903188697 1:21644208-21644230 AGAGGGAGCAGCAGGTGCAAAGG - Intronic
903299821 1:22370806-22370828 AGAGGGGACTGCAAGTGCAAAGG + Intergenic
903790531 1:25889902-25889924 AAAGGGAACTGCTAGTGCCAAGG - Intronic
904319115 1:29685043-29685065 AGGGGGACCTGCATGTTCCAGGG + Intergenic
904320513 1:29695115-29695137 AGTGGGAACAGCAAGTGGGAGGG - Intergenic
904362654 1:29987088-29987110 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
904377692 1:30092054-30092076 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
904596561 1:31649983-31650005 AGAGGGAACAGCACGTGCCAAGG - Intergenic
904850778 1:33457734-33457756 AGAGGAAGCAGCAAGTGCAAAGG - Intergenic
904889787 1:33771174-33771196 AGTGGGAGCCCCAGGTGCCATGG - Intronic
904914899 1:33962677-33962699 AGAGGGAGCTGCAAGTACAAAGG - Intronic
905451745 1:38061466-38061488 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
905527335 1:38649055-38649077 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
905562490 1:38938469-38938491 AGTGGGAGCTGGAACTGCTAGGG - Intronic
905799789 1:40835821-40835843 AGAGGGAACAGCAAGTGCCAAGG + Intronic
906674314 1:47682221-47682243 AGAGGGAGCAGTAAGTGCAAAGG - Intergenic
906692274 1:47800405-47800427 AGAGGGAGCAGCCAGTGCAAAGG + Intronic
907324981 1:53631819-53631841 AGAGGGAACAGCCAGTGCCAAGG + Intronic
907528797 1:55071969-55071991 AGTGGCAGCAGCAACCGCCAGGG + Intronic
907586397 1:55621525-55621547 AAAGGGAACTGCAGGTGCCAAGG - Intergenic
907875463 1:58482755-58482777 AGAGGGAGCTGCGAGTACAAGGG + Intronic
908078541 1:60548041-60548063 GGCTGGAGCTGCTAGTGCCAGGG + Intergenic
908292798 1:62685707-62685729 ATTGGGAGATGCAAGTGGGATGG - Intronic
909331320 1:74415138-74415160 TGAGGGAGCGGCAAGTGCAAAGG - Intronic
909346205 1:74590528-74590550 ATTGTGAGCTGCACATGCCAGGG - Intronic
911130468 1:94382449-94382471 ACTGTGGGCTGCAAGAGCCATGG - Intergenic
911147257 1:94564749-94564771 AGAGGGAACAGCAGGTGCCAAGG - Intergenic
911366117 1:96939603-96939625 ATTGGCAGCTGTAAGTACCATGG - Intergenic
912702613 1:111889319-111889341 AGTGGGACTAGCAGGTGCCAGGG - Intronic
913223786 1:116680818-116680840 AGAGGGAACTGCAAGTTGCAAGG + Intergenic
913974791 1:143446627-143446649 AGAGGGAGTGGCAAGTGCAAAGG - Intergenic
914069182 1:144272243-144272265 AGAGGGAGTGGCAAGTGCAAAGG - Intergenic
914109973 1:144694111-144694133 AGAGGGAGTGGCAAGTGCAAAGG + Intergenic
914328904 1:146648012-146648034 AGCGGGAGATGCAGGTGGCATGG + Intergenic
914792636 1:150892120-150892142 AGTGAGATCTGCAAGTGCCAGGG + Intergenic
916239384 1:162623794-162623816 AGAGGGGGCAGCAAGTGCCAAGG + Intergenic
918551717 1:185749892-185749914 AGAGGGAACTGCAAGGGCAATGG - Intronic
920216667 1:204365994-204366016 AGGGGGAACAGCAAGCGCCAAGG + Intronic
920333219 1:205227480-205227502 ATTCAGAGCTGCAAATGCCAAGG - Intergenic
920678863 1:208057838-208057860 AATGGGAGCTGCAGATTCCATGG + Intronic
920857239 1:209673228-209673250 AGGAGGGGCAGCAAGTGCCATGG - Intergenic
923616843 1:235545300-235545322 AGAGGAAGCTGCAGGTGCAAAGG + Intergenic
923664692 1:235989808-235989830 AGGGGGAACTGCAAGTGCAAAGG + Intronic
924099383 1:240588029-240588051 ACAGGGAGCTGGAAGTGCCTGGG + Intronic
1062958716 10:1557332-1557354 AGTTGGAGCTGCCAGGGTCAAGG - Intronic
1063588903 10:7377632-7377654 ATTGTGAACTGCATGTGCCAGGG - Intronic
1065363924 10:24916568-24916590 AGAGGAAGCAGCAAGTGCAATGG - Intronic
1067559508 10:47295108-47295130 AGTGGGATTGTCAAGTGCCATGG - Intergenic
1068875824 10:61995737-61995759 AGTGGGACCTGGAAAAGCCAAGG - Intronic
1068923848 10:62514252-62514274 GGAGGCAGCTGCAAGTGCTAGGG - Intronic
1069862128 10:71478361-71478383 AGAGGGAACTGCAGGTGCAAAGG - Intronic
1069935541 10:71913243-71913265 AGTGGTTGCAGCCAGTGCCAGGG - Intergenic
1070771204 10:79083324-79083346 AGTGGGAACAGCATGTGCAAAGG + Intronic
1070899277 10:80013910-80013932 CCTGGGAGCTGCATGAGCCAGGG - Intergenic
1071482829 10:86078059-86078081 AGAGGGAACTGGCAGTGCCAGGG + Intronic
1071589830 10:86862328-86862350 ATAGGGATCTGCACGTGCCAGGG + Intronic
1074154132 10:110783367-110783389 ACTGGGAGCTGCATGTGAAAGGG + Exonic
1074786188 10:116843572-116843594 AGTGGGAACTGGAAGAACCAGGG + Intergenic
1074825552 10:117213298-117213320 AGGGGTAGCTAGAAGTGCCAAGG + Intergenic
1074853679 10:117457969-117457991 GGCTGGAGCTGCAACTGCCATGG + Intergenic
1075288109 10:121204578-121204600 AGTGGGATCTGTCAGTCCCAGGG - Intergenic
1075451705 10:122556484-122556506 ACAGGGAGCAGCAAGTGCAAAGG + Intergenic
1075552285 10:123401256-123401278 GGAGGCAGCTGCATGTGCCAAGG - Intergenic
1075723377 10:124599838-124599860 AATGGGGGCTGACAGTGCCATGG - Intronic
1075730279 10:124631678-124631700 AGTGGGAGCAGCAAGGGCGGAGG - Intronic
1076141968 10:128086544-128086566 CGTGGGACATGCATGTGCCAGGG - Intergenic
1076183284 10:128427288-128427310 AGTGGGAACAGCCAGTGCAAAGG - Intergenic
1076239880 10:128896589-128896611 AGCGGAAGCAGAAAGTGCCAAGG + Intergenic
1076556096 10:131322341-131322363 AATGTGAGCTGCATGTGGCAGGG + Intergenic
1077082067 11:728652-728674 AGCGGGAGCTGCAGGTTGCAGGG - Intergenic
1078102795 11:8339681-8339703 AGCGGGGGCTGCAAGAGCTAGGG + Intergenic
1079307977 11:19341097-19341119 AGAGGCAGCTGCTAGTGCAAAGG - Intergenic
1080226669 11:29969279-29969301 GGTGGCAGCTGCAGGTGGCAGGG + Intergenic
1080634832 11:34114618-34114640 AGTGGGAACAGCAAGTGCCGAGG - Intronic
1081028564 11:38047463-38047485 ACTGAGAGCTGCAAGGGACAAGG - Intergenic
1081634810 11:44714068-44714090 AGAGGGAGCAGCAGGTGCAAAGG + Intergenic
1081659533 11:44879562-44879584 AGTAGGATCGGCAGGTGCCAAGG + Intronic
1081804107 11:45880772-45880794 AGAGTGAGCTGAAAGGGCCACGG - Intronic
1082106552 11:48227743-48227765 AGTGGGAGCAGAAAGATCCAGGG - Intergenic
1083227062 11:61291900-61291922 AGCAGGAACTGCAAGTGCAAAGG - Intronic
1083621944 11:64053583-64053605 AGTGGGAGCAGGAAGTGGGAGGG + Intronic
1083684215 11:64366653-64366675 AGCAGGAGCAGCAAGTGCAAAGG - Intronic
1083687074 11:64382908-64382930 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1084581527 11:70026928-70026950 AGAGGCAGCAGCAAGTGCAAAGG - Intergenic
1085083820 11:73653702-73653724 AGAGGGATCAGCATGTGCCAAGG + Intronic
1085200085 11:74696677-74696699 AGGAGGAACTGCAAGGGCCAGGG + Intronic
1085287689 11:75374844-75374866 AGAGGGAACAGCAAGGGCCAAGG + Intergenic
1085316661 11:75549211-75549233 AGAGGGAGCTGCATGGGCAAAGG - Intergenic
1085465083 11:76717561-76717583 AGGGGAAGCAGCAAGTGCAAAGG - Intergenic
1086993884 11:93334614-93334636 AGCAGGAGCAGAAAGTGCCAAGG + Intronic
1087094798 11:94307965-94307987 GCTGGGGGCTGGAAGTGCCAAGG + Intergenic
1087883581 11:103449120-103449142 AGAGGGAACAGCAAGTGCCATGG + Intronic
1088891047 11:114044452-114044474 AGGGGGAGCAGCAAGTGCCAAGG + Intergenic
1088902237 11:114127068-114127090 AGGGGGAACTGCAAGAGCCAGGG - Intronic
1089539292 11:119180345-119180367 AGTGGGAAAAGAAAGTGCCAGGG + Intronic
1090197257 11:124827279-124827301 AGAGGGAATAGCAAGTGCCAGGG - Intergenic
1090968659 11:131620606-131620628 AGAGGGAACAGCAGGTGCCAAGG - Intronic
1091704512 12:2684723-2684745 AGCTGGATCTGCAAGAGCCAGGG + Intronic
1091818916 12:3459781-3459803 GGTGGGAGCAGAAAGTGTCAGGG + Intronic
1092507564 12:9119661-9119683 AGTGGGAGGTACAAATGACAGGG + Intergenic
1092669360 12:10845551-10845573 AGAGGGAGTTGCAAGTGCTGGGG - Intronic
1093980716 12:25472305-25472327 AGTGAGAACTCCAAGTGCAATGG + Intronic
1095939055 12:47713864-47713886 AGAGGGAACTGCAAGAGCAAAGG + Intronic
1096410350 12:51372768-51372790 TCTGTGAGCTGCAAGTGCCCAGG - Intronic
1096599343 12:52718359-52718381 AGTGGGAGCTCCCAGGGGCAGGG - Intergenic
1097312369 12:58134143-58134165 AGAGGGAACTGCATGTGCAAAGG - Intergenic
1098094197 12:66937107-66937129 AGAGGGAACAGCAAGTGCGAAGG - Intergenic
1098937063 12:76492267-76492289 AGAAGAAGCTGCCAGTGCCAAGG + Intronic
1099064692 12:77959803-77959825 AGTGAGAAATGGAAGTGCCAAGG - Intronic
1099257629 12:80333845-80333867 AGAGGGACCAGCAAGTGCAAAGG + Intronic
1099285286 12:80708541-80708563 ACTGGGAGCTGCAGGTGCGCAGG - Exonic
1099339006 12:81403526-81403548 ATTGGTTGCTGCCAGTGCCAGGG + Intronic
1099901492 12:88716266-88716288 AGTGGGTGCTCCAAATGCCTGGG + Intergenic
1100678913 12:96897897-96897919 AGAGGGAGCAGCAAGGGCCAAGG + Intergenic
1101360373 12:104020769-104020791 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1102189563 12:110976761-110976783 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1102222325 12:111202884-111202906 AGAGGGAGCAGCCAGTGCAAAGG + Intronic
1102281423 12:111621858-111621880 AGAGGGAGTGGCAAGTGCAAAGG - Intergenic
1102372311 12:112392380-112392402 AGGGGGAACAGCAAGTGCAAAGG - Intergenic
1102380925 12:112466299-112466321 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1102403075 12:112647748-112647770 AGAGGGAACTGCAGGTGCAAAGG + Intronic
1102426158 12:112845958-112845980 AGGGGGAACAGCAAGTGCAAAGG + Intronic
1102527684 12:113523696-113523718 AGGGGGAGCAGCAAGGGCAAAGG - Intergenic
1103189478 12:118988935-118988957 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1103221914 12:119253242-119253264 AGCGAGAGCAGCTAGTGCCAAGG - Intergenic
1103914876 12:124371025-124371047 GGAGGCAGCTGCAAGTGCCCTGG - Intronic
1103914939 12:124371291-124371313 GGTGGGAACAGCAAGTGCGAAGG - Intronic
1104010322 12:124925628-124925650 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1104085586 12:125471506-125471528 AGTGGGAGCTGAAAATGCAGAGG - Intronic
1104085691 12:125472348-125472370 AGTGGGAGCTGAAAATGCAGAGG - Intronic
1104085806 12:125473185-125473207 AGGGGGAACAGCAAGTGCAAAGG - Intronic
1104223581 12:126810127-126810149 AGTGGGAACAGCAGGTGCAAAGG + Intergenic
1104516502 12:129431900-129431922 AGAGGAAACTGCAAGTGCAAAGG - Intronic
1104620459 12:130308073-130308095 AGCGGGAGCTGCAGGTGCGCGGG - Intergenic
1104657179 12:130581988-130582010 AGAGGGAGCAGCAGGTGCAAAGG - Intronic
1104769738 12:131353938-131353960 AGTGGTTGCTGCAGGTGGCAGGG - Intergenic
1104903097 12:132199578-132199600 AGTGGGAGCCGCAAGGGCACAGG - Intronic
1105914446 13:24900215-24900237 AGAAGGAGCAGCAAGTGCCAAGG + Intronic
1106405672 13:29470835-29470857 AGAAGGAACTGCAAGTACCAAGG - Intronic
1106470385 13:30049192-30049214 AGAGGGAACAGTAAGTGCCAAGG + Intergenic
1106821438 13:33468833-33468855 AGTGAGAGCAGAAAGTGACATGG + Intergenic
1107560597 13:41553825-41553847 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1107898300 13:44987998-44988020 AGAAGGAACTGCAAGTGCAAAGG - Intronic
1108091000 13:46849604-46849626 AGTGGGAACAGCAAGTCCCAAGG - Intronic
1108240327 13:48457510-48457532 GGTGGGCGCTGCCAGTCCCACGG - Intronic
1110471006 13:75860508-75860530 ACAGGGAGCAGCAAGTGACAAGG + Intergenic
1118010834 14:61608910-61608932 AATGGGAGCTGCAGCTGCCCTGG - Intronic
1118381966 14:65224840-65224862 AGAAGGAGCTGCTACTGCCAGGG + Intergenic
1119198131 14:72732526-72732548 AGTGAGAGCTTCAAAAGCCACGG + Intronic
1120407725 14:84109762-84109784 AGAGGGAGCAGCAAATGCAATGG + Intergenic
1120765035 14:88321192-88321214 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1120801142 14:88690071-88690093 AGAGGGAGCAGCAAGTGCAAAGG + Intronic
1121435425 14:93916064-93916086 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1121824769 14:97001087-97001109 AGTGGGGGCTGCACGTTCCATGG - Intergenic
1122140988 14:99662925-99662947 AGTGAGATCTGCATGGGCCACGG + Exonic
1122146163 14:99690066-99690088 AATGGGAACAGCAGGTGCCAAGG - Intronic
1122149697 14:99718243-99718265 AGAGGGAACAGCATGTGCCAAGG - Intronic
1122256915 14:100485118-100485140 AGAGGGAGCAGCAGGTGCAAAGG - Intronic
1122414987 14:101545130-101545152 GATGGGAGTTCCAAGTGCCAAGG - Intergenic
1122580591 14:102769217-102769239 AGAGGGAACAGCAGGTGCCAGGG + Intergenic
1122874209 14:104656047-104656069 AGCGGGAGCTACACGTGCAAAGG + Intergenic
1124235999 15:27989896-27989918 TGTGGGAGCTGCCAGAGGCAGGG - Intronic
1125556685 15:40591607-40591629 AGAGGGAGCTGCAGGTTGCAGGG + Intergenic
1125747900 15:42009765-42009787 AGAGGGAGCTACATGTGCAAAGG - Intronic
1127868819 15:63053357-63053379 AGTGAGAACTGCCAGTTCCAAGG + Intronic
1128369864 15:67032778-67032800 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1129763123 15:78143421-78143443 ATTGGGAGCAGTAAGTGCAAAGG + Intronic
1129991178 15:79964895-79964917 AGAGGGAGCAGCAAGTGCAAAGG + Intronic
1130078148 15:80707970-80707992 AGTGGGAGCTTGCAGTGCAAGGG + Intronic
1130885591 15:88090028-88090050 AGAGGGAGCTGCTAGTGCAAAGG - Intronic
1130891670 15:88138634-88138656 AGTGGAAACAGCAAGTGCAAAGG - Intronic
1131798742 15:96047576-96047598 AGTGGGAGTTCCAAGTGGCTAGG - Intergenic
1132379024 15:101353261-101353283 ATTGTGAACTGCACGTGCCAGGG - Intronic
1132380291 15:101361530-101361552 GGAGGGAGCAGCACGTGCCAAGG + Intronic
1132934129 16:2472455-2472477 GGCGGGCGCTGCAAGTGCAATGG + Exonic
1133022643 16:2973719-2973741 AGTGGAGGCTGCCAGTGCCCAGG - Intronic
1133128577 16:3662604-3662626 AGTGGGAGCTGCAATGGCTGAGG - Exonic
1134179230 16:12034226-12034248 GGAGGAAGCTGCATGTGCCAGGG + Intronic
1134668865 16:16039835-16039857 AGAGGGAGCAGCCAGTGCAAAGG + Intronic
1135195611 16:20391899-20391921 TATGGAAGCTGCAAGTGCAAAGG + Intronic
1135305965 16:21368011-21368033 GGAGGAAGCTGCATGTGCCAGGG + Intergenic
1135651501 16:24210350-24210372 AGAGGGAGCAGCAAGTGCAAAGG - Intronic
1135665448 16:24331803-24331825 AGAGGAAACTGCAAGTGCCAAGG - Intronic
1135823749 16:25707782-25707804 GGTGGAAGCAGCAAGTGCAAAGG - Intronic
1135939674 16:26810173-26810195 AGTGGGAATGGCAAGTGCAAAGG - Intergenic
1136015740 16:27399645-27399667 AGAAGGATCTGCAAGTGCAAAGG - Intergenic
1136302705 16:29347163-29347185 GGAGGAAGCTGCATGTGCCAGGG + Intergenic
1136412992 16:30087706-30087728 AGTGGGAACAGCACGTGCAAAGG - Intronic
1136596390 16:31253119-31253141 AGAGGGAACAGCCAGTGCCATGG + Intergenic
1137548019 16:49417375-49417397 AGAGGGAGCAGCAGGTGCAAAGG + Intergenic
1137720174 16:50623087-50623109 AGAGGGAGCTGCAGGAGCAAAGG + Intronic
1137914465 16:52414019-52414041 AGTGAGAGCAGCAAATGCAATGG + Intergenic
1138195870 16:55051732-55051754 CAGGGCAGCTGCAAGTGCCAAGG + Intergenic
1138337666 16:56265964-56265986 AGAGGGAGCAGCAAGAGCAAAGG - Intronic
1138369760 16:56517407-56517429 AGAGGGATCTGCAGGTGCAAGGG - Intronic
1138371506 16:56530655-56530677 GGAGGGAACTGTAAGTGCCAAGG - Intergenic
1139403907 16:66703337-66703359 AGAGGGAACAGCATGTGCCAAGG + Intergenic
1139440683 16:66965127-66965149 AGTGGGAACTGCATCTGCAAAGG + Intronic
1139510103 16:67422762-67422784 AGTGTGAGCTTCAAATGCAAAGG - Intergenic
1139690422 16:68638223-68638245 AGAGGGAACGGCAAGTGCAAAGG + Intronic
1139747834 16:69088762-69088784 AATGGGAACAGCAAGTGCCAAGG + Intergenic
1139829858 16:69788528-69788550 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1139963267 16:70730066-70730088 AGAGGGAGCTGGGAGTGTCAGGG - Intronic
1140004664 16:71062931-71062953 AGCGGGAGATGCAGGTGGCATGG - Intronic
1140014772 16:71171180-71171202 AGCGGGAACAGCAAGTGCAAAGG - Intronic
1140031391 16:71342019-71342041 TGTGGGAACAGCAAGTGCAAAGG + Intergenic
1140119828 16:72074009-72074031 AGTGGGATGTGGCAGTGCCAGGG - Intronic
1141505032 16:84471386-84471408 AGTGCGGGCTGCCACTGCCAAGG + Intergenic
1141805225 16:86337405-86337427 AGTGGGAGCAGCAGGAGCCCTGG - Intergenic
1142215872 16:88829580-88829602 ACTGGGGGCGGCAACTGCCAAGG - Intronic
1143327158 17:6106875-6106897 AGGGGGAACAGCAAGTGCAAAGG + Intronic
1143622789 17:8090571-8090593 AGAGGGAACAGCATGTGCCAAGG - Intergenic
1144035916 17:11365984-11366006 AGAGGGAACTGCAAGTGCAAAGG + Intronic
1144693835 17:17287679-17287701 GGTGGGAGCTTTAAGTGTCAGGG + Intergenic
1145262703 17:21364366-21364388 AGAGGGAGCAGCAAGTGCAAAGG + Intergenic
1145262706 17:21364389-21364411 CGAGGGAGCAGCAAGTGCAAAGG + Intergenic
1146075676 17:29726260-29726282 AGGGGGAGCAGCATGTGCAAAGG + Intronic
1146291079 17:31607732-31607754 AGAGGGAACTGCAAATGCAAAGG + Intergenic
1146467366 17:33096827-33096849 GGAGGGAACAGCAAGTGCCAAGG + Intronic
1146492299 17:33291960-33291982 AGCGGGCGCTGCAGGGGCCAGGG - Exonic
1146662876 17:34676319-34676341 AGAGGGAACTGCAATTGCAAAGG - Intergenic
1147235070 17:39051174-39051196 AGCGGGGGCTGCCAGTCCCAGGG - Intergenic
1147895621 17:43749563-43749585 AGGGGGAGCAGCAAGTGCAAAGG - Intergenic
1148830677 17:50428964-50428986 ATTCGGTGTTGCAAGTGCCATGG + Intronic
1149451898 17:56756196-56756218 AGAGAGAGCTGCATGTGCAAAGG - Intergenic
1149544023 17:57489675-57489697 AGAAAGAGCTGCATGTGCCAGGG - Intronic
1150007024 17:61476354-61476376 AGAGGGACCTGCATGTGCAAAGG + Intronic
1151284555 17:73100579-73100601 AGAGGGTGCAGCAAGTGCAAAGG - Intergenic
1151363060 17:73600171-73600193 GGCGGGAGCTGCAATGGCCAGGG - Intronic
1151768103 17:76142352-76142374 AGTGGGAGAGGCAAGGGCTAGGG - Intergenic
1152030500 17:77839271-77839293 ACAGGGAACTGCAAGTGTCAAGG - Intergenic
1152395541 17:80030698-80030720 AGTGGGAACTGCCAGCTCCATGG - Intronic
1152417013 17:80169243-80169265 AGTGGGAACAGCAGGTGCAAAGG + Intergenic
1152469472 17:80482839-80482861 AGAGTGAGCTGCAGGGGCCAGGG + Intergenic
1153947007 18:10027264-10027286 GGTGGGAGCTGACAGTGGCAGGG - Intergenic
1154111811 18:11576150-11576172 AGTGACAGCAGCCAGTGCCATGG + Intergenic
1155116488 18:22773428-22773450 AGTGGGAGGTGCTTGTGTCATGG + Intergenic
1155505572 18:26529335-26529357 AGTTCAAGGTGCAAGTGCCAAGG - Intronic
1156457078 18:37300863-37300885 AGAGGGAGCAGCTAGTGCAAAGG + Intronic
1158023304 18:52869035-52869057 CCTGGGAGCTTCAAGAGCCAGGG - Intronic
1158587567 18:58754989-58755011 AGTGTGAGCTGCTGGTGACAGGG + Intergenic
1159837755 18:73359932-73359954 ATAGGGAGCTGCCAGGGCCAAGG - Intergenic
1160059488 18:75516296-75516318 AGAGGGAACAGCAAGTGCGAAGG + Intergenic
1160059493 18:75516324-75516346 GGTGGGAACAGCAAGTGCGAAGG + Intergenic
1161333216 19:3698027-3698049 ACTGGGAGCTGGCAGTGCCGTGG + Intronic
1161461599 19:4400725-4400747 AGGGGGCGCTGCAACTGCTACGG - Intergenic
1161496255 19:4587525-4587547 AGTGGGAACAGCAAGTGCCAAGG - Intergenic
1161899102 19:7104507-7104529 AGTGGATGCAGCAAGAGCCACGG - Intergenic
1161914568 19:7218916-7218938 AGAGGGAACAGCAAGTGCCGAGG + Intronic
1162309793 19:9899415-9899437 AGAGGGAGCTGCATGTGCAGAGG - Intronic
1162330591 19:10026857-10026879 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1162366756 19:10254413-10254435 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1162924310 19:13922389-13922411 AGTGGGAACTGCATGTGCAAAGG - Intronic
1163032946 19:14556222-14556244 AGAGGGAACAGTAAGTGCCAAGG - Intronic
1163149374 19:15401928-15401950 TGTGGGAGCTGCAACGCCCAAGG + Intronic
1163345798 19:16741275-16741297 AGGGGGAGCAGCATGTGCAAAGG - Intronic
1163352208 19:16784531-16784553 ACAGGGAGCAGCAAGTGCAAAGG + Intronic
1163576184 19:18112115-18112137 AGTGGGTACTGCATGTGCAAAGG + Intronic
1163576508 19:18113998-18114020 AGTGGGGACAGCAAGTGCAAAGG - Intronic
1163627954 19:18401669-18401691 AGTGGGAACAGCATGTGCAAAGG + Intergenic
1163665719 19:18603401-18603423 AGTGGGAGCTGCAAGTGCCAAGG + Intronic
1164576405 19:29407857-29407879 AGGCGGAGAGGCAAGTGCCAAGG - Intergenic
1164913352 19:32029899-32029921 AGTGGGAAATGCAGGTGGCAGGG - Intergenic
1165071214 19:33255949-33255971 AGAGGGAGCCACCAGTGCCAAGG + Intergenic
1165310829 19:35028606-35028628 AGTGGGTTCTGCAAATCCCAAGG + Intergenic
1165699296 19:37925389-37925411 AGTGGGAACAGCCAGTGCAAAGG + Intronic
1165751440 19:38262918-38262940 AGTGGGAGATTCAAGTGCTGGGG + Intronic
1165937982 19:39401085-39401107 AGAGGGAACTGCAAGTGCCAGGG + Intergenic
1166006915 19:39914394-39914416 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1166077955 19:40425074-40425096 AGTAGGAGCTGGTAGTGGCATGG + Intronic
1166093826 19:40527620-40527642 AGAGGGAACGGCTAGTGCCAAGG + Intronic
1166101378 19:40573341-40573363 AGAGGGAACTGCAAGTGCAGAGG + Intronic
1166113713 19:40639873-40639895 AGAGGGAACAGCCAGTGCCAAGG - Intergenic
1166219595 19:41355945-41355967 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1166658423 19:44628957-44628979 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1166673954 19:44727882-44727904 AGAGGGAACAGCAAGTGCCAAGG - Intergenic
1166822576 19:45589573-45589595 AGAGGGAACTGCAGGTGCAAGGG - Intronic
1166879888 19:45922322-45922344 AGAGGGAGCAGCCAGTGCAAAGG + Intergenic
1166889179 19:45979893-45979915 AGGGGGAGCAGCAGGTGCAAAGG + Intergenic
1166929853 19:46296026-46296048 TGTGGGAACAGCAAGTGCAAAGG + Intergenic
1167112034 19:47468259-47468281 AGGGGGAACAGCAGGTGCCAGGG - Intronic
1167154175 19:47728274-47728296 AGAGGGAGCAGCAAGTGCACAGG - Intronic
1167294561 19:48642044-48642066 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1167347788 19:48957086-48957108 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1167487888 19:49773824-49773846 AGAGGGAGCTGCCTGTGCAAAGG + Intronic
1168482565 19:56734165-56734187 AGTGGGAACAGCACGTGCAAAGG - Intergenic
1168487626 19:56777965-56777987 AGAGCGAACAGCAAGTGCCAGGG - Intronic
1168511177 19:56974688-56974710 AGTGGGCACAGCAGGTGCCAAGG + Intergenic
1168677851 19:58291845-58291867 AGAGGGAGCAGCAGGTGCAAAGG + Intronic
926037598 2:9647385-9647407 GCTGGGAGCTTCAAGTACCAGGG + Intergenic
926272794 2:11379158-11379180 AGTGGGAGTTCGAAATGCCATGG + Intergenic
927053696 2:19351825-19351847 GGTGGGAGCTGCCAGTGCTAAGG + Exonic
927109537 2:19854508-19854530 AGCGGGAGCAGTAAGTGCAAAGG + Intergenic
927253396 2:21018516-21018538 AGAGGGACCAGCAAGTGCAAAGG - Intronic
927286151 2:21359056-21359078 AGTGGGAGTTGGAGGTGCTATGG + Intergenic
927522223 2:23706018-23706040 ACTGGGAGCTCCACCTGCCAAGG - Intronic
928481994 2:31692555-31692577 AGTTTGAGCTGCTGGTGCCAGGG + Intergenic
929793509 2:45040793-45040815 AATGGGAGCTCCCAGTTCCAGGG - Intergenic
931391409 2:61847201-61847223 AGAGGGAACAGCAAGTGCAAAGG - Intronic
932255031 2:70277254-70277276 AGAGTGTGCAGCAAGTGCCATGG + Exonic
934179490 2:89607595-89607617 AGAGGGAGTGGCAAGTGCAAAGG - Intergenic
934289782 2:91681863-91681885 AGAGGGAGTGGCAAGTGCAAAGG - Intergenic
935332585 2:101988007-101988029 CCTGGGAGCTGCAACTGCCGTGG - Intergenic
936103616 2:109604745-109604767 AGTGGAATCTGCGTGTGCCAAGG + Intronic
936512487 2:113159393-113159415 AGAGGGAACAGCAAGTGCAAAGG + Intronic
936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG + Intronic
936705002 2:115061776-115061798 AGTAGGCACAGCAAGTGCCAAGG + Intronic
936964520 2:118114399-118114421 GCTGGGAGCTGGAAATGCCAAGG - Intergenic
937059391 2:118970434-118970456 AGTGTGACCTCCAAGAGCCAGGG + Intronic
937065360 2:119013039-119013061 GGAGGGAGCTGCATGAGCCAGGG + Intergenic
937415918 2:121714407-121714429 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
937977914 2:127593000-127593022 ACTGGGGGCTGGAGGTGCCAAGG - Intronic
938733554 2:134165407-134165429 AGTTGGAGCTGGAAGTGGGAAGG + Intronic
938738127 2:134205021-134205043 AGAAGGAGCAGCAAGTGCAACGG + Intronic
939609600 2:144294287-144294309 AGTGGGAGCAGCATGTGCAAAGG - Intronic
939609682 2:144295197-144295219 AGTGGGAGCAGCATGTGCAAAGG - Intronic
940012833 2:149072949-149072971 AGAGGGAACAGCAAGTGCAAAGG + Intronic
940977293 2:159960186-159960208 AGGGGGAGCTGCATGTGCTAAGG - Intronic
941375156 2:164719511-164719533 AGTGGAAGCTGGAAGAGGCAAGG - Intronic
941487896 2:166104672-166104694 AGTGGAGGCTGCATGAGCCAAGG + Intronic
941920967 2:170850428-170850450 AGTGCGAGTGGCAAGTGCAAAGG + Intronic
943688596 2:190845390-190845412 AGTGGAAGCTGAAATTCCCAAGG - Intergenic
944229566 2:197379103-197379125 AGTAGCAACTGCATGTGCCAAGG + Intergenic
945706697 2:213243559-213243581 AGTGGGAGGAGAATGTGCCAAGG + Intergenic
945939049 2:215930120-215930142 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
946015275 2:216599263-216599285 AGGGAGAGCAGCAAGTGCAAAGG - Intergenic
946112644 2:217433628-217433650 AGCGGGAGCTGCAAGCGCCCAGG - Intronic
946348015 2:219126859-219126881 AGAGGGAACGGCATGTGCCAAGG + Intronic
947286970 2:228527965-228527987 AGAGGGAACTGCAAATGCAAAGG + Intergenic
948316064 2:237029316-237029338 AGTGGGAAGTGCAAGGGACAAGG - Intergenic
948829449 2:240591050-240591072 AGTGGGAGCTGCCACTACCATGG + Intronic
1168754925 20:309888-309910 ACTGGCGGCTGCAAGTGGCAGGG + Intergenic
1168811251 20:706191-706213 GGAGGGAACAGCAAGTGCCAGGG + Intergenic
1169520938 20:6372419-6372441 AGTGGATGCTGCTAGTACCATGG + Intergenic
1169763051 20:9117751-9117773 AGGGGGAGCTGCCAATGCAAAGG - Intronic
1169801473 20:9516070-9516092 AGTCGGAGCTGCAAGTGTTCTGG + Exonic
1170098135 20:12669568-12669590 AGTAGATGCTGTAAGTGCCATGG + Intergenic
1170552858 20:17491895-17491917 AGAGAGAGCTGCAAGTGTAAAGG - Intergenic
1171945282 20:31371214-31371236 AGAGGAAGCAGCAAGTGCAAAGG - Intronic
1171956553 20:31468255-31468277 AGAGGGAGCATCAAGGGCCAAGG - Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172027767 20:31960699-31960721 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
1172096117 20:32461267-32461289 AGAGGGAACAGCAAGTACCAAGG - Intronic
1172114674 20:32566601-32566623 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1172192100 20:33068394-33068416 AGAGGGAGCAGCAAGTGCAAAGG + Intronic
1172606269 20:36216294-36216316 AGTGGGAAAAGCAAGTGCAAAGG + Intronic
1172626328 20:36349551-36349573 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1172764233 20:37342654-37342676 AGAGGGATCAGCAAGTGCAAAGG + Intergenic
1172766293 20:37352822-37352844 AGTGGGAGCTGCAGGGGCAAAGG - Intronic
1172880201 20:38194926-38194948 AGTGGGAACAGCAGGTGCCAAGG + Intergenic
1173288641 20:41694950-41694972 AGAGGGATCAGCAAGTGCAAAGG + Intergenic
1173299644 20:41790475-41790497 ACTGGGAAATGGAAGTGCCAAGG - Intergenic
1173846366 20:46191285-46191307 AGTGGGATCAGCACGTGCAAAGG + Intronic
1173850366 20:46214113-46214135 AGAGGGAGCAGCAGGTGCAAAGG + Intronic
1173866313 20:46314632-46314654 AGAGGGAGCTCCAGGTGGCAGGG - Intergenic
1173880648 20:46409405-46409427 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1173908118 20:46643448-46643470 CGAGGGGGCTGCAAGTGCAAAGG + Intronic
1174050480 20:47764070-47764092 AGAGGGAGCAGCAAGTTCAAGGG - Intronic
1174090072 20:48039683-48039705 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1174128976 20:48328479-48328501 AGTGGGAGCAGGAGGTCCCATGG + Intergenic
1174163895 20:48571143-48571165 AGAGGGACCTGCAAGTGCAAAGG + Intergenic
1174177028 20:48651673-48651695 AGTGGGAACAGCAAGTGCAAAGG + Intronic
1174202860 20:48819335-48819357 AGTGGGAGCAGCAGATGCAAAGG - Intronic
1174222434 20:48967646-48967668 AGTGGGAGTTGGAAGTGTTAAGG + Intronic
1174273954 20:49390017-49390039 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1174394691 20:50239711-50239733 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
1174428286 20:50448856-50448878 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1174574555 20:51527244-51527266 AGGGGGAGCAGCAAGTACCAAGG - Intronic
1174615506 20:51832465-51832487 AGTGGGAGATGGGAGGGCCAAGG + Intergenic
1175277955 20:57784667-57784689 AGTGGCATCAGCAAGTGCAAAGG + Intergenic
1175762162 20:61568642-61568664 AGAAGGAACAGCAAGTGCCAAGG - Intronic
1176030230 20:63008051-63008073 AGTGGGAGCTGCACGTGTGTGGG + Intergenic
1176236345 20:64055520-64055542 AGAGGGAGGAGCATGTGCCAAGG + Intronic
1178499775 21:33116075-33116097 ATGTGGAGCTGCAAGTGCCAGGG - Intergenic
1178828859 21:36038416-36038438 CATGGGAGCTGCAAGTGGCATGG - Intronic
1179120821 21:38544150-38544172 TGCGGGAGCAGCAAGTGCAAAGG + Intronic
1179324747 21:40331223-40331245 AGTGGAAGCTGATAGTGCCAAGG + Intronic
1179400215 21:41076328-41076350 AGTGGGAGGGGCAAGTGCAGCGG + Intergenic
1180034925 21:45241701-45241723 AGTGGTATCTGCAAGTTCCTCGG - Intergenic
1181618213 22:24069852-24069874 AGTGGCAGCTGCACATGTCAAGG + Intronic
1181772932 22:25139846-25139868 AGTGGGAACAGCAAGTGTGAAGG + Intronic
1181897483 22:26123290-26123312 AGTGGGAGCTGCTTGGGTCATGG + Intergenic
1182320257 22:29474190-29474212 AGTGGGAGGTGCAAGGGTCCTGG + Intergenic
1182426277 22:30274615-30274637 AGTGGGAACGGCATGTGCAAAGG - Intergenic
1182575581 22:31270814-31270836 AGGGGGTGCTGCAACGGCCAGGG + Intronic
1182706396 22:32283240-32283262 AGAAGGAACTGCAAGTGCAAAGG - Intergenic
1182905175 22:33929639-33929661 AGCCGAAGCTCCAAGTGCCAAGG - Intergenic
1183271625 22:36865883-36865905 AGGGGGAGCTTCAAGTTCCTTGG - Intronic
1183316284 22:37138800-37138822 AGTGGGATCGGCATGTGCAAGGG + Intronic
1183321670 22:37168736-37168758 AGAGGGAGCTGCAAGAGCCAAGG + Intronic
1183380310 22:37487349-37487371 GGTGGGAACAGCAAGTGCCAAGG - Intergenic
1183450442 22:37891612-37891634 ACTGGGAGCTGGAAGAGGCAGGG + Intergenic
1183694579 22:39414424-39414446 ACTGGGACCTCCAAGTACCAGGG - Intronic
1183783541 22:40015555-40015577 AGTGGGAGCTGCGTCTGCCCAGG - Intronic
1184104869 22:42361700-42361722 AGCGGGAGCAGCACGTGCAAAGG + Intergenic
1184111663 22:42399099-42399121 AGAGGGAACAGCAGGTGCCAAGG + Intronic
1184582406 22:45426472-45426494 AGGGTGAGCTGCAAGGGCAAAGG + Intronic
1184637769 22:45848833-45848855 AGAGGGAGCAGCAAGTGCAGAGG + Intergenic
949431430 3:3980217-3980239 AGTGGGAGCAGCATGTACAAAGG - Intronic
949637076 3:5994808-5994830 AATGGCATCTGCAAGTGCAAAGG - Intergenic
950178524 3:10894163-10894185 AGTGGGAGCAGCAGGACCCAGGG - Intronic
950196326 3:11011534-11011556 AGAGGGAGCAGCAAGTGCAAAGG - Intronic
950404286 3:12794995-12795017 AGAGGGAGCAGCAGGTGCAAAGG - Intergenic
950535769 3:13577343-13577365 AGAGGGAGCGGCGAGTGCAAAGG + Intronic
950548740 3:13654098-13654120 AGAGGGACCGGCAAGTGCAAAGG - Intergenic
950721564 3:14886495-14886517 AGTGGCAGCAGCAGGTGCCATGG + Intronic
951607673 3:24453850-24453872 AGAGGGAGCAGCATGTGCAAAGG - Intronic
951861021 3:27252746-27252768 AAAGGGAGCTGCATGTGCAAAGG + Intronic
952105012 3:30059438-30059460 AGAAGGAACTGCAAGTGCAAAGG - Intergenic
952970022 3:38644895-38644917 AGAGGGAACTGCAAGTGCAAAGG - Intronic
953903178 3:46854711-46854733 GATGGGAGCAGAAAGTGCCATGG - Intergenic
954383027 3:50229659-50229681 AGAGGCAGCAGCAAGTGCAAGGG - Intronic
955040231 3:55309555-55309577 AGAGGCAACAGCAAGTGCCAGGG + Intergenic
955317031 3:57947780-57947802 AGTGGGAACAGCATGTGCAAGGG + Intergenic
955854212 3:63255775-63255797 AGTGTGAGCAGGAAGTGCAAGGG + Intronic
955886563 3:63605399-63605421 AGAGGGAACAGCAAGTGCAAAGG + Intronic
956718254 3:72097191-72097213 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
956796840 3:72725398-72725420 AGAGCGAGCAGCAAGTGCAAAGG - Intergenic
957013313 3:75033065-75033087 AGTGGGACCTGAAATTGCTAGGG - Intergenic
959575030 3:107925147-107925169 ATGGGGAGCTGAAAGTGGCAAGG + Intergenic
960764694 3:121112397-121112419 CCTGGGAGCTGCAAGTAACAAGG - Intronic
961057256 3:123799653-123799675 AGAGGGAGCTGTCAGTGCCTGGG - Intronic
961744753 3:129057394-129057416 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
961786261 3:129348876-129348898 AGTGGGAACAGCATGTGCAAAGG + Intergenic
963115236 3:141723319-141723341 AGAAGGAACAGCAAGTGCCAAGG + Intergenic
963255939 3:143145051-143145073 AGAGGGCACTGCAAGTGCAAAGG - Intergenic
963460046 3:145600498-145600520 GGTGGTAGCTGGAAGTGCCTTGG - Intergenic
965670094 3:171138977-171138999 AGTGGAAGCTGCATGAGCAAGGG + Intronic
965738614 3:171849147-171849169 TGTGGGAGCAGCATGTGCAAAGG - Intronic
966749440 3:183307912-183307934 AGAGCGAGCTGCAGGTGCAAAGG - Intronic
967135871 3:186512164-186512186 AGAGGGAACAGCAAGAGCCAAGG + Intergenic
967938545 3:194748493-194748515 AGGGGGAGCTGCAGATGCAAAGG - Intergenic
967949734 3:194831630-194831652 AGAGGGAGCTGCATCTGCAAGGG + Intergenic
968501036 4:950184-950206 GGTGGGGGCTGCAGGTGCCAGGG + Intronic
968543175 4:1178547-1178569 AGGGAGAGCTGCACGTGCAAAGG - Intronic
968744988 4:2355090-2355112 AGTGGGAACCTCACGTGCCAAGG - Intronic
969126478 4:4951944-4951966 TGGGGGAGCTGCATGTGGCAGGG - Intergenic
969664362 4:8548559-8548581 ACTGGGAGCACCAGGTGCCAAGG - Intergenic
969706298 4:8794074-8794096 AGCAGGAGCTGGAACTGCCAGGG - Intergenic
969860538 4:10032315-10032337 AGAAGGAGCAGCAAGGGCCAGGG + Intronic
971313860 4:25550528-25550550 AGAGGGAACAGCAAGTGCAAGGG + Intergenic
971374189 4:26043286-26043308 AATGGGAGCTGGAACTGCCGTGG - Intergenic
972663411 4:41140776-41140798 ATTGTGAACTGCACGTGCCAGGG + Intronic
973302544 4:48604300-48604322 AGAAGGAGCTGCATGTGCAAAGG + Intronic
974385779 4:61201089-61201111 AGGGGGAGCCGCGAGGGCCAGGG - Intergenic
975372020 4:73599965-73599987 AGAGGGATCAGCAAGTGCAAAGG - Intronic
977669909 4:99683694-99683716 AGAGGCAGCTGCAAGTCACATGG + Intergenic
977869970 4:102079932-102079954 AGAGAGAACAGCAAGTGCCAAGG + Intergenic
977978047 4:103289921-103289943 AGTGAGAGATGCAAGTGCATTGG + Intergenic
978128766 4:105168401-105168423 AGAGGGAACAGCAAGTGCAAAGG - Intronic
978257427 4:106709395-106709417 AGAGCGAGATGCAAGTGCTAAGG - Intergenic
979626942 4:122855593-122855615 AGCTGGAGGTGGAAGTGCCATGG - Intronic
981674003 4:147320145-147320167 AGTTGTAGCTTCAAATGCCATGG - Intergenic
981741394 4:148006092-148006114 AGTGGCAGCTGCCAGTGTTAGGG - Intronic
982537569 4:156625865-156625887 AGTTGGAGTTGAAAGGGCCAAGG - Intergenic
982786789 4:159545524-159545546 TGAGAGAGCTGGAAGTGCCATGG - Intergenic
983262320 4:165470579-165470601 ATTGGTTGCAGCAAGTGCCAGGG - Intronic
983332749 4:166352393-166352415 AGTGGGATCTAGAAGTGCCCAGG - Intergenic
984376846 4:178942263-178942285 ACTGTGAACTGCACGTGCCAGGG + Intergenic
986627074 5:9732194-9732216 ACTGGAAGCAGCAAGAGCCAAGG + Intergenic
986700752 5:10406080-10406102 ATTGGGAACTGCGAGTGCGAGGG + Intronic
987264766 5:16241727-16241749 AGTGAGAGATGAAACTGCCAAGG + Intergenic
987360917 5:17105715-17105737 AGAGGGAACAGCAAGTGCAAAGG + Intronic
988502299 5:31793389-31793411 AGAGGGAACTGCAGGTGCAAAGG - Intronic
989628325 5:43454706-43454728 AGGGGGAGCTGCAAGATCTAGGG - Intronic
990462219 5:56039833-56039855 AGTGGGAGTAGCAAGTCCAAAGG - Intergenic
991336620 5:65555321-65555343 AGAGGGAACTGCAAGTGCAAAGG + Intronic
991469757 5:66955336-66955358 AGTGGGAACTGTAAGTGCAAAGG + Intronic
991728306 5:69559192-69559214 AAAGAGAGCTGCAAGTGCAAAGG - Intergenic
991804735 5:70414339-70414361 AAAGAGAGCTGCAAGTGCAAAGG - Intergenic
991866649 5:71068683-71068705 AAAGAGAGCTGCAAGTGCAAAGG + Intergenic
994220170 5:97186347-97186369 AGTAGGAGCTGCAAAAGGCAAGG - Intergenic
994743460 5:103649474-103649496 AGAGGGAGCAGCAAGTGGAAGGG + Intergenic
995332409 5:110959898-110959920 AGAGGGAACAGCAAGTGCCAAGG + Intergenic
995347514 5:111137530-111137552 AATAGGAGTTGTAAGTGCCATGG - Intergenic
995550980 5:113280918-113280940 AGTGGGAGGTGGAAGAGCCTAGG + Intronic
996340519 5:122433917-122433939 GTTGGGAGCTGCAGCTGCCACGG - Intronic
996949087 5:129103542-129103564 AGAGGGAGATTAAAGTGCCAGGG + Intronic
997091322 5:130862311-130862333 AGTGAGAGCTGCCAATGCCAAGG - Intergenic
997240399 5:132302329-132302351 AGGGGGAGCTGCAGGTACCTTGG + Intronic
998485468 5:142498189-142498211 AGTGAGATCAGCATGTGCCAAGG + Intergenic
998644019 5:144042395-144042417 ACTGGGAGCGGCACGGGCCACGG + Intergenic
999190850 5:149746176-149746198 AGAGGGAACAGCAAGTGCAAAGG - Intronic
999250810 5:150181207-150181229 AGAGGGAACAGCAAGTGCAAAGG - Intronic
999324587 5:150635842-150635864 AGAGGGAACAGCAAGTGCTAAGG - Intronic
999735097 5:154506914-154506936 AGAGGGAACTACAAGTGCAAAGG - Intergenic
1000192518 5:158925072-158925094 AGTGGGAACAGCATGTGCAAAGG - Intronic
1001283752 5:170407208-170407230 GGGGGAAGCTGCACGTGCCATGG + Intronic
1001570261 5:172726070-172726092 AGTGGGAATAGCAAGTGCAAAGG - Intergenic
1001955304 5:175844658-175844680 CGAGGGAGCAGCAAGTGCGAAGG + Intronic
1002063171 5:176638616-176638638 AGAGGAAACTGCAAGTGCAAAGG + Intronic
1002077018 5:176714318-176714340 AGGGGGAGCAGCAACTGCAAAGG - Intergenic
1002434232 5:179221367-179221389 AGAGGGAGCTGAAAGTACCAGGG + Intronic
1002473756 5:179452573-179452595 TGAGGGAGCTGCAGCTGCCAGGG - Intergenic
1002550865 5:179990632-179990654 AGCGGTAGCTGTCAGTGCCAAGG - Intronic
1002570768 5:180138119-180138141 AGTGGGAGCTGCTGGTCCCGGGG + Exonic
1003276512 6:4658592-4658614 AGAGGGAGCAGGAAGTGCGAAGG + Intergenic
1003480327 6:6525302-6525324 CCTGAGAGCTGGAAGTGCCAGGG - Intergenic
1004017323 6:11744032-11744054 AGTGGGAGGTGCTTGGGCCATGG + Intronic
1006447655 6:34088877-34088899 AGTGGGGAATGCCAGTGCCAGGG + Intronic
1007416071 6:41691952-41691974 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1007498327 6:42277152-42277174 AGTGGGAGCTGCAGGAGTCTAGG + Intronic
1008737961 6:54570381-54570403 TGTTGTAGCTGCAAGTGCCAGGG + Intergenic
1010573658 6:77507542-77507564 ACTGGGATCTCCAAGTGCAATGG + Intergenic
1012011629 6:93794868-93794890 AGTGGGAGGTGAAAAAGCCATGG + Intergenic
1012828625 6:104179234-104179256 AGAGGGAGCAGCAAATGCAAAGG - Intergenic
1013071305 6:106731813-106731835 AGAGGGAGCAGCACGTGCAAAGG - Intergenic
1013636964 6:112038266-112038288 AGTCGGAGGTTCAAGTGCCAAGG - Intergenic
1014773638 6:125484666-125484688 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1015000622 6:128209962-128209984 ACAGGAAGCTGCCAGTGCCAGGG + Intronic
1015502453 6:133948482-133948504 AATGGGAGCTGCAATAGCCACGG - Intergenic
1015917468 6:138232178-138232200 TGTGGGAGCAGAAATTGCCAAGG + Intronic
1016441994 6:144094201-144094223 AGAGGGAACTGCCAGTGCAATGG - Intergenic
1016911242 6:149201285-149201307 ACAGGGAGCTGCGGGTGCCAGGG - Intergenic
1017323342 6:153118075-153118097 AGAGGGAGTGGCAAGTGCCAAGG + Intronic
1017815401 6:158012507-158012529 TCTGGGAGCTGCAAGAGACAAGG + Intronic
1017908886 6:158776053-158776075 AGTGGGACCTGCGAGTCTCAAGG - Intronic
1018170156 6:161138096-161138118 CGGGGCAGCTGCAGGTGCCAGGG - Intronic
1018285148 6:162229675-162229697 AGAGGGAATGGCAAGTGCCAAGG - Intronic
1021073369 7:16271509-16271531 AGTGGGAGTAGCAAGAGACAAGG - Intronic
1022525375 7:31033783-31033805 ACTGGAAGCTTCTAGTGCCAGGG - Intergenic
1022597343 7:31725139-31725161 AGTGGGAGATGCGGGTGGCAAGG - Intergenic
1023357753 7:39384601-39384623 AGAGGGAGCAGCAAGTGCAAAGG - Intronic
1023710570 7:42988055-42988077 AGTGGGAGCAGCAACTGACGTGG - Intergenic
1023996783 7:45163439-45163461 AGTGGGAGCTGCTGGTGTCCAGG + Intronic
1024343815 7:48292649-48292671 TGCGGGAGCAGCAAGTGCAAAGG - Intronic
1024656673 7:51456752-51456774 AGAGGGAACTTCAATTGCCAAGG - Intergenic
1025253743 7:57369244-57369266 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1026168725 7:67934302-67934324 AGTAGAGGCAGCAAGTGCCAAGG + Intergenic
1026911699 7:74094932-74094954 AGGGGGAGCAGAAAATGCCAGGG - Intronic
1026959032 7:74397015-74397037 TGTGGGAGCTGGAGGAGCCAGGG + Intronic
1026960289 7:74403703-74403725 AGAGCGAACTGCATGTGCCAAGG - Intronic
1027229780 7:76265400-76265422 TGTGGGAGCTGCCACTGCTATGG - Exonic
1029406174 7:100375105-100375127 AGTGGGGGCTGCAGGGGCCAGGG - Intronic
1029977152 7:104845626-104845648 GCTGACAGCTGCAAGTGCCAGGG - Intronic
1030065026 7:105652849-105652871 ACTGGGAGCAGCAGGTGTCAGGG - Intronic
1030764203 7:113389022-113389044 AGTGAGAACTGTAAGTGCAAAGG + Intergenic
1030869088 7:114733560-114733582 AGTTGCAGCTGCCAGTGCCAAGG - Intergenic
1032331770 7:130987161-130987183 AGAGGGACCAGCAAGTGCAAAGG + Intergenic
1032448101 7:132001975-132001997 AGAGGGAGCAGCATGTGCAAAGG + Intergenic
1033145640 7:138868383-138868405 AGTGGGAGCTATTAGTCCCATGG + Intronic
1033761502 7:144441124-144441146 AGAGGGAACAGCTAGTGCCAAGG + Intergenic
1034356891 7:150457963-150457985 AGAGGGAGCAGCAAGTTCAAAGG - Intronic
1034612490 7:152384391-152384413 AGAGGGAGCAGCATGTGCAAAGG - Intronic
1037575115 8:20195243-20195265 AGAGGGTTTTGCAAGTGCCAAGG - Intergenic
1037822504 8:22141736-22141758 GGTGGGAGCTGTAACTGCCCCGG - Exonic
1038177659 8:25195600-25195622 AGAGGGAGGAGTAAGTGCCAAGG - Intronic
1038381539 8:27099489-27099511 AATGGGAACAGCTAGTGCCAAGG - Intergenic
1038608189 8:29031969-29031991 AGTGGGAGCACCATGTGCAAAGG + Intronic
1039567090 8:38559544-38559566 AGTGGGAGCACCCAGAGCCAGGG - Intergenic
1039881741 8:41629593-41629615 AGTGGGAGTTTCATGGGCCACGG - Intergenic
1041182589 8:55264138-55264160 AGTGAGAACAGCAGGTGCCAAGG - Intronic
1041361201 8:57056013-57056035 AGGGGGAGCAGCATGTGCGAAGG + Intergenic
1042866321 8:73359573-73359595 ACTGTGAGCTGTAACTGCCAAGG - Intergenic
1044808373 8:96032162-96032184 AGAGGGAGCAGCACGTGCAAAGG + Intergenic
1045384241 8:101655956-101655978 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1045878659 8:107012699-107012721 AGTGGGAACAGCAAGTACAAAGG + Intergenic
1046320422 8:112567189-112567211 AGAGGGAGTAGCAAGTGCGAAGG - Intronic
1046841167 8:118858629-118858651 AGAGGGAGCAGCAAGTGCAAAGG - Intergenic
1047304510 8:123642104-123642126 AGTGGCAACTGCACATGCCAAGG + Intergenic
1048014180 8:130483004-130483026 AGAGGAAACTGCAAGTGCAAAGG + Intergenic
1048758619 8:137767009-137767031 AGTGGAAGCTTCCACTGCCAAGG + Intergenic
1049248756 8:141577103-141577125 AGTGGGGGCTGGGGGTGCCAGGG - Intergenic
1049953444 9:668880-668902 ATTGTGAACTGCAAGTGCGAAGG - Intronic
1050063868 9:1738238-1738260 AGTAGAAGCTGAAAGTGCAAGGG - Intergenic
1051173117 9:14339528-14339550 AGTGAGAGCAGCAAGAGCCATGG - Intronic
1051364776 9:16313882-16313904 AATGGAAGCTGGAAATGCCAGGG - Intergenic
1051746228 9:20297593-20297615 GGTGGGGGCTGCCATTGCCATGG - Intergenic
1051801191 9:20936363-20936385 AGTGGTAGCTGCATGTGTAAAGG + Intronic
1052851455 9:33380849-33380871 AGGGGGAGCTGGAGGGGCCATGG - Intergenic
1053412003 9:37921983-37922005 AGGAGGGGCTGCAGGTGCCAGGG + Intronic
1053797820 9:41742062-41742084 AGTGGGGGCTGCGTGTCCCAGGG - Intergenic
1054186233 9:61954115-61954137 AGTGGGGGCTGCGTGTCCCAGGG - Intergenic
1054467115 9:65503933-65503955 AGTGGGGGCTGCGTGTCCCAAGG + Intergenic
1054652270 9:67634408-67634430 AGTGGGGGCTGCTTGTCCCAAGG + Intergenic
1055893027 9:81143358-81143380 GGTGGGAGCTTTAAGAGCCACGG - Intergenic
1056132760 9:83601932-83601954 AGAGAGAGCAGCAAGTGCAAGGG + Intergenic
1056760602 9:89411982-89412004 AGAGGGAGCAGCAAGTGCCAAGG - Intronic
1057130073 9:92648858-92648880 AGTGGGGGCTGGATGGGCCAGGG - Intronic
1057384230 9:94593480-94593502 TGTGGGAGCTGCAGGTGCTTTGG - Intronic
1057770039 9:97959297-97959319 AGAGGGAGCTGCAAGTACAAAGG + Intergenic
1057786552 9:98092393-98092415 AGAGGGCACAGCAAGTGCCAAGG - Intronic
1057816965 9:98303094-98303116 AGTTGCAGCTGCGAGAGCCAGGG - Intronic
1059422772 9:114202726-114202748 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1059457693 9:114410048-114410070 AGTGAGAGCGGCAGGTGCAAAGG - Intronic
1059595685 9:115717976-115717998 TGTGGGAACTGGAAATGCCAGGG - Intergenic
1059984987 9:119813028-119813050 AGAGGGAACTGCATGTGGCAAGG + Intergenic
1060494137 9:124105541-124105563 AATGGGAACAGCAAGGGCCAAGG - Intergenic
1060749188 9:126157662-126157684 GGTGGGAGCTGCAGGAGGCAGGG + Intergenic
1060861041 9:126954996-126955018 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1060866888 9:127007628-127007650 AGAGGGAGCAGCATGTACCAAGG + Intronic
1060975596 9:127763088-127763110 AGAGGGAACAGCAAGTGCGAAGG - Intronic
1061205474 9:129160714-129160736 AGAGGGAACAGCAAGTACCAAGG + Intergenic
1061772044 9:132932740-132932762 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1061905502 9:133694640-133694662 GGTGGGAGGGGCCAGTGCCAAGG - Intronic
1062032430 9:134367724-134367746 AGGGGGAGCTGCAGGTGCTAAGG - Intronic
1062429401 9:136520281-136520303 GGTGGGAGCTCCAAGGGCAACGG - Intronic
1186092304 X:6062968-6062990 AGAGGGAACAGCCAGTGCCAAGG - Intronic
1186747130 X:12581765-12581787 AGAGGGAACTGCAAATGCAAAGG - Intronic
1187041827 X:15604447-15604469 AGAGGGAGCAGCAAGTGTAAAGG + Intergenic
1187203109 X:17154978-17155000 AGAGAGAGCTGCATGTGCTAAGG + Intergenic
1187452553 X:19411725-19411747 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1187498233 X:19814568-19814590 AGTGGGAACGGCACGTGCAAAGG - Intronic
1188088156 X:25928355-25928377 GGAGGGAGCTGATAGTGCCACGG - Intergenic
1188662953 X:32782438-32782460 AGTTGGAACAGCAAGTGCTAAGG + Intronic
1189150311 X:38699773-38699795 AGTGGGTGGGGCAAGTGTCAAGG + Intergenic
1189856365 X:45229036-45229058 GGTTGGAGCTGCTAGTCCCATGG - Intergenic
1191718608 X:64210325-64210347 AGAGGGAGCAGCCAGTGCAAAGG - Intergenic
1192275413 X:69625354-69625376 AGTAGGAACAGCAAGTGCAAAGG + Intronic
1192551982 X:72061796-72061818 AGAGGGAACAGAAAGTGCCAAGG - Intergenic
1192631099 X:72778292-72778314 AGTGCCAGTTGCCAGTGCCAGGG + Intronic
1192650610 X:72942509-72942531 AGTGCCAGTTGCCAGTGCCAGGG - Intronic
1195304157 X:103562664-103562686 AGTGGGAGCAGCATGTGCAAAGG - Intergenic
1195411383 X:104570353-104570375 ACTTGGAGCTGCAAGTGCCAAGG + Intronic
1195427985 X:104756852-104756874 AGTGGAAGCATCAAGTGCAAAGG + Intronic
1195659476 X:107363895-107363917 AGTGGGAGGTGTTAGTGTCATGG - Intergenic
1196748997 X:119097625-119097647 TGTGAAAGCTGCAAGTACCAAGG - Intronic
1198507688 X:137317578-137317600 AGAGGAAACTGCAAGTGCAAAGG - Intergenic
1199236576 X:145500595-145500617 AGTGGTAGCTGCAAGACCCCAGG + Intergenic
1199259863 X:145759858-145759880 AGAGGGAACACCAAGTGCCAAGG + Intergenic
1199767792 X:150953535-150953557 AGTGGGGGCTGATAGTGTCAGGG + Intergenic
1200137624 X:153882743-153882765 AGGGGCAGCTGCGAGGGCCAGGG - Intronic
1201755704 Y:17483652-17483674 AGTGGCATCTGCAAATCCCAGGG + Intergenic
1201845848 Y:18422333-18422355 AGTGGCATCTGCAAATCCCAGGG - Intergenic