ID: 1163667414

View in Genome Browser
Species Human (GRCh38)
Location 19:18609900-18609922
Sequence ATGTGTAAGGGGCAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163667406_1163667414 1 Left 1163667406 19:18609876-18609898 CCAAGTCCTTGAAGTTGGCTGGG 0: 1
1: 0
2: 3
3: 14
4: 164
Right 1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG 0: 1
1: 0
2: 4
3: 48
4: 442
1163667408_1163667414 -5 Left 1163667408 19:18609882-18609904 CCTTGAAGTTGGCTGGGAATGTG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG 0: 1
1: 0
2: 4
3: 48
4: 442
1163667404_1163667414 2 Left 1163667404 19:18609875-18609897 CCCAAGTCCTTGAAGTTGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG 0: 1
1: 0
2: 4
3: 48
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163667414 Original CRISPR ATGTGTAAGGGGCAGAAGGA GGG Intronic
900685313 1:3944476-3944498 ATGTGGGAGGGACAGAGGGAGGG - Intergenic
901878161 1:12178901-12178923 ATCTGAAAGGGACAGAAGGCTGG + Intronic
902065513 1:13682424-13682446 ATATTTAAGGGGAAGTAGGATGG + Intergenic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903445382 1:23419254-23419276 ACAGGCAAGGGGCAGAAGGAAGG + Intronic
904619262 1:31765638-31765660 AGGTGGGAGGGACAGAAGGAGGG - Intergenic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
906716822 1:47976253-47976275 GTGTGTAAGGGGTAGAAGGTTGG - Intronic
907167987 1:52431853-52431875 ACGTTTAAGGGGGATAAGGAAGG + Intronic
907272878 1:53300990-53301012 GAGTGAAAGGGACAGAAGGAGGG + Intronic
907770116 1:57453076-57453098 ATGGGAAAGGGGTAGAAAGAAGG + Intronic
907806483 1:57825528-57825550 AGGTGTTAAGGGCAGGAGGAAGG + Intronic
908358464 1:63344883-63344905 ATGATTAAGGGGAAGAAGAAGGG + Intergenic
908554558 1:65244884-65244906 ATATAGAAGGAGCAGAAGGAGGG + Intergenic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909806336 1:79876983-79877005 ATGTGTAATGGCCAGTAGGTAGG - Intergenic
910082841 1:83362098-83362120 ATGTGTGCTGGGCAGAAGGTGGG + Intergenic
910530009 1:88225193-88225215 TTGTGCAATGGGCAGATGGATGG + Intergenic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
912249024 1:107991731-107991753 ATGTGGAGGGGTCAGAAGGGCGG + Intergenic
913588475 1:120299683-120299705 ATGTGTTGGGGGGTGAAGGAGGG - Intergenic
913619710 1:120598686-120598708 ATGTGTTGGGGGGTGAAGGAGGG + Intergenic
914570493 1:148911555-148911577 ATGTGTTGGGGGGTGAAGGAGGG - Intronic
914602337 1:149218714-149218736 ATGTGTTGGGGGGTGAAGGAGGG + Intergenic
914701642 1:150139336-150139358 ATGTTTAAGGAACAGAAAGAAGG - Intronic
914902836 1:151721120-151721142 ATGTGTACCGGACAGAGGGACGG + Intronic
915303821 1:154966551-154966573 ATGTGTGGTGGGCAGGAGGAGGG + Intronic
915496022 1:156283118-156283140 GCGGGAAAGGGGCAGAAGGATGG - Intronic
915555956 1:156660936-156660958 TTGTGTGGGGGGCAGAAGGTGGG - Intergenic
915707449 1:157859729-157859751 ATGTGTACTGAACAGAAGGAGGG + Intronic
917773425 1:178305967-178305989 ATGTGTATGGGGAAGAAGAAGGG + Intronic
920692191 1:208155451-208155473 GTGTGGGAGGGGCAGAATGAGGG - Intronic
922151260 1:223006660-223006682 ATGTTAAAGGCACAGAAGGACGG + Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
923072427 1:230577865-230577887 AAGGGGAAGGGGAAGAAGGAGGG - Intergenic
924133555 1:240938500-240938522 AGGTGTAAGGGGTAAAAGGATGG - Intronic
924264135 1:242263977-242263999 ATGTGTTAGGAAGAGAAGGAGGG - Intronic
924708417 1:246516397-246516419 ATGGGTGGGGGGCAGCAGGATGG - Intergenic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063444428 10:6100869-6100891 AGGTGTAAGGGCAAGAAGTATGG + Intronic
1066212486 10:33253354-33253376 ATATGTAAGTGACAGCAGGAAGG + Intronic
1066498364 10:35964811-35964833 AGTAGTAAGGGGCAGAGGGAAGG - Intergenic
1066626083 10:37407083-37407105 AGTAGTAAGGGGCAGAGGGAAGG - Intergenic
1066638017 10:37526327-37526349 AAGTTTAAAGAGCAGAAGGATGG + Intergenic
1066720662 10:38334486-38334508 ATGTGTTAGGAAGAGAAGGAGGG + Intergenic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067560995 10:47304323-47304345 ATGCGTAAGGGACAGAAGGAAGG + Intronic
1067839786 10:49666404-49666426 AAGTCTAAAGGGCAGAGGGAGGG + Intergenic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068886173 10:62099133-62099155 GTATGTAAGTGGCAGAAGGTGGG + Intergenic
1069630033 10:69892023-69892045 AAGTGTGTGGGGCAGAGGGACGG - Intronic
1069748720 10:70732356-70732378 ACGTGTAAGTGGCAGCAGCACGG + Exonic
1069926366 10:71853258-71853280 ATCTGCAAGGAGCTGAAGGATGG - Intergenic
1071104672 10:82080459-82080481 ATGGGAAGGTGGCAGAAGGAGGG - Intronic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072252155 10:93590187-93590209 ATGTTTAATAGGCAGAAGAAAGG + Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073061649 10:100737086-100737108 ATGGGAAAGGGAAAGAAGGAGGG - Intronic
1073148433 10:101295513-101295535 ATGTGTGTGGGGCAGCTGGAGGG - Intergenic
1074033860 10:109717984-109718006 AGGGCTGAGGGGCAGAAGGAAGG + Intergenic
1074162652 10:110846880-110846902 AGGAGGAAGGGGCAGCAGGAAGG - Intergenic
1074486896 10:113893256-113893278 ATGGGTCAGAGGCAGAAGGAGGG + Intronic
1074700042 10:116084534-116084556 AGGGGCAAGGGGCTGAAGGAAGG + Intronic
1074708075 10:116153310-116153332 ATGTATAAAGGGAGGAAGGATGG - Intronic
1075931488 10:126300397-126300419 TTTGGTAAGGGGAAGAAGGAAGG - Intronic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077245720 11:1536867-1536889 ATGTGAAATGAGCAGAGGGAAGG + Intergenic
1078162737 11:8855805-8855827 AGGTGTAAAGGGCAAAGGGAAGG + Intronic
1078226403 11:9395604-9395626 ATGTGTATGGGGCAGCTAGATGG + Intronic
1079469894 11:20768347-20768369 AAGTTTAAAGGGCACAAGGATGG + Intronic
1079524358 11:21366580-21366602 AAGTGGAAGAGGCAGAAGGATGG - Intronic
1080304055 11:30817806-30817828 ATGAGTGAGAAGCAGAAGGAAGG + Intergenic
1080799627 11:35598257-35598279 AGGTTTGAGGGTCAGAAGGAAGG - Intergenic
1080954578 11:37078359-37078381 ATGTTTCAGGGGCTGAGGGAGGG + Intergenic
1081962342 11:47147611-47147633 AAGGGAAAGGGGCAGCAGGAAGG + Intronic
1082634937 11:55583926-55583948 ATGTGAAAGGGGCAGAAGATTGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1084569913 11:69953131-69953153 ATGGGGAAGGGGGAGAGGGACGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1086766765 11:90705252-90705274 ATGCGTAACTGACAGAAGGAGGG - Intergenic
1086901611 11:92373905-92373927 ATCTGTAAGCTGGAGAAGGAGGG + Intronic
1087229993 11:95650406-95650428 ATGTGAAATGGCCAAAAGGAAGG + Intergenic
1088417108 11:109601227-109601249 ATGTGAGAAGGGCAGATGGATGG + Intergenic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1088803516 11:113329616-113329638 TAATGGAAGGGGCAGAAGGAGGG - Intronic
1089090762 11:115872954-115872976 AGGTGTAAGGGGTGGTAGGAGGG + Intergenic
1089689982 11:120181115-120181137 ATGTGTCTGGGGGAGCAGGATGG + Intronic
1089753756 11:120670651-120670673 AAGTGTCAGGGGCAGAGGCAGGG - Intronic
1089798909 11:121007367-121007389 ATGTATAAGGGCCAAAAAGAAGG + Intergenic
1090197353 11:124827982-124828004 AAGTGCACGGGGCACAAGGAAGG + Intergenic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090627938 11:128622187-128622209 ACGTGTCATGGCCAGAAGGAGGG - Intergenic
1090751390 11:129749182-129749204 ATGTGCAGGAGGCAGAAGGTGGG - Intergenic
1093171232 12:15863122-15863144 AAGTTTGAGGGACAGAAGGATGG - Intronic
1093180629 12:15963100-15963122 ATTTATGAGGGGCACAAGGATGG - Intronic
1094106543 12:26817848-26817870 ATGGGGTAGGGGCAGAGGGAGGG + Intronic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096791734 12:54049187-54049209 ATGTGGAAGGGGAAAAATGAAGG - Intronic
1097756041 12:63407704-63407726 ACATGAAAGGAGCAGAAGGAAGG + Intergenic
1098076282 12:66735595-66735617 AAGTTTAAGTGGCAGCAGGAGGG + Intronic
1098204235 12:68090371-68090393 CATTCTAAGGGGCAGAAGGAGGG - Intergenic
1098775293 12:74606068-74606090 ATGTGTAAGGAACAGAAGCCAGG - Intergenic
1099943019 12:89212586-89212608 ATATGTAAGGGAAAGAAGCAAGG + Intergenic
1100071382 12:90723811-90723833 CTGAGCAAGGGGCAGAAGAATGG - Intergenic
1101220563 12:102634861-102634883 ATGTGTATGGGGCAGATGGGAGG + Intergenic
1102527235 12:113520617-113520639 ATGAGTAAAGAGCAGAACGAGGG - Intergenic
1104131277 12:125896681-125896703 AAGGGCCAGGGGCAGAAGGAAGG + Intergenic
1104162664 12:126194745-126194767 ACGTGAAAGGGAAAGAAGGAAGG - Intergenic
1104856709 12:131905559-131905581 ATGTGTACAGGGCAGAGGGAGGG + Intronic
1106049027 13:26173611-26173633 AGGGGTTGGGGGCAGAAGGAAGG + Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106936606 13:34729480-34729502 GTGAGGCAGGGGCAGAAGGAGGG - Intergenic
1107283493 13:38763092-38763114 GTGTGCAAGGGGCAAAAAGATGG - Intronic
1107455606 13:40551934-40551956 TTATGTTAAGGGCAGAAGGAAGG - Intergenic
1109367161 13:61370383-61370405 ATCTGCAAAAGGCAGAAGGAAGG - Intergenic
1110360372 13:74617911-74617933 ATGTTTAAGGGACAGCAGAAAGG + Intergenic
1110532026 13:76609031-76609053 ATGTATTAGGGGTTGAAGGAAGG + Intergenic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1116857107 14:49962366-49962388 AGGAGTAAGGGGTAGAAGGGAGG + Intergenic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1117922133 14:60735712-60735734 AGGGGAAGGGGGCAGAAGGAGGG + Intronic
1118506069 14:66413340-66413362 ATAGGTAAGTGGCAGAAGTATGG + Intergenic
1118510898 14:66472080-66472102 ATGTGAAAGGGGGAAAAAGATGG - Intergenic
1119147009 14:72326532-72326554 ATGTGGTAGGAGCAGAAGCAAGG - Intronic
1119405640 14:74397124-74397146 AAGTGTGAAGGGCTGAAGGAAGG + Intergenic
1119459838 14:74791498-74791520 ATGTGTAAAAGCCAGAAGAAAGG - Intronic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1120323885 14:83001224-83001246 TTGTATAAGGGGCAGAAACAAGG + Intergenic
1120452093 14:84681215-84681237 ATGTATAAAGGACAGAAGGAAGG + Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121936660 14:98025887-98025909 ATGAGCAAGGGGTAGAGGGATGG - Intergenic
1121971500 14:98361039-98361061 ATGTAATAGGGGAAGAAGGACGG + Intergenic
1122531449 14:102430442-102430464 ATGTGTTAGGGGCAGACTGCAGG - Intronic
1202860549 14_GL000225v1_random:79015-79037 ATGTGGCAGGGGCAGATGCAAGG - Intergenic
1124464139 15:29920961-29920983 ATGTGAAATGGACAGATGGATGG + Intronic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1124719978 15:32103608-32103630 ATGTGTCCTGGGCAAAAGGAGGG - Intronic
1125679797 15:41523507-41523529 ATGTGTAGGGGGCATAAAGAGGG + Intronic
1126004468 15:44243178-44243200 ATGTGTAGGAGGCCGATGGAGGG - Intergenic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127526177 15:59793935-59793957 ACTGGTAAGGGGCAGATGGATGG + Intergenic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128309303 15:66620624-66620646 ATCTGAATGGGGGAGAAGGAGGG + Intronic
1128868835 15:71136845-71136867 GTGTGTAAGGGGCGGCAGAATGG + Intronic
1130152050 15:81318651-81318673 GAGTGTAAGGGGCAGTAGGGTGG - Intronic
1130397927 15:83520636-83520658 TTGAGGAAGGGGCTGAAGGAAGG + Intronic
1130433831 15:83875831-83875853 ATGTGTAAGACACAGGAGGAAGG + Intronic
1130626759 15:85523424-85523446 CTGAGTAAGGGCCTGAAGGAAGG - Intronic
1131514723 15:93069554-93069576 AAGTATAAGGGGAAGAAAGAAGG + Intronic
1131788293 15:95936596-95936618 TTGGGGAAGGGGCAGAGGGACGG - Intergenic
1133759174 16:8784758-8784780 ATGTGACAGGGACACAAGGATGG + Intronic
1135395056 16:22124900-22124922 ATGAGAATGGGGCAGAAGGTGGG + Intronic
1135818025 16:25653701-25653723 AAGAGTAAGGGGATGAAGGAAGG - Intergenic
1136071337 16:27789300-27789322 ATGGATAATGGGCAGATGGAGGG + Exonic
1136071350 16:27789368-27789390 ATGGATAATGGGCAGATGGAGGG + Exonic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136147102 16:28322122-28322144 ATGTGTAGGGTGCAGACGCATGG + Exonic
1136388006 16:29942184-29942206 ATGTGTACAAGGCAGAAAGAAGG + Intronic
1136746803 16:32597860-32597882 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1137527185 16:49246588-49246610 TTATTTGAGGGGCAGAAGGAAGG - Intergenic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1140287102 16:73614201-73614223 ATGTGTACGGGGCAAAAGTGAGG + Intergenic
1140875403 16:79147243-79147265 ATGAGGCAGGCGCAGAAGGAAGG - Intronic
1141119363 16:81339856-81339878 AGGTGTCAGGGGCAGATGTAAGG + Intronic
1141900743 16:86988730-86988752 ATGTGTGAGGGGCCCAGGGAAGG + Intergenic
1142231685 16:88903083-88903105 ATGGGGAACGGGCAGAAGCAGGG - Intronic
1203048933 16_KI270728v1_random:857064-857086 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1143565481 17:7717834-7717856 GTGTGTCGGGGGCAGAGGGAAGG + Exonic
1143618784 17:8069375-8069397 ATGTGGAAGGTGCAGAAGAAAGG - Intergenic
1144018842 17:11222251-11222273 ATGTTTTAGGGACACAAGGAGGG + Intergenic
1144325739 17:14178063-14178085 ATGTGTAAGAGGTACAGGGAAGG - Intronic
1144410092 17:14992347-14992369 TTGTGGAAGGGGCAGAGAGATGG - Intergenic
1144474613 17:15574951-15574973 ATGTGTAAGAGGTACAGGGAAGG - Intronic
1144671260 17:17133895-17133917 AGGTGTGAAGGGCGGAAGGATGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145867224 17:28249023-28249045 ATGTGTAAAGGGGAGAAGTGAGG + Intergenic
1146795956 17:35781088-35781110 ATGTTTAAGGAACAGAAGGAAGG + Intronic
1146805139 17:35858867-35858889 AGGTGTGAGGGGCAGGAGGCTGG - Exonic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147685067 17:42282208-42282230 ATGTGTTAGGGCCATAAGAAGGG + Intergenic
1147744792 17:42688540-42688562 ATGTGGAAGGGGCAGAGGTCAGG + Exonic
1147924856 17:43940036-43940058 ATGTGTAAAGGGGAGAAGTGAGG - Intergenic
1148977838 17:51545134-51545156 ATGTTTGAGGGTCAGAAAGAAGG - Intergenic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1152425611 17:80217006-80217028 AGGTGCAAGGGGCGGGAGGAGGG - Intronic
1152787384 17:82255807-82255829 AGCTGTAAGGGGGACAAGGAGGG + Intronic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1154092232 18:11376304-11376326 ATGTGGTAGGAGCAGAAGGCAGG + Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1157406295 18:47424879-47424901 TGGTGTGTGGGGCAGAAGGAGGG + Intergenic
1157516004 18:48312000-48312022 ATCTCTCAGGGACAGAAGGAGGG + Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159965096 18:74587431-74587453 ATGTGAAATGGGCAGGAAGATGG - Intergenic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161585649 19:5103994-5104016 GTGGGTGAGGAGCAGAAGGAGGG + Intronic
1162186644 19:8910200-8910222 ATGTGTGTGGGGCAGAAGTCAGG + Intronic
1162739418 19:12765671-12765693 ATTTGTAAGTCGCAGAAAGAGGG - Exonic
1163290674 19:16377230-16377252 AGGTGAAAGGGCCAGAAGGTGGG + Exonic
1163365227 19:16872331-16872353 ATTTGAAGGGGGCAGATGGATGG + Intronic
1163442755 19:17329887-17329909 GTCTGTATGGGGCACAAGGAAGG - Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163827332 19:19530969-19530991 ATGTTCAAGGGGCAGAAGGGAGG - Intronic
1165171592 19:33895774-33895796 ATATTTGAGTGGCAGAAGGATGG - Intergenic
1165189389 19:34049685-34049707 ATGTGTAAGAGGGAAAAGGGTGG + Intergenic
1165376634 19:35447574-35447596 ATGTGTTGGGGGCAGAGGGCAGG + Intronic
1168262659 19:55205270-55205292 TTGTTTAAGGGGCAGTAGGCAGG - Intronic
925090837 2:1154779-1154801 ATGTGTTGGAGGTAGAAGGAAGG - Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925414704 2:3661261-3661283 ATGAGCCAGGAGCAGAAGGAAGG - Intronic
926334486 2:11853040-11853062 AGGGGGAAGGGGAAGAAGGAAGG + Intergenic
926373495 2:12204096-12204118 GTGTGGGAGGGGCTGAAGGATGG + Intergenic
926781237 2:16473995-16474017 GTTTGTAAGGGGTGGAAGGAGGG + Intergenic
927332146 2:21878185-21878207 AGGTGTAAGGGCCAGTAGGTGGG + Intergenic
927576858 2:24207762-24207784 AGGAGGCAGGGGCAGAAGGATGG + Intronic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
929191353 2:39143198-39143220 ATTGGAAAGGGGCATAAGGAGGG - Intergenic
929566201 2:42986934-42986956 ATGGGAAAGAGGTAGAAGGAAGG - Intergenic
932341435 2:70964905-70964927 ATGTGTGTGGGGCGGAAGGAGGG - Intronic
933149745 2:78900190-78900212 ATGTGTATGAGGCAGATAGATGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
936471877 2:112805939-112805961 AGGTGGAAGAGCCAGAAGGAGGG + Intergenic
936613926 2:114029160-114029182 ATGTCTCAGTGGTAGAAGGAAGG + Intergenic
936997377 2:118429725-118429747 ATGTGTAAGGGGTGGATGGCAGG + Intergenic
937011468 2:118566554-118566576 ATGTGACAGAGGAAGAAGGAGGG + Intergenic
937114832 2:119397558-119397580 AGGGGATAGGGGCAGAAGGATGG - Intergenic
937333106 2:121044375-121044397 ATGTGTGAGTGGCAGAACCAAGG - Intergenic
937730988 2:125228931-125228953 ATCTGAATGGGGCACAAGGAGGG - Intergenic
938934085 2:136113501-136113523 ATTTGTTAGAGTCAGAAGGAAGG - Intergenic
939611065 2:144311761-144311783 ATGTGTAAGTGGCAGTACTATGG - Intronic
939623246 2:144446396-144446418 ATGTGGAGAGGGAAGAAGGAGGG - Intronic
940645659 2:156390176-156390198 AGTTGTCAGGGGCTGAAGGAAGG + Intergenic
941783416 2:169473810-169473832 AAGTCTAGGGGGCAGAAGGCAGG + Intergenic
942462187 2:176175919-176175941 ATGGGGAAGTGGCAGAAGAAAGG + Intergenic
942783527 2:179673616-179673638 AAGTGAAGGAGGCAGAAGGAAGG - Intronic
945158646 2:206865403-206865425 ATGTGCAAGGTGCAGGAGCATGG + Intergenic
945891780 2:215437135-215437157 GTGAGAAAGGGGCCGAAGGAGGG - Intergenic
945898957 2:215516746-215516768 ATCTGTAAGGGAGTGAAGGAAGG + Intergenic
946354341 2:219175671-219175693 GTCTGCAAGGGACAGAAGGAAGG + Exonic
946446356 2:219742857-219742879 ATCTGTAAGGGGAAGAAATATGG - Intergenic
946650440 2:221887477-221887499 ATGTGTAGGGAGAAGAAGAATGG + Intergenic
946708599 2:222484266-222484288 GTGGGGAAGGGGCAGCAGGAAGG - Intronic
947239768 2:227981757-227981779 ATGCATGAGGAGCAGAAGGATGG - Exonic
947736060 2:232456179-232456201 ATGTCTTGGGGGCAGCAGGAGGG - Exonic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948148135 2:235723927-235723949 GTGTGAAAGTGGCAAAAGGAGGG + Intronic
949081149 2:242100663-242100685 ATGTGTATGGTGCAGTAGGAGGG + Intergenic
1168863538 20:1063900-1063922 GTATTTAAGGGACAGAAGGAAGG - Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1171391232 20:24802824-24802846 AGGTGAGAGGGGGAGAAGGAAGG + Intergenic
1172366735 20:34355749-34355771 AGGTGTCATAGGCAGAAGGAAGG + Intergenic
1172780756 20:37435911-37435933 ATGGGTAGTGGGCAGCAGGAGGG - Intergenic
1172817249 20:37697380-37697402 ATGTGAAGGGAGCAGAATGATGG + Intronic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174276864 20:49410195-49410217 ATGTGTGAGGGGGAGAAGCAGGG + Intronic
1174397476 20:50256794-50256816 ATGTGTAAGGGGAGGAAGTGGGG + Intergenic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1175322185 20:58096980-58097002 ATGAATGAGGGGCAGAAGGCAGG - Intergenic
1175355801 20:58366524-58366546 ATGTGTAATGGACTGAATGAGGG - Exonic
1175690939 20:61065644-61065666 AGGTGTAGGGGGCAGAATAATGG - Intergenic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1176422798 21:6529827-6529849 AGGTGTCAGGGGCTGAGGGAAGG - Intergenic
1177091541 21:16775290-16775312 ATGTGTCTGAGGCAGAGGGAAGG + Intergenic
1178053383 21:28771836-28771858 ATGTGTAAGTGGCAGACGACTGG - Intergenic
1178687559 21:34723414-34723436 ATGGGTAAGGAGCTGATGGAAGG + Intergenic
1178916866 21:36709664-36709686 GTGTGCAAGGGGCGCAAGGACGG + Intronic
1179037667 21:37773445-37773467 ATGAGTAGGGAGCAGAGGGAAGG + Intronic
1179136415 21:38683854-38683876 TTGTGTAAGGGGCAGAAGAGAGG - Intergenic
1179698291 21:43138144-43138166 AGGTGTCAGGGGCTGAGGGAAGG - Intergenic
1180989296 22:19924821-19924843 ACATGTGAGGGGAAGAAGGAGGG + Intronic
1181258860 22:21582965-21582987 ATGGGTACAGGGGAGAAGGAAGG - Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183421722 22:37715674-37715696 AAATGAGAGGGGCAGAAGGAAGG - Intronic
1183453809 22:37910728-37910750 AAGTGTTGGGGGCAGGAGGAGGG + Intronic
1183812798 22:40271820-40271842 ATGTGTAATGTGCGGAAGAAAGG + Intronic
1185372040 22:50465433-50465455 TGGTGGGAGGGGCAGAAGGATGG - Intronic
949779425 3:7669376-7669398 ATGTGCAAAGGGCTTAAGGATGG + Intronic
949898705 3:8792289-8792311 AGGTGGAAGGTGAAGAAGGAGGG - Intronic
949905490 3:8855144-8855166 ATGTGTGAGTGGAAGAAGGGAGG - Intronic
950426926 3:12929362-12929384 AGCTGGAAGGGGCAGAAGGACGG + Intronic
950471136 3:13187083-13187105 ATGCATAGTGGGCAGAAGGATGG - Intergenic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
952569211 3:34694402-34694424 AAGGGAAAGGGGAAGAAGGAAGG - Intergenic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
952608978 3:35183903-35183925 ATATGTAAGGAGCAGATGCAGGG - Intergenic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
953145107 3:40267732-40267754 ATGTGTAAAGGGCAGATAGAAGG + Intergenic
954178696 3:48864614-48864636 ATGTCTGAGGAACAGAAGGAAGG + Intronic
954625413 3:52019636-52019658 CTGTGTGAGGGGCAGAGGGGTGG + Intergenic
954626524 3:52024828-52024850 ATGTGGAAGGGGCCTAAGGGAGG - Intergenic
955180737 3:56666863-56666885 ATGGGTAATGGGAAGAGGGAAGG - Intronic
955468057 3:59256653-59256675 ATCGATGAGGGGCAGAAGGAGGG + Intergenic
955820398 3:62890457-62890479 ATCCGCACGGGGCAGAAGGATGG + Intergenic
955867071 3:63396400-63396422 ATGTCTAGGGGGAGGAAGGAGGG + Intronic
956070450 3:65444411-65444433 ATTTGTATAGGGCAGAAGGGTGG + Intronic
956532099 3:70231999-70232021 ATGGCTAAGGGGAAGAAGGGTGG - Intergenic
959985798 3:112569837-112569859 ATATGAAAGAGGCAGAGGGAGGG - Intronic
960127080 3:114011640-114011662 ATGTGTAAAGGGCAAAGGCAAGG + Intronic
960221100 3:115109624-115109646 ATGTGTAAGGAATAGAAGGAGGG + Intronic
960902044 3:122563605-122563627 ATGGGTGAGGGGATGAAGGAGGG - Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961380772 3:126495291-126495313 ATGTGGAATGGGGAGATGGATGG - Intronic
961765330 3:129205931-129205953 TTGTGTACGTGGCAGAATGATGG + Intergenic
962158410 3:132973699-132973721 ATTTCTAAGGGGCATAAGGGTGG - Intergenic
962201693 3:133405388-133405410 CTGTGCAAGGGACAGAAAGACGG - Intronic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
963822929 3:149919362-149919384 AGTTGGAAGGGGTAGAAGGAAGG - Intronic
963948883 3:151177020-151177042 ATGTGTTAGAGGCAGAATAAAGG + Intronic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
965384324 3:168027697-168027719 ATGTGTCAGGGGCAGAAGAGAGG + Intronic
965681726 3:171258712-171258734 AGGTGGAGTGGGCAGAAGGAGGG - Intronic
965861376 3:173155149-173155171 ATGAGTAAAGGAGAGAAGGAAGG - Intergenic
966173116 3:177105344-177105366 AAGTGTGGGGGGCCGAAGGAGGG + Intronic
966412113 3:179654481-179654503 ATGTGTGAGAAGCAGCAGGAGGG + Intronic
967036417 3:185651727-185651749 AGGTGTAAGGGGAAGTAGCATGG - Intronic
967276469 3:187780326-187780348 GTGTGTAGGGGGCAGAAGGTTGG - Intergenic
967300117 3:188004497-188004519 AGGAGTACAGGGCAGAAGGATGG - Intergenic
967445301 3:189558922-189558944 ATATGGAAGGGGCAGGAGGGTGG + Intergenic
967655540 3:192043863-192043885 ATGTGGGAGGTGCAGCAGGATGG + Intergenic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968397311 4:253697-253719 AAGTGTAAGGTGCAGAAAGGAGG + Intergenic
968509803 4:990679-990701 ATGTGTAGGAAGCAGCAGGAAGG - Intronic
968914191 4:3490029-3490051 ATGAGTAGGAGGAAGAAGGAAGG - Intronic
969686805 4:8680035-8680057 TGGTGTAAGGGGCACAAGGAAGG + Intergenic
970088700 4:12378319-12378341 ATGAGTATGGGGAAGAAGGGTGG - Intergenic
971077486 4:23166786-23166808 ATGTGTTAGGGAGAGAAGGGGGG - Intergenic
971572770 4:28234438-28234460 AAGTGGAAGGGTCAGAAGAAAGG - Intergenic
971819574 4:31533711-31533733 ATGTGTAAGTGGCATTAGGCTGG + Intergenic
972039607 4:34576057-34576079 ATGTGTAAAAGCCAGAAGGATGG - Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
973249895 4:48049757-48049779 ATGTGCAGCGGGCAGCAGGAAGG + Intergenic
973398225 4:49615530-49615552 GTGTGTCAGGGGCAGAAGACAGG + Intergenic
976344841 4:83988999-83989021 TTGAGGATGGGGCAGAAGGAGGG + Intergenic
977400749 4:96528748-96528770 ATGTTTAATGGCCAGAAGCAAGG + Intergenic
979531097 4:121769811-121769833 TTGTGTACGGGGCAGAAGCAAGG - Intergenic
981621891 4:146709975-146709997 ATGAGTGGGAGGCAGAAGGAAGG - Intronic
982786522 4:159543404-159543426 ATGTGTCAAGGGCAGAAACATGG + Intergenic
984175496 4:176411783-176411805 ATGTGTAGGGAGCAGAGGAATGG - Intergenic
985174850 4:187189804-187189826 AGGTGTAAAGGCAAGAAGGATGG - Intergenic
985650013 5:1103048-1103070 AACTGTGAGGGGCAGAGGGAGGG - Intronic
986130393 5:4924546-4924568 ATGTGTAAAGGGAAGAGGGTGGG + Intergenic
986184802 5:5425231-5425253 ATGTGGCAAGGGTAGAAGGAAGG - Intronic
986635063 5:9812941-9812963 ATGGGTTATGAGCAGAAGGAAGG + Intergenic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
989403456 5:41034084-41034106 ATGAGTAAGCTGCAGAAGGCAGG + Intronic
990125027 5:52505040-52505062 ATGAGGAAGGGAAAGAAGGAAGG + Intergenic
990809657 5:59708495-59708517 ATGTCTAAGGGACAGAAAGCTGG + Intronic
992069666 5:73137046-73137068 AAGTTTAATAGGCAGAAGGAAGG + Intergenic
993401007 5:87450957-87450979 ATGGGGATGGGGCATAAGGATGG + Intergenic
993470696 5:88304283-88304305 AGCTATAAGGGGCAGAGGGAAGG + Intergenic
994607124 5:101982176-101982198 ATCTGTAAGGATCAGAAAGAGGG + Intergenic
994766847 5:103929176-103929198 ATGTGTATGTGGCAGAAAGGAGG + Intergenic
995291707 5:110463889-110463911 CTGTGTAAGGGGTAGAAATAAGG - Intronic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996709627 5:126531385-126531407 ATCTGTTAGGGACAAAAGGAGGG + Intergenic
997508267 5:134435339-134435361 CTGTTTAAGGGGCTGAAGGGAGG + Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998464468 5:142332328-142332350 GTATGTGAGGAGCAGAAGGAAGG + Intergenic
998498838 5:142614471-142614493 ATGTGTGTGGACCAGAAGGAGGG - Intronic
998677201 5:144423132-144423154 ATGTTTGAGGAACAGAAGGAAGG + Intronic
998733971 5:145113629-145113651 ATGTTGAAAGGGGAGAAGGAAGG - Intergenic
999171815 5:149601842-149601864 ATGTTTAAAGGACAGACGGAAGG + Intronic
999227605 5:150040004-150040026 ATGTGTAAGGGGTACAACAAAGG - Intronic
999679933 5:154047338-154047360 ATGTCTATGGGGCAGTAGGTAGG + Intronic
1001324994 5:170717018-170717040 ATTCCTAAGGGGCAAAAGGAGGG + Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1003062429 6:2874217-2874239 ATTTGTAAGTGGCAGAATGAGGG + Intergenic
1003191238 6:3876867-3876889 ATTTCTAAGGGGCAGACTGAAGG + Intergenic
1003332417 6:5140865-5140887 AGGTGGAAGTGGCATAAGGAAGG - Intronic
1003541733 6:7024259-7024281 AAGTGTGAGGGGCATAAGGAAGG - Intergenic
1004892678 6:20116490-20116512 GTTTGTAAGGGACAGAAGGAAGG + Intronic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1008155391 6:48008089-48008111 ATTTCTAAGTGGCAGCAGGAAGG + Intronic
1008181067 6:48329930-48329952 GTGAGTGAGAGGCAGAAGGATGG + Intergenic
1009656145 6:66546920-66546942 ATGTGTTGGGGGCAGAGGGAGGG + Intergenic
1012818288 6:104052894-104052916 ATGAGTAGGGGGAGGAAGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013450724 6:110277915-110277937 ATGTGTAAGAAGCAAAAAGAAGG + Intronic
1013492680 6:110664499-110664521 ATGTGTAAAGCACAGAGGGATGG - Intronic
1015507088 6:133999833-133999855 ATGTGAAACAGGCATAAGGAAGG + Intronic
1015948265 6:138524999-138525021 ATGTGTAAGTGGCAAATGGGCGG + Intronic
1015988560 6:138911656-138911678 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988569 6:138911699-138911721 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1015988578 6:138911742-138911764 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988588 6:138911785-138911807 ATGTGTGAGGGAGAGGAGGAGGG + Intronic
1015988602 6:138911874-138911896 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1016490208 6:144592072-144592094 ATGTGTAAAGTGTAAAAGGAAGG - Intronic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017256762 6:152342104-152342126 ATGTGAAAGAGGCAGAAACAAGG + Intronic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1017602917 6:156102978-156103000 ATGTATAAGGGGAAGAAGAGTGG - Intergenic
1017936240 6:159007758-159007780 ATGTTTAAGGAGCAAAAGGAAGG + Intergenic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018149079 6:160921649-160921671 AGATGAAAGGGGCTGAAGGAAGG + Intergenic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1019920015 7:4157452-4157474 AGGTGGAAGGGAGAGAAGGAAGG + Intronic
1022963651 7:35453888-35453910 ATGGGTAATGGAAAGAAGGAAGG - Intergenic
1023440175 7:40177317-40177339 ATGTGCAGGGAGCAGAAGCAAGG - Intronic
1023591313 7:41783380-41783402 ATGTGAAACGGACAGCAGGAAGG + Intergenic
1023771117 7:43557437-43557459 ATGTGTGAGGGCCAGGAGAAAGG + Intronic
1025036032 7:55592971-55592993 AGGGGTAAGGGGCTGAAGGCTGG - Intergenic
1026777749 7:73241521-73241543 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1027018600 7:74794913-74794935 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1027069429 7:75151024-75151046 ATGAGTGAGAGGGAGAAGGAGGG - Intergenic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027299676 7:76818304-76818326 ATGTGTGCTGGGCAGAAGGTGGG + Intergenic
1028281640 7:88937064-88937086 ATGTGTTTGGGGCAGAAAGCAGG - Intronic
1028716718 7:93979515-93979537 ATGTGTCATGGGGAGAAGGAAGG - Intronic
1028835180 7:95366728-95366750 ATTTGTAAGTGGCAGAAACAGGG - Intronic
1029364159 7:100106637-100106659 ATCTGTGAGGGGCAGAGGCAGGG - Exonic
1029658665 7:101944524-101944546 AAGTGAGAGGGGCAGAAGGCTGG - Intronic
1030096388 7:105904302-105904324 AGGAGGAAGGGGCAGAAGAAAGG + Intronic
1030505622 7:110418259-110418281 ATGTGTCAAGGGAAGAAGCAAGG - Intergenic
1031935124 7:127728140-127728162 ATTTGTAATGGGGAGAAGAAAGG - Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033025134 7:137764868-137764890 ATAGGTAGGGGGCAGAAAGAAGG - Intronic
1033043544 7:137940037-137940059 AAGGATAAGGGACAGAAGGAGGG - Intronic
1033277590 7:139984361-139984383 ATGTGGAAGGGACACATGGAAGG - Intronic
1033681423 7:143599859-143599881 ATGTGAAAGTGACAGAGGGAAGG - Intergenic
1033703469 7:143861954-143861976 ATGTGAAAGTGACAGAGGGAAGG + Intronic
1033710029 7:143933608-143933630 ACCTGTAAAGGCCAGAAGGAGGG - Intergenic
1034819348 7:154202564-154202586 CTCGGAAAGGGGCAGAAGGATGG - Intronic
1035539057 8:417469-417491 ATGTGTATGGTGCAGTAAGAGGG + Intronic
1037234701 8:16704134-16704156 AAGTGTAAGGGGGATTAGGAGGG - Intergenic
1037344152 8:17880186-17880208 ATCTCTAAGGGCCAGAGGGAGGG + Intronic
1038163665 8:25064224-25064246 AAGTGTATAGGGCAGAAAGACGG - Intergenic
1039032162 8:33322286-33322308 ATGTGTAAGACACAGAAGGGAGG + Intergenic
1042220762 8:66471580-66471602 AATTGTAAGGGCCAGAATGATGG - Intronic
1042661146 8:71155823-71155845 ATGTGTAAAGGCTAAAAGGAGGG + Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043096209 8:75977245-75977267 TTGTGTAAGGAGCAGAGGCAGGG + Intergenic
1043488195 8:80719727-80719749 ATGTGTTAGGAGCTGAGGGATGG + Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1046877484 8:119271856-119271878 ATGTATAAGGGGCTTAAGGAAGG + Intergenic
1047060767 8:121222432-121222454 AGGTGAAAGGGACAGAAAGAAGG - Intergenic
1047446327 8:124923442-124923464 TTTTGTAAGGAGCATAAGGAAGG - Intergenic
1048626242 8:136188582-136188604 ATAGGAATGGGGCAGAAGGAGGG - Intergenic
1048836450 8:138523646-138523668 ATATGTAAGTGACAGAAGGTGGG - Intergenic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1049483072 8:142836397-142836419 ATGTGTAAGAGGCAGAAATAAGG - Intronic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1050151359 9:2622065-2622087 AGGGGAAAGGGGGAGAAGGAGGG - Exonic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1050833792 9:10050200-10050222 ATGTTTCAGGGGCAGTAGGTGGG + Intronic
1051716280 9:19988072-19988094 ATTTGCTAGGGGCACAAGGAGGG + Intergenic
1051839482 9:21379053-21379075 AATTGAAAGTGGCAGAAGGAAGG + Intergenic
1052135055 9:24898847-24898869 ATGTGGTAGGGGCAGGAGCAAGG + Intergenic
1053251578 9:36578540-36578562 AGTTGAAAGGGGCAGAATGAGGG + Intronic
1053264054 9:36697606-36697628 ATGTGGTAGGGGCAGAAGCTTGG + Intergenic
1053365338 9:37518751-37518773 AGGTGTAAGCGGCAGTAGGATGG - Intronic
1053434258 9:38065153-38065175 ATGAGTGAGGGGCAGAAGGAAGG + Intronic
1055331379 9:75187556-75187578 CTTTGTAAGGGACAGAAGAAGGG + Intergenic
1055407229 9:75987642-75987664 ATGTTTAAGGGGAAAAAGGGAGG + Intronic
1057417182 9:94874960-94874982 CTGTGTAAGGGGCTCAAGGATGG + Intronic
1058162493 9:101584957-101584979 GTGTGGAATGGGCACAAGGAAGG - Intronic
1058247881 9:102653460-102653482 AAGTGTGAGGGGGAAAAGGAGGG + Intergenic
1059153139 9:111967043-111967065 AAGAGTAAGGCTCAGAAGGAAGG + Intergenic
1059373340 9:113861698-113861720 ATGTCTACTGGGGAGAAGGAGGG - Intergenic
1060044380 9:120328087-120328109 AAATGTGAGGGGCAGAAGGTGGG + Intergenic
1060860809 9:126953410-126953432 AGGTGAGAGAGGCAGAAGGAGGG + Intronic
1061163658 9:128910307-128910329 CTGTGTCGGGGGCAGAAGGGTGG - Intronic
1061388300 9:130303253-130303275 ATGTGTCAGGGCAGGAAGGATGG + Intronic
1186309057 X:8297271-8297293 AAGTGTAAGAGAGAGAAGGAAGG - Intergenic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1188182344 X:27072236-27072258 ATGTGACAGGGACAGAAGGCAGG + Intergenic
1189067354 X:37824602-37824624 ATGTGTGAGGGGCAGCAAGGTGG - Intronic
1190050024 X:47142565-47142587 ATGGGTAAGAGGCAGAGGCAGGG - Exonic
1190540918 X:51477825-51477847 ATGTGCAAGGTGTATAAGGAAGG - Intergenic
1192588814 X:72342557-72342579 ATGATCAAGGGGTAGAAGGAAGG - Intronic
1193478318 X:81995254-81995276 CTGTATTGGGGGCAGAAGGAGGG - Intergenic
1195418526 X:104647113-104647135 CTGGGATAGGGGCAGAAGGAAGG + Intronic
1195480222 X:105336505-105336527 ATGACTAAGGAGCAGAACGAGGG - Intronic
1195667577 X:107444906-107444928 AAGTGAAATGGGCAGAAGCAAGG + Intergenic
1198437405 X:136630560-136630582 CTGAGTGAGGGGCAGAAGGTGGG + Intergenic
1199491506 X:148405313-148405335 ATGAGTAAGGTGCAGAGGAAGGG - Intergenic
1200281673 X:154781980-154782002 ATGTGTCCTGGGCAGATGGAGGG - Intronic
1201165038 Y:11201374-11201396 ATGTGTCAGGGGCAGACGACAGG + Intergenic
1201434154 Y:13938951-13938973 ATGGGTGAGGGGGAGAGGGAAGG - Intergenic