ID: 1163665894

View in Genome Browser
Species Human (GRCh38)
Location 19:18604028-18604050
Sequence GGCCCCCCCAACAGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163665889_1163665894 -9 Left 1163665889 19:18604014-18604036 CCGCTTCCTGCCTGGGCCCCCCC 0: 1
1: 1
2: 6
3: 113
4: 1020
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665881_1163665894 4 Left 1163665881 19:18604001-18604023 CCCGGCCCACCCACCGCTTCCTG 0: 1
1: 0
2: 7
3: 39
4: 495
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665887_1163665894 -5 Left 1163665887 19:18604010-18604032 CCCACCGCTTCCTGCCTGGGCCC 0: 1
1: 0
2: 4
3: 38
4: 455
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665885_1163665894 -2 Left 1163665885 19:18604007-18604029 CCACCCACCGCTTCCTGCCTGGG 0: 2
1: 0
2: 6
3: 64
4: 566
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665882_1163665894 3 Left 1163665882 19:18604002-18604024 CCGGCCCACCCACCGCTTCCTGC 0: 1
1: 0
2: 8
3: 54
4: 604
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665880_1163665894 5 Left 1163665880 19:18604000-18604022 CCCCGGCCCACCCACCGCTTCCT No data
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665888_1163665894 -6 Left 1163665888 19:18604011-18604033 CCACCGCTTCCTGCCTGGGCCCC 0: 1
1: 0
2: 11
3: 84
4: 792
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665883_1163665894 -1 Left 1163665883 19:18604006-18604028 CCCACCCACCGCTTCCTGCCTGG 0: 1
1: 1
2: 6
3: 39
4: 409
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1163665879_1163665894 17 Left 1163665879 19:18603988-18604010 CCAGCGTCTCTGCCCCGGCCCAC 0: 1
1: 0
2: 1
3: 28
4: 373
Right 1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163665894 Original CRISPR GGCCCCCCCAACAGAGTGGG AGG Intronic
900475984 1:2876618-2876640 AGGCTCCCCATCAGAGTGGGAGG + Intergenic
901763684 1:11486933-11486955 TGCCACCCCAGCACAGTGGGAGG - Intronic
903131229 1:21280670-21280692 GGCCCCACCAACAGCCTGAGGGG + Intronic
907430657 1:54409380-54409402 GTCTCCCCCACCAGACTGGGAGG + Intronic
909997253 1:82295658-82295680 CCCACCTCCAACAGAGTGGGTGG + Intergenic
910240222 1:85078521-85078543 GGAGCCTCCAGCAGAGTGGGAGG - Intronic
912572625 1:110635600-110635622 GACCCCCCAAACCCAGTGGGAGG - Intergenic
915505982 1:156356881-156356903 AGCCCAGCCAAGAGAGTGGGGGG + Intronic
915941879 1:160123467-160123489 TGAACCCCCAACACAGTGGGGGG + Intronic
922724058 1:227914438-227914460 GGCCTCCCCAGCAGGGAGGGAGG - Intergenic
923040983 1:230319543-230319565 AGCCCCCCCAACAGTGAGGGGGG - Intergenic
924531807 1:244899997-244900019 GGTACCCCCAGCAGAGTGGATGG - Intergenic
924562942 1:245172203-245172225 ACCCCCCCCACCAGACTGGGAGG - Intronic
1069834636 10:71300947-71300969 GGCCCCTCGAACAGGTTGGGTGG - Exonic
1071273988 10:84036028-84036050 GGCCCTCCCAACACTGCGGGCGG + Intergenic
1071522925 10:86342045-86342067 GGCCCCTCCAACTGAGGGGCTGG + Intronic
1073036809 10:100569862-100569884 AGCGCCCCCAACAGTCTGGGGGG - Intergenic
1074823519 10:117198675-117198697 AGCCCCCACACCAGAGTGGGAGG - Intronic
1075781324 10:125018974-125018996 GTCCCCACTGACAGAGTGGGCGG - Intronic
1076353012 10:129831618-129831640 GGCCCTCCAAACCGTGTGGGTGG + Intergenic
1076391611 10:130107648-130107670 GGACCCTCCAACAGAGTTGCGGG - Intergenic
1076777830 10:132707866-132707888 GCCCACCCCAACAGTGTGTGTGG - Intronic
1077502851 11:2917069-2917091 GACCCCCCCAATGGGGTGGGTGG + Intronic
1081622859 11:44629140-44629162 GGCCCTCCCCACAGAGAGGGCGG - Intergenic
1081667157 11:44923323-44923345 TGCCCACCCAGCAGAGAGGGAGG + Intronic
1084435406 11:69136552-69136574 GGCCTCCCCAACTGAGGGGCAGG - Intergenic
1089508289 11:118979512-118979534 GGGCCCCCCTCCAGAGTCGGAGG + Exonic
1089978822 11:122755622-122755644 GGCCTCCCTCACAGAGTGGGAGG - Intronic
1090828031 11:130401597-130401619 GGTCCCGCGAACGGAGTGGGTGG - Intergenic
1091840009 12:3614006-3614028 GGCCCCCACAGGAAAGTGGGTGG - Intronic
1094819633 12:34214408-34214430 GGCCCCCAAATCACAGTGGGTGG + Intergenic
1096474112 12:51897443-51897465 GTCCCACCCACCAGAGTGGCTGG + Intergenic
1096630875 12:52926052-52926074 GGCCCCCTCTGCAGAGTGGAAGG + Intronic
1100240172 12:92703291-92703313 GGCTTCCCCAACAGTGTGGGTGG + Intronic
1105306934 13:19175499-19175521 GTCTCCCCCAACAGAGACGGTGG - Intronic
1109201809 13:59439829-59439851 GGCCCCCACAGCACAGTGGCAGG - Intergenic
1110892455 13:80707712-80707734 AGGACCCCCATCAGAGTGGGGGG + Intergenic
1115285934 14:31712575-31712597 GGCCCCCACAGCACAGTGGCGGG + Intronic
1116008239 14:39320993-39321015 GGACCCTCCAACAAAGTTGGAGG - Exonic
1119656389 14:76420260-76420282 GGCCCCCCCAGCAGATGGTGAGG + Intronic
1123059107 14:105586418-105586440 GGCCCCACCACCCTAGTGGGTGG - Intergenic
1123083436 14:105706649-105706671 GGCCCCACCACCCTAGTGGGTGG - Intergenic
1136618370 16:31412022-31412044 GGACCCCCAAACAGAGAAGGGGG - Intronic
1141341725 16:83209885-83209907 GGCATCCCCAGCAGAGTAGGTGG + Intronic
1141623618 16:85249992-85250014 GGACCCCGCAACAGCTTGGGAGG - Intergenic
1141703212 16:85651757-85651779 GGCCTCCCCACCAGCCTGGGAGG + Intronic
1142293331 16:89202526-89202548 GGCCCCCCCAACAGTGTTGCGGG + Intergenic
1143128987 17:4664225-4664247 GGCCACCCCAACAGAGGCAGAGG - Intergenic
1144137713 17:12314401-12314423 GTACCACCCAATAGAGTGGGTGG - Intergenic
1144637964 17:16923115-16923137 AGCCCCCTCCACAGTGTGGGCGG + Intergenic
1146950065 17:36899711-36899733 GCCTCCCCCCACAGACTGGGAGG - Intergenic
1147667802 17:42159829-42159851 GGCTCCCCTCACAGAGGGGGAGG + Exonic
1151712339 17:75813881-75813903 GGGCCCCACAGCAGGGTGGGGGG + Intronic
1152314551 17:79572541-79572563 AGCCCTCTCAACAGGGTGGGGGG + Intergenic
1152891387 17:82883559-82883581 GGCCCCTTCCACAGAGTGGCAGG - Intronic
1155673325 18:28398643-28398665 GGCCCTCCAAAGAGAGTAGGTGG - Intergenic
1159289258 18:66395741-66395763 GGCCCCCACAGCACAGTGGCAGG - Intergenic
1160033743 18:75283077-75283099 GGCCTCCCGCACACAGTGGGAGG + Intronic
1160726003 19:618075-618097 GGCTCCCACAGCAGCGTGGGGGG - Intronic
1161173047 19:2822923-2822945 GGCCCCCCATACACAGAGGGAGG - Intronic
1162481407 19:10928948-10928970 GGCCGCCGCGACAGGGTGGGTGG + Intronic
1162519968 19:11173993-11174015 GCCCCCCCCATCAGACTGGAAGG + Intronic
1162554146 19:11375893-11375915 GGGCCCCAGAACAGAGTGGTGGG + Exonic
1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
926801566 2:16664925-16664947 GGCACCCCCAAAACAGTGGCTGG + Intronic
927114254 2:19885920-19885942 GGCACCCCCAGGAGAGTGAGGGG - Intergenic
931459886 2:62441472-62441494 GGCTCCCTCAAAAGAGTAGGGGG - Intergenic
937900037 2:127012668-127012690 GGCCCACCCAAGAGCATGGGGGG - Intergenic
940919525 2:159291475-159291497 GGCCCCCCCACCAAAGTGCTGGG + Intergenic
943298922 2:186173087-186173109 GGCCACCCCAACAGCTTGGTTGG - Intergenic
945674113 2:212834201-212834223 GGCATTCCCAACAGTGTGGGAGG - Intergenic
946369227 2:219270472-219270494 GGCCCCCCGATCAGAGTGCAGGG - Intronic
946647253 2:221851064-221851086 TGCCCACCCAAGAGAGTTGGGGG + Intergenic
947793548 2:232880815-232880837 AGCACCCCCATCACAGTGGGAGG - Intronic
1169407075 20:5330660-5330682 GGTCCCACCAACAGAATGGATGG - Intergenic
1173822565 20:46028909-46028931 GGCCCCGCCCGGAGAGTGGGTGG + Intronic
1175934366 20:62508262-62508284 GTCCGCCCCAGCAGAGGGGGTGG + Intergenic
1176024300 20:62978028-62978050 GGCCGCCCCAGCAGGGTGGTGGG - Intergenic
1180967295 22:19797302-19797324 GCCCAGCCCAGCAGAGTGGGCGG + Intronic
1183462624 22:37961392-37961414 GGCCAGTCCAGCAGAGTGGGGGG + Intronic
949292698 3:2484833-2484855 GGCCCCCACAGCACAGTGGCAGG - Intronic
950472084 3:13192707-13192729 GGCCTCCATAACAAAGTGGGTGG - Intergenic
954083127 3:48224109-48224131 TGCCCCCACCCCAGAGTGGGAGG + Intronic
954448039 3:50557154-50557176 GGCCCACCCAACAGGGTGGGAGG + Intergenic
961513823 3:127420573-127420595 GGGCCCCCCAGCAGAGTGCTGGG - Intergenic
961735031 3:128995921-128995943 AGACCCCCCAACTGGGTGGGAGG - Intronic
967506286 3:190256295-190256317 GGCCTGAGCAACAGAGTGGGAGG + Intergenic
968915374 4:3494928-3494950 GGCACCCACAACAGGGTGGCGGG - Intronic
969349388 4:6589594-6589616 AGCCTCCCCAGCAGAGTGGGTGG + Intronic
975033948 4:69658366-69658388 GGCCCCCACAGCACAGTGGTGGG + Intergenic
979918858 4:126474004-126474026 AGCCCCCCCAACTGACTGAGTGG - Intergenic
982773640 4:159420819-159420841 GGCCCCCACAGCGCAGTGGGGGG - Intergenic
983223231 4:165062780-165062802 GGCCTCCCAAACAGAGTGCTAGG + Intergenic
983937029 4:173509345-173509367 GGCCTCCAGGACAGAGTGGGAGG - Intergenic
984021270 4:174487274-174487296 TGCCACCCCAAGAGAGTGGAGGG - Intergenic
987689684 5:21251050-21251072 GGGACCCCCAACAGAGTGACTGG + Intergenic
988629063 5:32909770-32909792 TGCCCCTCCAAGAGAGGGGGCGG - Intergenic
995853398 5:116570328-116570350 AGGCACCCCAAGAGAGTGGGGGG + Intronic
1002639051 5:180621995-180622017 GGCCCCTCCAGGAGAGAGGGAGG - Intronic
1004259595 6:14096476-14096498 CGCCCACCCACAAGAGTGGGTGG + Intergenic
1006088897 6:31616241-31616263 GGCCCACCTACCACAGTGGGAGG + Intronic
1007327207 6:41072164-41072186 GCACCCCCCAAAAAAGTGGGGGG - Intronic
1014290480 6:119552260-119552282 GGCCACCCCCACAGTTTGGGAGG - Intergenic
1016184632 6:141183436-141183458 GGCCCCCACAGCACAGTGGTGGG - Intergenic
1016972674 6:149779047-149779069 GGGCCCCGCACCAGAGTGGGGGG - Intronic
1017051534 6:150398241-150398263 GGGCCCCCCAAGGGAGTGGCAGG + Exonic
1020257288 7:6509230-6509252 GACCCCCCGAACACAGCGGGTGG + Exonic
1021201392 7:17731981-17732003 GGCCCCCCAAAATGAGTGTGTGG - Intergenic
1021785391 7:24146453-24146475 GGCCCCCCCAACTCAGCTGGGGG - Intergenic
1023820303 7:43977080-43977102 GGCCCCCACAGCAGGGTGGCTGG + Intergenic
1029610283 7:101622939-101622961 GGCCAGCCAGACAGAGTGGGCGG - Intronic
1029748588 7:102530601-102530623 GGCCCCCACAGCAGGGTGGCTGG + Intergenic
1029766535 7:102629685-102629707 GGCCCCCACAGCAGGGTGGCTGG + Intronic
1033685712 7:143639708-143639730 GGCCTCCCTACCAGAGTGGCAGG - Intronic
1033690031 7:143727607-143727629 GGCCTCCCTACCAGAGTGGCAGG + Intronic
1033698902 7:143817913-143817935 GGCCTCCCTACCAGAGTGGCAGG + Intergenic
1040638762 8:49306432-49306454 GGCCCCCACAGCACAGTGGTGGG - Intergenic
1044762730 8:95538820-95538842 GGGGGCCCCCACAGAGTGGGGGG - Intergenic
1044780179 8:95735492-95735514 GGCCCGTCCAACAGAGTGACTGG - Intergenic
1044817281 8:96126024-96126046 GGCCACCTTAACAGAGCGGGTGG + Intergenic
1045395876 8:101760220-101760242 GGCCAGCCAAACAGCGTGGGAGG - Intronic
1047731128 8:127729393-127729415 GGCTCCCACAACAGAGAGTGGGG - Intergenic
1048847658 8:138615826-138615848 GGCGCCTCCAACCTAGTGGGTGG - Intronic
1049333117 8:142065581-142065603 GGCCCCACCAGCAGCGGGGGCGG + Intergenic
1049576783 8:143393362-143393384 GTCCCCAGCAACAGAGAGGGAGG - Intergenic
1049686097 8:143939899-143939921 GGACCCCCCAACAGACTGAAGGG + Intronic
1053010120 9:34628130-34628152 GAGCCCCCCAACACAGGGGGAGG + Intergenic
1053532533 9:38896777-38896799 TGCCCCCAAAACAGAGTGGAGGG + Intergenic
1054204758 9:62121198-62121220 TGCCCCCAAAACAGAGTGGAGGG + Intergenic
1054456488 9:65434020-65434042 GGCTCCTGCAACAGAGTTGGTGG - Intergenic
1054633601 9:67467160-67467182 TGCCCCCAAAACAGAGTGGAGGG - Intergenic
1060724624 9:125998893-125998915 GGACCACCCAGCAGACTGGGAGG - Intergenic
1061090261 9:128421974-128421996 GGCCCCCATAACAGAGGTGGGGG - Intronic
1061317071 9:129803093-129803115 GCCGCCCCCAAGGGAGTGGGCGG + Intergenic
1062168630 9:135121956-135121978 GGCACCCCCAGCAACGTGGGTGG + Intergenic
1185616025 X:1422577-1422599 GCCCCCTCCCACAGAATGGGAGG + Intronic
1190247017 X:48697199-48697221 GACCCCCCCTTCAGAGTGCGGGG + Intronic