ID: 1163668087

View in Genome Browser
Species Human (GRCh38)
Location 19:18612448-18612470
Sequence CTCCCTCTCCGTTCCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163668080_1163668087 15 Left 1163668080 19:18612410-18612432 CCAGGACTCAGCTGCCGGGTCCT 0: 1
1: 0
2: 0
3: 14
4: 231
Right 1163668087 19:18612448-18612470 CTCCCTCTCCGTTCCCTGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1163668082_1163668087 1 Left 1163668082 19:18612424-18612446 CCGGGTCCTGCGGCTCTCACCTT 0: 1
1: 0
2: 0
3: 26
4: 1078
Right 1163668087 19:18612448-18612470 CTCCCTCTCCGTTCCCTGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1163668083_1163668087 -5 Left 1163668083 19:18612430-18612452 CCTGCGGCTCTCACCTTCCTCCC 0: 1
1: 0
2: 3
3: 48
4: 507
Right 1163668087 19:18612448-18612470 CTCCCTCTCCGTTCCCTGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163668087 Original CRISPR CTCCCTCTCCGTTCCCTGGT TGG Intronic
900321812 1:2088268-2088290 CTCCCTCCCCCTTGCCTGGATGG + Intronic
900557016 1:3285656-3285678 CTCCGTCTCTGGTCCCTGGACGG + Intronic
900694793 1:4002971-4002993 CTCCCTCTGCGGGCCCTGGGGGG - Intergenic
905514903 1:38555476-38555498 CTTCCTCTCCTTTCCCAGGCTGG - Intergenic
906484252 1:46222118-46222140 CTCCCTCTCCTTTTCCAGGATGG - Intergenic
906544451 1:46611596-46611618 CTTCCTCACCATTCCCAGGTGGG + Intronic
910425933 1:87120111-87120133 CTCCCTCACCTGCCCCTGGTGGG + Intronic
914919258 1:151836675-151836697 TTCCTTCTCCCTTCCCTGATTGG - Intergenic
916512249 1:165482664-165482686 CTTCCTCTTCTTTTCCTGGTAGG - Intergenic
917083848 1:171285656-171285678 CACCCTCTCGCTTCCCTGGCTGG + Exonic
917209475 1:172616716-172616738 CTCCCCCTCCCTTCCCAGTTGGG + Intergenic
917761243 1:178160802-178160824 CTCCATCCCCCTTCTCTGGTTGG - Intronic
920230463 1:204466604-204466626 CTCTCTCTCCTTTCTCTTGTGGG - Intronic
920313296 1:205061075-205061097 CTCACTCTCCTCTCCCAGGTAGG - Intronic
921334934 1:214076475-214076497 CTCCCTCTTCACTCCCTGGCTGG - Intergenic
924748539 1:246862031-246862053 CTCCCTCTCCATCACCTGGAAGG - Exonic
1062965509 10:1604465-1604487 CTCCCTCTCCCTTTCCAGGAAGG - Intronic
1063367974 10:5502778-5502800 CTTCCTCTCACTTCCCTGCTGGG - Intergenic
1068421826 10:56804200-56804222 CTCCCTCCCCTTTTTCTGGTAGG - Intergenic
1069512507 10:69052922-69052944 CTGCATCTCAGTTCCCTCGTAGG - Intergenic
1070154483 10:73825044-73825066 CTCCTGCTCCTTTCGCTGGTGGG - Intronic
1071574978 10:86718617-86718639 CTCCTGCCCTGTTCCCTGGTAGG + Intronic
1072670533 10:97426045-97426067 CTCCCTCTCCAGTCCCGCGTCGG - Exonic
1073050481 10:100663821-100663843 CTCCCTCTGCCTTCCCTAGGTGG - Intergenic
1073301809 10:102475490-102475512 GTCCTCCTCAGTTCCCTGGTTGG - Intronic
1074352475 10:112751302-112751324 CTCTCTCTACGTGCCCTGGCAGG - Intronic
1076497333 10:130905608-130905630 CTCCCCCTCCCCTCCCTGGATGG + Intergenic
1076606421 10:131692447-131692469 CTCCCTCTTCCTTCACTGCTGGG + Intergenic
1076627182 10:131829302-131829324 CTGCCTCCCTGTTTCCTGGTGGG - Intergenic
1078054203 11:7994081-7994103 CTCTGTCTCCTTTCCATGGTAGG + Intronic
1078086682 11:8237681-8237703 CTTCCTCTCCCTGCCCTCGTGGG - Intronic
1080563657 11:33487946-33487968 CTCCCTTTCCCATCCCTGGGAGG + Intergenic
1081630734 11:44687947-44687969 CTGCCTCTGCCTTCCCTGCTGGG - Intergenic
1081747996 11:45486465-45486487 CTCCCTCTCCACTCCCTTCTAGG - Intergenic
1083270822 11:61571700-61571722 CTCCCTCTCCACCCCCAGGTTGG - Intronic
1083404794 11:62449245-62449267 CTCTCCTTCCGTTCCCTGGCTGG + Intronic
1083729029 11:64643163-64643185 CTCGCTCTCCCCTCCCTGCTTGG - Intronic
1083734573 11:64672096-64672118 CACCCTCTCCCTTCTCTGGCTGG - Intronic
1085821807 11:79801863-79801885 CTCCCTCTCTGAACCCTTGTAGG + Intergenic
1087241902 11:95789797-95789819 CTCCCTTTCCCATCCCTGATTGG + Intronic
1089620140 11:119717442-119717464 CTGCCTCTCCCTTCCCGGGCAGG - Intronic
1090534434 11:127625306-127625328 CCCCCTCTCAGTGGCCTGGTGGG + Intergenic
1090797858 11:130150741-130150763 CTCCTTCTCAGCTCCCTTGTAGG + Intergenic
1091232838 11:133999636-133999658 CTCCCTCTCCGACTCCTGGGAGG - Intergenic
1091261918 11:134241450-134241472 CTCACTCTCTGTTCACTGGTGGG - Intronic
1094186254 12:27646073-27646095 ACACATCTCCGTTCCCTGGTAGG - Exonic
1097995318 12:65881979-65882001 CTCCATCTCCTGTCCCTGGGCGG + Exonic
1098224146 12:68304080-68304102 GTCTCTCTCCGTTTCCTGGCTGG - Intronic
1099690628 12:85947325-85947347 CTCCCTCTCTGTTCCTGGGCAGG - Intergenic
1100006511 12:89901465-89901487 CTCCCTCTCCCTTCCCAGGGAGG + Intergenic
1100815169 12:98380050-98380072 CTCCAAATCCATTCCCTGGTTGG + Intergenic
1102030097 12:109735327-109735349 TTCCCTCTCTGTTTCCTCGTGGG + Intronic
1102165675 12:110804690-110804712 CTCTCTCTCAGTTCTCTAGTTGG + Intergenic
1102720854 12:115014679-115014701 CTCCCTCTCCTTTCTCTGATAGG + Intergenic
1103971488 12:124675553-124675575 CTTCCTCTCCTTCCCCTGGCAGG - Intergenic
1104157007 12:126143014-126143036 CTCTCTCTCCTTTCTCTGGGAGG + Intergenic
1104730914 12:131104881-131104903 CTCCCTCTCCGTGCTCTGCCTGG + Exonic
1104749950 12:131231938-131231960 CTCCTCCTCCTGTCCCTGGTGGG + Intergenic
1104782769 12:131432504-131432526 CTCCTCCTCCTGTCCCTGGTGGG - Intergenic
1105902095 13:24764244-24764266 CTTCCTCCCCATTCGCTGGTAGG - Exonic
1105991857 13:25630092-25630114 TTCCCTCCCAGTTCCCTGTTTGG - Intronic
1115932296 14:38510058-38510080 CTCCCTCTCCTTGCCCTTTTAGG + Intergenic
1116427874 14:44811973-44811995 CTCCCTCTCCTTTCCTTGCAAGG - Intergenic
1117072252 14:52068159-52068181 GTCCCTCTCCTCTCCCAGGTGGG - Exonic
1119685342 14:76626570-76626592 CTCCCTCTCTGTTCCCTTTGAGG - Intergenic
1119770868 14:77219980-77220002 CTCCCTGCCCCTTCCCTGGCTGG + Intronic
1120584568 14:86296263-86296285 GTCTCTCTCCTTTCCCTGGCTGG + Intergenic
1124490387 15:30151600-30151622 CTCCGTCTCCTTTCCCTGGGAGG - Intergenic
1124753145 15:32386729-32386751 CTCCGTCTCCTTTCCCTGGGAGG + Intergenic
1124974884 15:34522429-34522451 CTCCCTCTTCTTTCCCTGGGAGG + Intergenic
1125797057 15:42410747-42410769 TTCCCTCTCCTTTCTCTAGTGGG - Intronic
1126981448 15:54248808-54248830 CTGAGGCTCCGTTCCCTGGTAGG + Intronic
1127233232 15:57019466-57019488 CTCCCTCTGAGTTCCCAGGGAGG - Intronic
1127282866 15:57506589-57506611 CTCCTTTTCCCTTCCCTGGCTGG + Intronic
1129252532 15:74316694-74316716 CTCCCTTTCATTTCCCTGGAGGG + Intronic
1129273090 15:74429572-74429594 CCCCGTCACAGTTCCCTGGTGGG - Intronic
1129351608 15:74958760-74958782 CCCCCTCCCCGTCTCCTGGTGGG + Intronic
1132328538 15:100993895-100993917 CTACCTATCTGTTCCTTGGTTGG + Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134037454 16:11041867-11041889 CTCCTTCCCCGTTCCAGGGTTGG - Intronic
1135643775 16:24143522-24143544 CTCCCTCTCCCATCCCTGCTAGG - Intronic
1139695253 16:68669694-68669716 CTCCTTCTGGGTTACCTGGTGGG + Intronic
1142366744 16:89654150-89654172 CTCCCTCCCTGTTTCCTTGTTGG + Intronic
1143181551 17:4987159-4987181 CTCCCGCTCCGCACCCTGGCAGG - Intronic
1143868845 17:9943481-9943503 CTTCCTCTCAGTTCCCAGGTTGG - Intronic
1144287196 17:13788315-13788337 ATACCTCCCTGTTCCCTGGTGGG + Intergenic
1144763052 17:17718132-17718154 CTCCCCCTGCTTCCCCTGGTCGG + Intronic
1146688916 17:34859688-34859710 TTCCCTCCCCAGTCCCTGGTGGG + Intergenic
1147044363 17:37742657-37742679 GTCCCTCTCCCTGCCCTGCTGGG + Intronic
1147742267 17:42676109-42676131 CTGCCTCTCCCTTCCCCGCTGGG - Intronic
1148559410 17:48597382-48597404 CCCCCTCTCCCAGCCCTGGTAGG - Intronic
1148693355 17:49545415-49545437 CCCCCTCTTCCTTCCCTGGGGGG - Intergenic
1149554963 17:57566979-57567001 CTTCCTATCCGTGCCCTGGAGGG + Intronic
1150004077 17:61458931-61458953 CTTCCTCTCTGCTCCCTGGCAGG + Intronic
1151201035 17:72468148-72468170 CTCCCTCTCAGTGCCGTGGCGGG - Intergenic
1151370620 17:73644491-73644513 CCCCCTCCCCGCCCCCTGGTTGG + Intergenic
1156494510 18:37517147-37517169 CTCCCTCCCCATGCCCTGCTTGG + Intronic
1157298852 18:46465348-46465370 CTCCCTCTCCTTTTCCTAGATGG + Intergenic
1158425991 18:57340051-57340073 CTCCCTCTCCCTTTCCCAGTTGG + Intergenic
1159354214 18:67316239-67316261 TTCCCTCTCCCTTCCCTGGTAGG - Intergenic
1159878941 18:73839765-73839787 CACCCTTTCCTTGCCCTGGTAGG + Intergenic
1160556730 18:79730375-79730397 CTCCCTCCTGGTTTCCTGGTCGG + Intronic
1161545587 19:4878317-4878339 CTGCCTCTTTGTTCCCTGGGCGG + Intergenic
1161985470 19:7651065-7651087 ATCCATCTCCCTGCCCTGGTGGG - Intergenic
1163359724 19:16838028-16838050 CTCTCTCCCCGTGCCCTGGGTGG - Intronic
1163386964 19:17005665-17005687 CTCCCTGTCCCTTCCCTGTATGG - Intronic
1163598662 19:18234857-18234879 CTCCCTCTCTGTTCTATGCTTGG + Intronic
1163668087 19:18612448-18612470 CTCCCTCTCCGTTCCCTGGTTGG + Intronic
1163730033 19:18943637-18943659 CACCCTCTCCGGTCTCTGGGAGG + Intergenic
1165403368 19:35615730-35615752 CTCCCTCTCCCTTCTATGATAGG - Intronic
1165705752 19:37975213-37975235 CTCTCTCTCTGTTTCCTGTTTGG - Intronic
1165861005 19:38909311-38909333 CTCCACCTCCTTTTCCTGGTGGG + Exonic
1165979331 19:39706575-39706597 CTCACTCTCCATACCCTGGCAGG + Exonic
1166421010 19:42635852-42635874 TTCCCTCTCTGTTCCCAAGTAGG + Intronic
1168486944 19:56771375-56771397 CTCCCTCTCGAGTCCCTGGCAGG - Intergenic
925688671 2:6497677-6497699 CTCCCTCTCAGGTCCCTTTTTGG + Intergenic
927114412 2:19886717-19886739 CTCCCTCTTCTTGCCCTGGAGGG - Intergenic
927903449 2:26840274-26840296 CTCCCTCTCCCATCCCTTTTTGG - Intergenic
929133701 2:38602888-38602910 CTCCGTCTCCGCTCCCTGCCCGG + Exonic
929577263 2:43059748-43059770 CTCCCTCTCAGTACCGTGGCTGG + Intergenic
932019874 2:68073608-68073630 CTCCCCCACCCTTCTCTGGTTGG + Intronic
933637231 2:84721418-84721440 CTTCCCCTCCCTTTCCTGGTGGG + Intronic
933760844 2:85670872-85670894 CTCCATCTCCCTTCCCTCCTGGG - Intergenic
939526333 2:143299631-143299653 CTCTCTCTCCTTTTCCTGTTTGG + Intronic
941118749 2:161504017-161504039 CTCCCTCTCCATCACCTGGAAGG - Intronic
944746630 2:202663611-202663633 CTCACTCTCCTTTCCCAGGCTGG + Intronic
945976748 2:216277101-216277123 TTCCTTTTCCATTCCCTGGTGGG + Intronic
946516114 2:220412926-220412948 CTCACTCACCCTTTCCTGGTTGG + Intergenic
947712953 2:232326211-232326233 CACCCTGTCAATTCCCTGGTGGG - Intronic
947732636 2:232439667-232439689 CACCCTGTCAATTCCCTGGTGGG - Intergenic
947841395 2:233209992-233210014 CTCCCAGTGCGTTCCCTGGGTGG - Intergenic
1169519608 20:6356746-6356768 CTTCCTCTCCCTTCCAGGGTTGG + Intergenic
1171106466 20:22438250-22438272 CTCCCTCTCCATGCACTTGTTGG - Intergenic
1173556319 20:43968508-43968530 CTACCTCTCCTTTCCCTGTGTGG - Intronic
1173860582 20:46280617-46280639 CTCACTCACTGTTCCCTGGGAGG + Intronic
1174378378 20:50141018-50141040 CACTATCTCCCTTCCCTGGTTGG - Intronic
1174681735 20:52415266-52415288 CTCCCTGTCCACTCCCTGGATGG + Intergenic
1175841075 20:62027892-62027914 ACCCCTCTCAGTTCCCTGCTGGG + Intronic
1175900532 20:62358246-62358268 CTCCCTCTACGTGTCCTGGAAGG - Intronic
1178755785 21:35348320-35348342 CCCCCTCTCCATTTCCTGCTGGG + Intronic
1179816746 21:43911003-43911025 ATCCCACTCCGTTTCCTGGAGGG + Intronic
1182110379 22:27718889-27718911 CTCCCTCTCCCTCCCTTGCTGGG + Intergenic
1183043704 22:35202957-35202979 CTCTCTCTCAGATCCCTGTTAGG - Intergenic
1184999544 22:48236504-48236526 CTCCCGCTCTGTACCCTGCTCGG - Intergenic
1185222250 22:49634942-49634964 TTCTCTCTCTGTCCCCTGGTGGG - Intronic
949160199 3:872892-872914 CTCCCTCTCTCTTCCCTGGAGGG + Intergenic
950101792 3:10361679-10361701 GTCCCTCTCCCTTCCCTGCCAGG + Intronic
950710807 3:14811465-14811487 CTCCCTCGCAGCGCCCTGGTCGG + Intergenic
954314946 3:49795910-49795932 CTCCCTCACTGTTCCAGGGTAGG + Intronic
954437485 3:50503710-50503732 CTCCCTCTCTCTTCCCGGGCTGG + Intronic
954468537 3:50673151-50673173 CTTCTTTTCCCTTCCCTGGTTGG + Intergenic
955349760 3:58184693-58184715 CTCTCTCCCCTTTCCCTGGCTGG - Intergenic
955631874 3:60983261-60983283 CTCCCTCTTCCTTCCCTGGATGG - Intronic
955814279 3:62825564-62825586 CTCCATCTCCAATCCCTTGTTGG + Intronic
961623661 3:128244166-128244188 CTCCCTCCTTGTTCCCTGCTGGG + Intronic
963025248 3:140912890-140912912 CTCTCTCTCTCTTCCTTGGTGGG + Intergenic
963900869 3:150732328-150732350 CTCCCCAACAGTTCCCTGGTTGG + Intergenic
966490463 3:180522477-180522499 CGCCCTCCCCATTCTCTGGTTGG - Intergenic
968462503 4:732378-732400 CTCCCTCTCCCTTCCTGGGCAGG + Intronic
969868875 4:10092754-10092776 CTCCCTCTTTGTTCACTGGCCGG - Intronic
975462871 4:74675096-74675118 CTCCCTCTGAATTTCCTGGTGGG + Intergenic
975492216 4:75001876-75001898 CCCCTTCCCCGTTCCCTGGATGG + Intronic
976605258 4:86976609-86976631 CTCCCCCTCCATCCTCTGGTAGG - Intronic
979863976 4:125729846-125729868 CTCACTCTCCTTGCCCTGGCTGG - Intergenic
980893177 4:138836449-138836471 CTCTCTCTCCGCTCCCTGTATGG - Intergenic
982046932 4:151457459-151457481 CCCTCTCTCCCTTTCCTGGTAGG - Intronic
985646957 5:1089453-1089475 CCCCGGCTCCGTTCCCTGGATGG + Intronic
993512666 5:88790854-88790876 ATCCCTCTCCTTTCCCTGAAGGG - Intronic
994338493 5:98598251-98598273 CTCCCTCTCCCTTCAGTGGAGGG - Intergenic
996168396 5:120256265-120256287 CTCCCTCTCTTTTCTCTTGTTGG + Intergenic
996344193 5:122471895-122471917 CTCTCTCTCCCTCCCCTGCTGGG + Intergenic
998130046 5:139647268-139647290 CCCCCTCTCCCTCCCCTGCTTGG + Intergenic
1003841552 6:10125658-10125680 CTCCGTCTCTCTTCCCTGGTAGG + Intronic
1004906600 6:20242407-20242429 GCCCCTCTCCCCTCCCTGGTGGG + Intergenic
1006083724 6:31581845-31581867 GGCCGTCTCCGTTACCTGGTTGG + Exonic
1007521629 6:42454561-42454583 CTCCCGCTCAGGTCCCTGGGCGG - Intergenic
1014109618 6:117605833-117605855 CTCCCTCTCCAGTCCAAGGTGGG - Intergenic
1015841288 6:137479923-137479945 CTCCCTCTCCTTTCTCTAGGTGG - Intergenic
1016410241 6:143775239-143775261 CTCCCCCGAGGTTCCCTGGTAGG - Intronic
1016708521 6:147142319-147142341 CTCCTGCTCGGTTCACTGGTAGG + Intergenic
1019578637 7:1749468-1749490 CACACTCTCAGGTCCCTGGTGGG - Intergenic
1020564444 7:9778101-9778123 CTCCCTCTCCTTTCACAGGTAGG + Intergenic
1022881067 7:34587942-34587964 CTCTCTCTCCCTTCCCTCTTGGG - Intergenic
1023770237 7:43550437-43550459 CTCCCTTTCCGTGACCTTGTAGG - Exonic
1029703167 7:102260994-102261016 AGCCCTCCCAGTTCCCTGGTTGG - Intronic
1032016210 7:128381788-128381810 CCCACTCTCCTTTCCCTGGCAGG - Intergenic
1033921533 7:146398805-146398827 CAGCCTCTCCCTGCCCTGGTGGG - Intronic
1034968246 7:155404410-155404432 CTCCCTCTCTGTTCCTGGGTTGG - Intergenic
1039098679 8:33915765-33915787 TTCCCTCTCTGGTCCCTGGCAGG - Intergenic
1039247255 8:35622310-35622332 CTCCCTCTCTGTTGCCAGGCTGG - Intronic
1039912469 8:41835941-41835963 TGCCCTCTCCCCTCCCTGGTGGG - Intronic
1040799926 8:51329064-51329086 CTCCTACTCCTTTCCCTGGCTGG - Intronic
1045883373 8:107066595-107066617 CCCCCTCTCCCTCCCCTGGTAGG - Intergenic
1047361158 8:124170542-124170564 CTCCCTCTGCTTTCCCTAGTGGG - Intergenic
1049452527 8:142669853-142669875 GGCGCTCTCCGGTCCCTGGTGGG - Intronic
1049600469 8:143505155-143505177 CTCCCTCTCCCATCCCTGGAGGG - Intronic
1049778256 8:144416126-144416148 CTGCCTCTCCCCTCCCTGGTGGG - Intronic
1052636834 9:31117302-31117324 CCCACTCTCAGTTCCATGGTGGG - Intergenic
1052854958 9:33401411-33401433 CTCCCTCCCTGTTCCTTGGCTGG - Intronic
1053682978 9:40497740-40497762 CTCCCTCCCTGTTCCTTGGCTGG - Intergenic
1054280736 9:63127188-63127210 CTCCCTCCCTGTTCCTTGGCTGG + Intergenic
1054296078 9:63333240-63333262 CTCCCTCCCTGTTCCTTGGCTGG - Intergenic
1054394094 9:64637735-64637757 CTCCCTCCCTGTTCCTTGGCTGG - Intergenic
1054428744 9:65142948-65142970 CTCCCTCCCTGTTCCTTGGCTGG - Intergenic
1054501636 9:65878595-65878617 CTCCCTCCCTGTTCCTTGGCTGG + Intronic
1055689388 9:78812774-78812796 CTTCCTCCCCACTCCCTGGTTGG + Intergenic
1055847588 9:80585685-80585707 CTCCCTCTTAGTTCCCAAGTAGG - Intergenic
1058739707 9:107930746-107930768 CTCCCTCTGGTTGCCCTGGTTGG - Intergenic
1058942974 9:109831312-109831334 CACACTCTCCGGACCCTGGTGGG - Intronic
1058961313 9:109995164-109995186 CTTCCTCTCCAGTCCCTGGGTGG - Intronic
1059161595 9:112040050-112040072 CTCCTTCTCCCTTGCCTGCTAGG - Intergenic
1059494530 9:114698652-114698674 CTCTCTCTGCGTTTCCTGGAGGG + Intergenic
1059502564 9:114767491-114767513 CTCCCTCTTTGCTCCCTGGCAGG - Intergenic
1061642402 9:131969619-131969641 CTCCCTCTCCAATCCCTCTTGGG - Intronic
1062232128 9:135487536-135487558 GTCCCTCTCCGCTCCCGGGCTGG - Exonic
1186645189 X:11499516-11499538 CTCCCTCTCCATTCCCCTCTGGG + Intronic
1186778769 X:12892194-12892216 CTCCCTCTCGGTTTCCTTTTTGG + Intergenic
1192564704 X:72153953-72153975 GCCCCTCTCCCTTCCCTTGTAGG - Intergenic
1198177534 X:134171854-134171876 CTCCCCCTCCATTCCCGGGTTGG + Intergenic
1198218952 X:134582090-134582112 TTCCCTCCCCATTCCCTGTTTGG - Intronic
1200133814 X:153865052-153865074 CTCCACCTCCCTTCCCTGCTGGG + Intronic
1201398588 Y:13577222-13577244 CTGCCTCTCCGCTCCCTGACAGG - Intergenic