ID: 1163665911

View in Genome Browser
Species Human (GRCh38)
Location 19:18604078-18604100
Sequence CACTCTAGAAGGGCTGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 268}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163665911_1163665920 15 Left 1163665911 19:18604078-18604100 CCCCTCTCAGCCCTTCTAGAGTG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1163665920 19:18604116-18604138 GCCCCCACCACCCGCCAGCTTGG 0: 1
1: 0
2: 4
3: 41
4: 371
1163665911_1163665933 30 Left 1163665911 19:18604078-18604100 CCCCTCTCAGCCCTTCTAGAGTG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1163665933 19:18604131-18604153 CAGCTTGGCCTGGGCAGGAAGGG 0: 1
1: 0
2: 4
3: 40
4: 545
1163665911_1163665932 29 Left 1163665911 19:18604078-18604100 CCCCTCTCAGCCCTTCTAGAGTG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1163665932 19:18604130-18604152 CCAGCTTGGCCTGGGCAGGAAGG 0: 1
1: 0
2: 8
3: 146
4: 675
1163665911_1163665926 21 Left 1163665911 19:18604078-18604100 CCCCTCTCAGCCCTTCTAGAGTG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1163665926 19:18604122-18604144 ACCACCCGCCAGCTTGGCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 125
1163665911_1163665925 20 Left 1163665911 19:18604078-18604100 CCCCTCTCAGCCCTTCTAGAGTG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1163665925 19:18604121-18604143 CACCACCCGCCAGCTTGGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 190
1163665911_1163665929 25 Left 1163665911 19:18604078-18604100 CCCCTCTCAGCCCTTCTAGAGTG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1163665929 19:18604126-18604148 CCCGCCAGCTTGGCCTGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163665911 Original CRISPR CACTCTAGAAGGGCTGAGAG GGG (reversed) Intronic
900077821 1:832381-832403 GACTCAGGAAGGGCTGAGAGTGG + Intergenic
901036138 1:6337333-6337355 CGCTCTTTAGGGGCTGAGAGGGG - Intronic
903506959 1:23843246-23843268 AACTCCAAAAGGTCTGAGAGAGG + Intergenic
903602598 1:24553663-24553685 CACTCTAGAAGGGAGCAGGGTGG - Intergenic
904364609 1:30002339-30002361 CACACGAGAGAGGCTGAGAGAGG + Intergenic
904636162 1:31883413-31883435 CACTCCAGAATGGGTGACAGAGG - Intergenic
904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG + Intergenic
904905676 1:33895700-33895722 CCCTCCAGAAAGGCTGAGAGGGG + Intronic
905661183 1:39727491-39727513 CACTCTAGCCTGGCTGACAGAGG - Intronic
905899049 1:41568529-41568551 CACTCTTGTTGGGCTGAGAACGG + Intronic
905996462 1:42385555-42385577 CCTTTTACAAGGGCTGAGAGTGG + Intronic
908333225 1:63092654-63092676 CATTCTATGAAGGCTGAGAGAGG - Intergenic
908340744 1:63176222-63176244 CATTCTATGAAGGCTGAGAGAGG - Intergenic
910298332 1:85675916-85675938 AACTCTATGAAGGCTGAGAGAGG - Intronic
912756358 1:112328187-112328209 CACTCTAAAAGGCCTCACAGTGG + Intergenic
914939875 1:152013399-152013421 CTCTCTTGAAGGGCAGAGATTGG - Intergenic
915695164 1:157733238-157733260 AATTCTATAAAGGCTGAGAGAGG + Intergenic
916191539 1:162183735-162183757 AATTCTATAAAGGCTGAGAGAGG - Intronic
916599990 1:166283349-166283371 GATCCTAGCAGGGCTGAGAGAGG - Intergenic
918091150 1:181296243-181296265 CATTCTGCATGGGCTGAGAGTGG + Intergenic
918448316 1:184635705-184635727 CACTCTGGAGGGGCAGGGAGAGG - Intergenic
920525312 1:206661773-206661795 CAGTGTAGAAGGGTGGAGAGTGG + Intronic
922333192 1:224595874-224595896 AATTCTATGAGGGCTGAGAGAGG + Intronic
922631844 1:227123188-227123210 TACTCGAGAAGGGCTGAGGCGGG + Intronic
922758577 1:228109915-228109937 GGATCTAGAAGGGGTGAGAGAGG + Intergenic
923372014 1:233324132-233324154 AATTCTAGAAAGGCTGAGAGAGG + Intergenic
924546121 1:245029542-245029564 CACTTTGGGAGGGCTGAGATGGG - Intronic
924661870 1:246027126-246027148 AATTCTATAAAGGCTGAGAGAGG + Intronic
1062849383 10:731570-731592 GATTCTTGAAGGGCTGAGACGGG + Intergenic
1063520786 10:6738751-6738773 CACTCTGTAAGGGCTGGGATAGG + Intergenic
1063788588 10:9413244-9413266 CATTCTATGAAGGCTGAGAGAGG + Intergenic
1064189794 10:13195935-13195957 CACTCTAGCATGGGTGACAGGGG - Intronic
1066175836 10:32904364-32904386 CACTCTGGAATGGCTGACAGTGG + Intronic
1070435861 10:76392387-76392409 CACTGTGGAATGGCTGAAAGGGG + Intronic
1070825263 10:79386996-79387018 CACACAAGCAGGGCTGCGAGTGG - Intronic
1070984411 10:80675878-80675900 CATTCTGTAAAGGCTGAGAGAGG + Intergenic
1071489073 10:86123730-86123752 CCTTGTGGAAGGGCTGAGAGAGG - Intronic
1072836282 10:98717169-98717191 AATTCTATAAAGGCTGAGAGAGG - Intronic
1073949099 10:108785942-108785964 CTTTATAGAAGGACTGAGAGAGG + Intergenic
1075778112 10:125000993-125001015 AAATGTAGAAGGGCTGTGAGTGG - Intronic
1076478568 10:130769139-130769161 CTCTCTAGACAGGCTGGGAGGGG + Intergenic
1077646978 11:3933919-3933941 CAATTTAGAAAGGCTGAGGGAGG - Intronic
1080070627 11:28081039-28081061 AATTCTACAAAGGCTGAGAGAGG + Intronic
1081457355 11:43237048-43237070 GATTCTATAAAGGCTGAGAGAGG + Intergenic
1083269445 11:61564279-61564301 AACTCTGGAAGGGCTGGGTGTGG - Intronic
1083465679 11:62844190-62844212 CACTCTAGGCTGGGTGAGAGAGG + Intergenic
1083978945 11:66149126-66149148 CACTCCAGAATGGGTGACAGAGG - Intronic
1084154073 11:67304041-67304063 AACTCTAGAATTCCTGAGAGAGG + Intronic
1085514755 11:77105664-77105686 CACTCTGGAAGGCCTGAGTCTGG - Intronic
1085888184 11:80545654-80545676 CACCCTAGAAGGGTGGTGAGAGG - Intergenic
1086229555 11:84551942-84551964 CACTCTGGAAGACATGAGAGAGG - Intronic
1086604246 11:88676232-88676254 TTCTCTGGAAGTGCTGAGAGTGG - Intronic
1087473243 11:98603626-98603648 CACTGAGGAAAGGCTGAGAGAGG + Intergenic
1089168034 11:116492841-116492863 CACTCCAGAAGGACTGGGGGAGG + Intergenic
1090496406 11:127217015-127217037 CTGTCCAGAAGGGATGAGAGAGG + Intergenic
1093057947 12:14573374-14573396 CACTCCCGCAGGGCTCAGAGGGG - Intergenic
1094112529 12:26876833-26876855 AATTCTATAAAGGCTGAGAGAGG + Intergenic
1095203380 12:39411558-39411580 CACTCTAGCTGGGGTGACAGAGG - Intronic
1095466859 12:42496779-42496801 CATTCTACAAAGGCTGAGAGAGG - Intronic
1095719355 12:45384182-45384204 CACTCTATGAAGGCTGAGAGAGG - Intronic
1095977778 12:47951475-47951497 CCCTCTAGAAGGGCAAAAAGGGG + Intergenic
1097372390 12:58800132-58800154 CACTATAGGAGTGGTGAGAGAGG + Intronic
1099119172 12:78666121-78666143 TATTCTATAAAGGCTGAGAGAGG - Intergenic
1102670931 12:114618204-114618226 CACTCTAGAAGTGGGGAGGGAGG + Intergenic
1102753722 12:115319821-115319843 CACTCTGGAAGACCTGGGAGGGG + Intergenic
1105831408 13:24165553-24165575 CAACCGGGAAGGGCTGAGAGAGG - Intronic
1107475826 13:40734782-40734804 CTCACTAGAAAGGCTGAGATGGG + Intronic
1108493036 13:51000168-51000190 CACTTAGGAAGGACTGAGAGAGG + Intergenic
1111978461 13:94992591-94992613 TCCTCTAGATGTGCTGAGAGAGG + Intergenic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1112799342 13:103093107-103093129 CACTCCAGCATGGCTGAAAGGGG - Intergenic
1113469613 13:110535077-110535099 CACTTTAGAAGGGCAAAGCGGGG - Intronic
1115962866 14:38855216-38855238 GACTCTAGAGGGGATGGGAGTGG - Intergenic
1115963008 14:38856870-38856892 AACTCTAGAGGGGATGGGAGTGG - Intergenic
1116672298 14:47858925-47858947 GACTCTACAAGGGGAGAGAGAGG - Intergenic
1116882150 14:50181412-50181434 CACTCTAGAATGGGTGACAGAGG + Intronic
1117514417 14:56486336-56486358 CATGGTAGAAGGGCTGAAAGGGG + Intergenic
1117539234 14:56730497-56730519 CACTCCTGAGGGGATGAGAGTGG - Exonic
1118683712 14:68269673-68269695 CACTCTACAAGGGCAGAAAGAGG + Intronic
1124033668 15:26033773-26033795 CACACAAGAAGGAATGAGAGTGG - Intergenic
1124586034 15:31008227-31008249 CACTGTTGAAGTGGTGAGAGTGG + Intronic
1126234907 15:46372622-46372644 GACTCCAGAAGGGGAGAGAGTGG + Intergenic
1127314564 15:57782506-57782528 CACTCTAGGAGCTCTGAGAAGGG + Intronic
1128281505 15:66398379-66398401 CACTCTAGCCTGGGTGAGAGTGG + Intronic
1129516178 15:76159116-76159138 TACTGGGGAAGGGCTGAGAGGGG - Intronic
1129713455 15:77833329-77833351 CACACTGCCAGGGCTGAGAGTGG + Intergenic
1130211776 15:81930599-81930621 CACTCTAGACTGGGTGACAGAGG - Intergenic
1130363225 15:83209020-83209042 CATTCTACAAGGCCAGAGAGGGG - Intergenic
1130414668 15:83681640-83681662 CACTCTAAAAGGGCTGGCTGTGG + Intronic
1130651985 15:85767343-85767365 CACTTTAGGAGGGCTGAGGTGGG - Intronic
1132415325 15:101615118-101615140 CCTTCCAGAAGGGCTCAGAGTGG - Intergenic
1132603829 16:785487-785509 CCCTCTAGAGGGGCTGGGAAGGG - Exonic
1133758064 16:8777262-8777284 CACACTAGAGGGGGTGAGAGAGG - Intronic
1134216485 16:12320595-12320617 CATTCTAGAAGGGATGAGTGAGG - Intronic
1135621750 16:23961938-23961960 TACTCCATAAGGACTGAGAGTGG + Intronic
1136376352 16:29867679-29867701 CACTCTAGCCTGGCTGACAGAGG + Intergenic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1138246849 16:55473877-55473899 AACTCTATGAAGGCTGAGAGAGG - Intronic
1139187048 16:64819072-64819094 GACTTTAAAAGGGGTGAGAGAGG - Intergenic
1139490961 16:67285790-67285812 CACTTTAGAGGGCCTGAGTGCGG + Intronic
1139708711 16:68760402-68760424 TACTTTAGAAGGGCTGGGCGTGG - Intronic
1140513231 16:75523458-75523480 CACTCTAGCATGGGTGACAGAGG - Intergenic
1142196385 16:88741121-88741143 CACTGCAGAAGGGCTGAGAAGGG - Intronic
1143688284 17:8537557-8537579 CACTTTAGAGGAGCTCAGAGTGG + Intronic
1144706884 17:17374624-17374646 AATTCTATAAAGGCTGAGAGAGG + Intergenic
1146042940 17:29474130-29474152 AACTCTACAAAGGCTGAGAGAGG - Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1147987969 17:44317144-44317166 CCCTCAAGAAAGGCTGAGAGAGG - Intronic
1148121421 17:45214500-45214522 CACTCCAGCAGGGGTGACAGAGG - Intergenic
1152497156 17:80681377-80681399 CACTCTAGCAGGGCAGTGTGAGG - Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1154465240 18:14637724-14637746 CACTGTAGTAGGGCTGATACTGG - Intergenic
1156311942 18:35931740-35931762 CACTCTAGCATGGGTGACAGAGG + Intergenic
1156768921 18:40695783-40695805 AATTCTGTAAGGGCTGAGAGAGG + Intergenic
1157010205 18:43638972-43638994 AATTCTATAAAGGCTGAGAGAGG - Intergenic
1158499393 18:57986463-57986485 CGCTAAAGAAGGGCTGAGCGTGG - Intergenic
1158848449 18:61469531-61469553 CACTATAGGATGGTTGAGAGGGG - Intronic
1158919220 18:62170977-62170999 CAATCTATGAAGGCTGAGAGAGG + Intronic
1160152410 18:76405403-76405425 CACTCAGGAAGGGCTCAGTGAGG + Intronic
1160583940 18:79902598-79902620 CACTCTTGAATGTCTGAGTGAGG - Exonic
1160613398 18:80106806-80106828 CTCTCTAAAAGGGCTGACTGGGG + Intergenic
1162266061 19:9575496-9575518 CACTCTGGGAAGGCTGAGATGGG + Intronic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1165286569 19:34847619-34847641 CGTTCTAGAGGAGCTGAGAGTGG - Intergenic
1165308327 19:35015732-35015754 CACACTACAAGGCCTGGGAGTGG + Intronic
1167271362 19:48508382-48508404 CATCCTAGAAGCACTGAGAGTGG + Intronic
925756154 2:7134026-7134048 CACTCTAGTAGGGGTGGAAGTGG - Intergenic
925770440 2:7277129-7277151 CACTCCAAAAGCCCTGAGAGAGG - Intergenic
926057522 2:9783270-9783292 CTCTCTATGAAGGCTGAGAGGGG + Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
929157872 2:38804106-38804128 CACTCTAGAAGGCATCACAGTGG - Intronic
929505221 2:42523054-42523076 CACTCTGGGAGGCCTGAGATGGG - Intronic
929654430 2:43716279-43716301 CACACTGGAAGGGCTGAAACTGG + Intronic
930322114 2:49868671-49868693 CATTCTATGAAGGCTGAGAGAGG - Intergenic
933374855 2:81466775-81466797 TACTCTAGAAGGGCTGGATGTGG + Intergenic
936144638 2:109972096-109972118 GACTCTAGTAGGGCTGTGAGAGG + Intergenic
936181322 2:110270059-110270081 GACTCTAGTAGGGCTGTGAGAGG + Intergenic
936200049 2:110399373-110399395 GACTCTAGTAGGGCTGTGAGAGG - Intergenic
937678306 2:124616404-124616426 AATTCTATAAAGGCTGAGAGAGG - Intronic
938179156 2:129164035-129164057 CCCTCAAGAAGGGCTGCCAGGGG - Intergenic
938295824 2:130178759-130178781 CACTCTAGCCGGGGTGATAGAGG + Intronic
940321532 2:152382478-152382500 ATCTCAAGAAGGGCTGAGAGAGG + Intronic
940756604 2:157690078-157690100 GATTCTATAAAGGCTGAGAGAGG - Intergenic
941907054 2:170726637-170726659 CACTCTAGACTGGGTGACAGAGG + Intergenic
944255761 2:197622086-197622108 CATTCTATGAAGGCTGAGAGAGG + Intronic
945559829 2:211325949-211325971 CACTCTAGTCGGGGTGACAGAGG + Intergenic
946442500 2:219708502-219708524 CTGTCTGGAAGGGCTGAGAATGG + Intergenic
946575266 2:221068724-221068746 CATTCTATGAAGGCTGAGAGTGG + Intergenic
948508651 2:238448399-238448421 CACCCTGGTAGGGCTGATAGGGG + Exonic
948845686 2:240681850-240681872 CGCTCTGGAAGGGGTGATAGAGG + Intronic
948848169 2:240692880-240692902 CGCTCTGGAAGGGGTGATAGAGG - Intronic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1169341422 20:4799376-4799398 CACTCCAGGTGGGATGAGAGGGG + Intronic
1169653926 20:7901066-7901088 AATTCTATAAAGGCTGAGAGAGG + Intronic
1172726520 20:37047687-37047709 CACCCTAGATTGGCTGAGTGTGG + Intronic
1174392257 20:50224872-50224894 CATTCTCAAAGGGCAGAGAGGGG + Intergenic
1180002237 21:45000495-45000517 CACGCTGGAAGTGCTGAGTGTGG - Intergenic
1180419352 22:12799458-12799480 CAAACTAGCAGGGCTGAAAGAGG + Intergenic
1180990406 22:19932391-19932413 CAGGCTAAAAAGGCTGAGAGTGG - Intronic
1181424077 22:22821818-22821840 CAGTGTCGAAGGGTTGAGAGAGG + Intronic
1181427920 22:22856118-22856140 CACCCTAGAAGGGCTGAAGGGGG + Intronic
1182884553 22:33762336-33762358 CACTCTGGAAGGGCAGATAAAGG + Intronic
1183048973 22:35245694-35245716 CACTCTAGCAGGGCAAAGAGGGG + Intergenic
1183520267 22:38292785-38292807 CTCTGTAGTAGGACTGAGAGAGG - Intronic
1184294493 22:43515177-43515199 CACTCTGGAAGGTCTCAGTGAGG + Intergenic
949594818 3:5532425-5532447 CACTCTAGGATCACTGAGAGAGG - Intergenic
950453614 3:13079503-13079525 GACTCAAGCAGGGCTGTGAGAGG + Intergenic
950513711 3:13449859-13449881 CACTCTAGACTGGGTGATAGAGG + Intergenic
951120703 3:18924254-18924276 CACTCTAGGAGTGGTGAGAGAGG + Intergenic
952639294 3:35572890-35572912 AATTCTATAAGGGCTGAGAGAGG + Intergenic
954385663 3:50242561-50242583 CAAGCTAGAAGGGCTGGGTGGGG - Intronic
955622539 3:60879435-60879457 CACTCTAGAAAGTCTGGAAGAGG + Intronic
956558093 3:70543400-70543422 CCCTCTTGACGGGCTGAGAGTGG - Intergenic
956942151 3:74175591-74175613 AATTCTATAAAGGCTGAGAGAGG - Intergenic
957539720 3:81551901-81551923 AATTCTAGAAGAGCTGAAAGGGG + Intronic
957927600 3:86834772-86834794 CAGTCTAGAAGAGCTAAAAGGGG + Intergenic
959912031 3:111774221-111774243 CACTCAAGTAAGGCTGTGAGAGG + Intronic
960540607 3:118857541-118857563 CTCTCTATGAAGGCTGAGAGAGG + Intergenic
963108139 3:141664142-141664164 CCCTCTGGAAGGGATGGGAGGGG - Intergenic
963183801 3:142390519-142390541 AATTCTATAAAGGCTGAGAGAGG - Intronic
963952816 3:151221547-151221569 CACTCTAGTGTGGCTGAAAGGGG + Intronic
966050992 3:175617791-175617813 CTTCCCAGAAGGGCTGAGAGAGG - Intronic
966106133 3:176336186-176336208 AACTCTATGAAGGCTGAGAGAGG + Intergenic
969074068 4:4563485-4563507 CTCTCTAGAAGCTCTGATAGGGG - Intergenic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
969512748 4:7628837-7628859 CACTCGAGAAGGGCTCACAAGGG + Intronic
972382556 4:38533090-38533112 CACAGAAAAAGGGCTGAGAGCGG - Intergenic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
973362434 4:49177815-49177837 CAAACTAGCAGGGCTGAAAGAGG - Intergenic
973809732 4:54558065-54558087 ATCTCTGGAAGGGCTCAGAGAGG - Intergenic
974412803 4:61564088-61564110 AATTCTATAAAGGCTGAGAGAGG - Intronic
975542144 4:75524787-75524809 CACTCTAGCATGGGTGACAGAGG - Intronic
976058463 4:81097814-81097836 AACTCTATGAAGGCTGAGAGAGG - Intronic
976129419 4:81869195-81869217 CACTATAGAAGAGCTGTGAATGG + Intronic
977105904 4:92884242-92884264 AACTCTATGAAGGCTGAGAGAGG - Intronic
977401178 4:96534537-96534559 AATTCTATAAAGGCTGAGAGAGG + Intergenic
978703520 4:111676723-111676745 CACTCTAGAAGCACTGCCAGTGG + Intergenic
979206734 4:118046779-118046801 CACTCTCAAAGCACTGAGAGGGG + Intronic
979811606 4:125043095-125043117 CATTCTATAAAGGCTGAGAGGGG + Intergenic
981220886 4:142232938-142232960 AATTCTATAAAGGCTGAGAGAGG + Intronic
981898378 4:149832582-149832604 AATTCTATAAGGGCTAAGAGAGG - Intergenic
982085084 4:151826875-151826897 AACTCTATGAAGGCTGAGAGAGG - Intergenic
982169935 4:152651550-152651572 AATTCTACAAAGGCTGAGAGAGG - Intronic
982697075 4:158614577-158614599 CATTCTATGAAGGCTGAGAGAGG - Intronic
983220571 4:165039963-165039985 CAATCTACAAGGTCTGGGAGGGG + Intronic
985833382 5:2252159-2252181 CACTAAAGCAGGGCTCAGAGGGG - Intergenic
985910911 5:2881616-2881638 CACTGTTGAATGGCTGGGAGGGG - Intergenic
986409088 5:7458870-7458892 CACACAAGAAGGGCTGATAGAGG + Intronic
987560136 5:19509282-19509304 GACTCCAAAAGGGCAGAGAGTGG + Intronic
989268707 5:39506726-39506748 CACACTAGGACTGCTGAGAGAGG - Intergenic
989760134 5:45005382-45005404 AATTCTATGAGGGCTGAGAGAGG + Intergenic
990512545 5:56501712-56501734 CACTCAAGAATGGTTGAGAATGG + Intergenic
990874628 5:60470229-60470251 AATTCTACAAGGGCTGAGAGAGG + Intronic
991193343 5:63902096-63902118 CACTCTAGAGTGGGTGACAGAGG - Intergenic
992462815 5:76978044-76978066 CATTCTATGAAGGCTGAGAGAGG + Intronic
999390420 5:151185642-151185664 CACTTAACATGGGCTGAGAGAGG - Intronic
1000586675 5:163108432-163108454 AACTCTATGAAGGCTGAGAGAGG - Intergenic
1000758270 5:165187727-165187749 AACTCTATGAAGGCTGAGAGAGG + Intergenic
1002989946 6:2229085-2229107 CACTGCAGATGGGGTGAGAGAGG + Intronic
1005204646 6:23388168-23388190 CACACTGAAAGGGTTGAGAGTGG - Intergenic
1005957145 6:30672063-30672085 CACTCTGAGGGGGCTGAGAGAGG + Intronic
1006725953 6:36199035-36199057 AACCCTAGAAGCTCTGAGAGTGG - Intronic
1007350675 6:41271456-41271478 CACTCTAGCAGGGCACAGAAGGG - Intronic
1007723377 6:43899472-43899494 CACCTGACAAGGGCTGAGAGAGG - Intergenic
1008152220 6:47967800-47967822 CAATTTAGGAAGGCTGAGAGAGG - Intronic
1009573511 6:65421363-65421385 CAATCTATAAAGGCTGAGAGAGG - Intronic
1011095996 6:83663575-83663597 AATTCTAGGAGGGCTGAGAGAGG + Intronic
1011115699 6:83889030-83889052 AATTCTAGGAAGGCTGAGAGAGG + Intronic
1011119104 6:83930934-83930956 AATTCTAGGAGGGCTGAGAGAGG - Intronic
1011337534 6:86277583-86277605 GACACTGGAAAGGCTGAGAGTGG + Intergenic
1011633130 6:89346499-89346521 CTGTATAGAAAGGCTGAGAGTGG - Intronic
1012961539 6:105627488-105627510 CACTCTCAGAGGGCTGAGACAGG + Intergenic
1014603171 6:123441822-123441844 TACACTAGAAGGGCAAAGAGGGG - Intronic
1014928419 6:127303522-127303544 AACACTACAAAGGCTGAGAGTGG + Intronic
1015336744 6:132047680-132047702 CTCTATAGAAGGCCTGAGATAGG + Intergenic
1016946206 6:149536625-149536647 AATTCTATAAAGGCTGAGAGAGG + Intronic
1019353644 7:567859-567881 CTTTCTAGAAGGGCTGGGAGAGG + Intronic
1019918922 7:4150610-4150632 CAGTCAGGAAGGGCTGAGACGGG - Intronic
1020306086 7:6836217-6836239 CACTGTAGAACAGCTGAGACCGG + Intergenic
1020548978 7:9573826-9573848 CACTCTGTGAAGGCTGAGAGAGG - Intergenic
1020754487 7:12184389-12184411 AATTCTATAAAGGCTGAGAGAGG - Intergenic
1020765023 7:12308570-12308592 CATTCTATGAAGGCTGAGAGAGG - Intergenic
1021282822 7:18740967-18740989 AATTCTATGAGGGCTGAGAGAGG + Intronic
1022029006 7:26475042-26475064 AACTCTTGAAGAGCTGAGTGAGG + Intergenic
1022346007 7:29515314-29515336 CAGCCTAGAAGGGAAGAGAGAGG + Intergenic
1022981561 7:35609511-35609533 CACTCTAGCTGTGGTGAGAGTGG - Intergenic
1023104354 7:36748813-36748835 TAGTCAAGAAGGGCTGATAGTGG + Intergenic
1024646774 7:51377694-51377716 CTCTCTAGTAGGGTAGAGAGGGG + Intergenic
1024844959 7:53632833-53632855 CTCTTTAGAAGGGCTGTCAGAGG + Intergenic
1029175647 7:98662561-98662583 CACTCCAGAAGGGGCGAGGGAGG + Intergenic
1029840912 7:103362065-103362087 CATTGAAGAAGGGATGAGAGTGG + Exonic
1029980989 7:104879015-104879037 CATTCTACGAAGGCTGAGAGAGG + Intronic
1035431077 7:158822514-158822536 CACTTCAGAAGTGCTGAGATAGG + Intronic
1035527804 8:327256-327278 GACTCAGGAAGGGCTGAGAATGG - Intergenic
1035958816 8:4113859-4113881 AACTCTATGAAGGCTGAGAGAGG + Intronic
1037603281 8:20416995-20417017 CACTCTGGAAGGGCAGGGACTGG - Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039345265 8:36696801-36696823 CACTCTAGCCTGGGTGAGAGAGG - Intergenic
1039384044 8:37115819-37115841 AACTCTACCAAGGCTGAGAGAGG - Intergenic
1041180222 8:55239591-55239613 CTATATAGAAAGGCTGAGAGGGG - Intronic
1041372515 8:57177679-57177701 AATTCTATAAAGGCTGAGAGAGG - Intergenic
1042689588 8:71483266-71483288 CAGTCTTGAGGAGCTGAGAGAGG - Intronic
1045399853 8:101802707-101802729 AATTCTATAAAGGCTGAGAGAGG + Intronic
1047681345 8:127257559-127257581 AACTGCAGAAGGGCTGGGAGAGG + Intergenic
1047897266 8:129380701-129380723 AATTCTATAAAGGCTGAGAGAGG + Intergenic
1048073904 8:131048098-131048120 CAATCATGCAGGGCTGAGAGGGG - Intergenic
1048743464 8:137587739-137587761 CACACTGGAAGTGCTCAGAGTGG + Intergenic
1048788477 8:138077713-138077735 CACTCTAGGAGGGGTGAGTGGGG - Intergenic
1050337069 9:4599839-4599861 CACTATAGTAGGGCTGGTAGAGG + Intronic
1051180456 9:14406347-14406369 CACTCTAGAAGGGATGTGTTGGG + Intergenic
1051254172 9:15195277-15195299 AACTCTATAAAGGCTGAGAGAGG + Intronic
1051320685 9:15901767-15901789 CAATGTAGAGGGGCTGAAAGTGG + Intronic
1053076912 9:35141198-35141220 CTCCCTAGAAAGGCTAAGAGGGG + Intergenic
1056934954 9:90909292-90909314 CACTCTCCAAAGGCTGAGAATGG - Intergenic
1058130424 9:101246587-101246609 GACTCTAGAAGGGAAGAGATTGG - Intronic
1058538947 9:105992131-105992153 CAGTCTAGAATGGCTGAAATTGG + Intergenic
1059558933 9:115312204-115312226 AATTCTAGGAAGGCTGAGAGAGG + Intronic
1061015442 9:127978582-127978604 CACTCTAGAAGGCCAGGGGGCGG + Intronic
1061549703 9:131326434-131326456 CACTCCAGCAGGGGTGACAGGGG - Intergenic
1061838243 9:133343013-133343035 CACACTAGGGTGGCTGAGAGGGG - Intronic
1186512204 X:10138662-10138684 CCTTCTAGAAGGCCTGAGTGAGG + Intronic
1186520991 X:10206764-10206786 CAGTCTAGAAGAGGTGAGAATGG + Exonic
1187188857 X:17013814-17013836 CCCTGTAGCAGGGCTGGGAGAGG - Intronic
1188931436 X:36116215-36116237 GACTCAAAAAGGGTTGAGAGTGG - Intronic
1189923125 X:45923127-45923149 CATTCTATGAGGGCTAAGAGAGG + Intergenic
1189975472 X:46457589-46457611 AACAGTAGAAGGGCTGAGACTGG - Intronic
1189983989 X:46537435-46537457 AACAGTAGAAGGGCTGAGACTGG + Intronic
1191758905 X:64626145-64626167 CACTCTACAAGGTGGGAGAGTGG - Intergenic
1191813275 X:65215506-65215528 AACTCTATGAAGGCTGAGAGAGG - Intergenic
1193400992 X:81042243-81042265 CACTCCAAAAGGTGTGAGAGTGG - Intergenic
1194844235 X:98783657-98783679 CCCTTTTGAAGGGCTGATAGAGG + Intergenic
1195734906 X:108001741-108001763 CACCCTAGAAAGGCGGAGAAAGG + Intergenic
1195786894 X:108534911-108534933 GATTCTAGAAGAGGTGAGAGAGG - Intronic
1198323102 X:135539369-135539391 AACTCTATGAAGGCTGAGAGAGG - Intronic
1199023260 X:142907805-142907827 AATTCTAGGAAGGCTGAGAGAGG + Intergenic
1199023855 X:142914198-142914220 AATTCTAGGAAGGCTGAGAGAGG + Intergenic
1199577684 X:149329222-149329244 AATTCTATTAGGGCTGAGAGAGG + Intergenic
1199712114 X:150476961-150476983 CAGTCTACCAGGGGTGAGAGAGG - Intronic
1200228535 X:154432568-154432590 CCTTCTGGAAGGGCTGTGAGGGG - Intronic
1200389183 X:155926479-155926501 AACTCTATGAAGGCTGAGAGAGG - Intronic
1201411716 Y:13704824-13704846 CACTCTAGTATGGGTGACAGAGG + Intronic