ID: 1163668518

View in Genome Browser
Species Human (GRCh38)
Location 19:18614048-18614070
Sequence GGGGAGAGGTGGCCTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 1, 2: 12, 3: 91, 4: 989}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163668506_1163668518 1 Left 1163668506 19:18614024-18614046 CCCGCCGGCAGGGTGGGCCAGCG 0: 1
1: 0
2: 0
3: 20
4: 183
Right 1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG 0: 1
1: 1
2: 12
3: 91
4: 989
1163668507_1163668518 0 Left 1163668507 19:18614025-18614047 CCGCCGGCAGGGTGGGCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG 0: 1
1: 1
2: 12
3: 91
4: 989
1163668497_1163668518 29 Left 1163668497 19:18613996-18614018 CCCAAACTGAGTGTGAAGCAGGT 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG 0: 1
1: 1
2: 12
3: 91
4: 989
1163668509_1163668518 -3 Left 1163668509 19:18614028-18614050 CCGGCAGGGTGGGCCAGCGTGGG 0: 1
1: 1
2: 6
3: 42
4: 271
Right 1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG 0: 1
1: 1
2: 12
3: 91
4: 989
1163668498_1163668518 28 Left 1163668498 19:18613997-18614019 CCAAACTGAGTGTGAAGCAGGTG 0: 1
1: 0
2: 2
3: 12
4: 146
Right 1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG 0: 1
1: 1
2: 12
3: 91
4: 989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163668518 Original CRISPR GGGGAGAGGTGGCCTGGGAA GGG Intronic
900361199 1:2289874-2289896 GGGAAGGGGTGGCCTGGCCAGGG + Intronic
900538270 1:3189759-3189781 GAGGAGAGGGGGTCTGGGAGTGG + Intronic
900575126 1:3379193-3379215 TGGGAGAGGTGTGCTGGGAGGGG - Intronic
900575169 1:3379333-3379355 TGGGAGAGGTGTGCTGGGAGGGG - Intronic
900609347 1:3537880-3537902 GGAGATGGGTGGCCTGGGAGGGG + Intronic
900714140 1:4133251-4133273 GGGAAGAGGAGGCCTGGGGCAGG + Intergenic
900785122 1:4644468-4644490 GGAGGGACGTGTCCTGGGAAGGG + Intergenic
900857018 1:5194389-5194411 GGAGGGAGATGGCATGGGAAGGG + Intergenic
901217243 1:7561676-7561698 GGGGAGGGGTGGCCTCTGACGGG - Intronic
901217259 1:7561735-7561757 GGGGAGGGGTGGCCTCTGACAGG - Intronic
901386041 1:8909922-8909944 GAGGAGAGGTGGGCGGGGATTGG + Intergenic
901634416 1:10663912-10663934 GGGCAGAGCTGGCCTGGGTGGGG + Intronic
901648046 1:10727165-10727187 AGGGAGAGGTGGCCAGGGGTAGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
901829433 1:11883160-11883182 AGGGAGGGGTGGCCTAGGCATGG - Intergenic
901835886 1:11923811-11923833 GAGGAGAAGTGGCCTGAGACTGG - Intronic
902178557 1:14670099-14670121 GGGGAGGGGAGGGCTGGGGAGGG - Intronic
902232360 1:15036205-15036227 GGGGAGAGGTAGGCAGGGTAGGG - Intronic
902255851 1:15188190-15188212 GGGGAGAGGCTGCCTGAGGAGGG - Intronic
902315489 1:15615702-15615724 GGGAAAAGGGGGGCTGGGAATGG - Intergenic
902376485 1:16032372-16032394 AGGGAGAGGTGGTCTGAGAGAGG + Intronic
902480215 1:16707743-16707765 GGGGAGAGAGGGCCGGGGGATGG + Intergenic
902538478 1:17135630-17135652 GGGGAGGGCTGTTCTGGGAAGGG + Intergenic
902712415 1:18249476-18249498 AGGGAAAGGTGGTGTGGGAAGGG + Intronic
902720438 1:18300786-18300808 GGGGGTAGGAGGCCTGGGATTGG - Intronic
902779277 1:18693919-18693941 GGAGGGAGGGGGTCTGGGAATGG + Intronic
902817141 1:18922860-18922882 GGTGAGAGGTGGCCTGGGACCGG - Intronic
902980290 1:20117827-20117849 GGGGACCGTTGGGCTGGGAAGGG + Intronic
903141861 1:21344145-21344167 GGTGAGAAGAGGCCTTGGAAGGG + Intronic
903151759 1:21414872-21414894 CGGGAGAGCTGGCCAGGGATCGG - Intergenic
903275087 1:22216511-22216533 GCAGAGAGGTGCCCTGGGAGAGG - Intergenic
903679313 1:25086770-25086792 AGAGAGAGGTGGCCTGGGGAGGG - Intergenic
904259492 1:29280212-29280234 AGGGTGAGCTGGCCTGGGATGGG - Intronic
904468476 1:30721739-30721761 CGGCAGAGATGGCCTGGGAGTGG + Exonic
904719767 1:32499279-32499301 GGGGACAGGTCCCCTGAGAAGGG + Intronic
905172713 1:36118589-36118611 GGGGAGACGTCGCCAGGGGAGGG - Intronic
905212583 1:36385105-36385127 GGGGCCAAGTGGCGTGGGAATGG + Intronic
905336738 1:37249670-37249692 GGGGAGAGGAGCATTGGGAAGGG - Intergenic
905593739 1:39187951-39187973 GGGGAGAGGAGGGGAGGGAAGGG - Intronic
906105657 1:43290577-43290599 GGGGAGGGTTGGCCTTGGACAGG + Intergenic
906146905 1:43565757-43565779 GAGGAGCCGGGGCCTGGGAAGGG + Intronic
906297443 1:44657932-44657954 GGGGAGGGGTAGTCTTGGAAAGG - Intronic
906308673 1:44738051-44738073 GGGGAGAGGGGGAGGGGGAAAGG - Intergenic
906519350 1:46458122-46458144 GGGAAGGAGTGGCCTGGGAGCGG - Intergenic
907307935 1:53523873-53523895 GAGGAGAGGTGGTGTGGGCAGGG - Intronic
907384317 1:54116111-54116133 GAGGAGAGGTGGCCTGACCAAGG - Intergenic
907447284 1:54516632-54516654 AGGGAGAGGAGGCCTGAGAGAGG + Intergenic
907678351 1:56539657-56539679 GAGGAGAGGGGGGCAGGGAAAGG + Intronic
907939837 1:59076995-59077017 GAGGAGAGATGGGCTGGGCAAGG + Intergenic
909238258 1:73180491-73180513 GCAGAGAGGAGGCCTGGAAAGGG + Intergenic
909517977 1:76533657-76533679 TGGGAAAGGTGGTCTGGGTAAGG - Intronic
910849685 1:91637940-91637962 GGGGTGAGGTGGCCCATGAAGGG + Intergenic
911152832 1:94611418-94611440 GGGGAGAGCTGGTCTGAGAATGG + Intergenic
912453599 1:109783281-109783303 GGGAGGGGGTGTCCTGGGAAGGG + Intergenic
912507071 1:110163712-110163734 AGGGAGAGGTGTGCTGGGGAGGG - Intronic
912514123 1:110207444-110207466 GTGGAGGGGGGGCCTGGAAAGGG + Intergenic
913196171 1:116458013-116458035 AGGGAGGGGTGGGCTGGGGAGGG - Intergenic
913218809 1:116643281-116643303 AGAGAGAGGTGGCGTGGGAGGGG - Intronic
913333651 1:117687567-117687589 GAGGAAGGGTGGCATGGGAATGG - Intergenic
913680302 1:121183975-121183997 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
914032137 1:143971626-143971648 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
914157308 1:145096341-145096363 GGGAAGAGGAGGCGTGGGTAGGG + Exonic
914517807 1:148388893-148388915 AGGCAGATGGGGCCTGGGAAAGG - Intergenic
914790834 1:150876386-150876408 GGGGAGCGGTGACCTGGGGAGGG - Intronic
914826683 1:151142540-151142562 GGGGAAAGGCGGCCTGAGTATGG + Exonic
914827736 1:151147242-151147264 GGGGGCTGGAGGCCTGGGAAAGG + Intergenic
915511914 1:156391228-156391250 GAGGTGAGCTGGCCGGGGAAAGG - Intergenic
915518884 1:156429964-156429986 GTTGAGGGGAGGCCTGGGAAGGG - Intronic
915585816 1:156843388-156843410 GTGGACAGGTGGTGTGGGAAAGG - Intronic
915841336 1:159215881-159215903 GGGCAGAGGGAGCCTGGGAAAGG - Intergenic
915997658 1:160580572-160580594 TGGGAGATGTTGTCTGGGAATGG + Intergenic
916427246 1:164692489-164692511 AGGGAGTGGTGGGGTGGGAATGG - Intronic
916464716 1:165062407-165062429 GGGGAAAGGGGGGCTGGCAAAGG + Intergenic
916479677 1:165203771-165203793 GGGAAGAGGTGGGTTGGGGAGGG - Exonic
916608159 1:166363547-166363569 TGGGAGAGGTGGCCAGGGTAAGG - Intergenic
916673972 1:167050688-167050710 GGGGTGAGATGGCCTGGGTCAGG + Intergenic
916704143 1:167329415-167329437 GGGGAGAGTTGGACTGAGCAGGG + Intronic
917513023 1:175683686-175683708 GGGGAGGGGAGGGCAGGGAAAGG + Intronic
917735975 1:177920875-177920897 GGGGAGAGGTGGTGGGAGAAAGG - Intergenic
917846652 1:179025918-179025940 GGCGAGAGGTGGCCTGGGAATGG + Exonic
917922797 1:179765095-179765117 GGGAAGAGGTGGACGAGGAAGGG - Intronic
917965864 1:180178184-180178206 GTGGGGAGGGGGACTGGGAAGGG - Intronic
918095433 1:181330301-181330323 GGGGGGAGGTGGCCATGGCAGGG - Intergenic
918931104 1:190858397-190858419 GGGGTGAGGGGTCCTGGGACTGG - Intergenic
919748915 1:201024628-201024650 GGAGGGAGATGGACTGGGAAGGG - Intergenic
919842846 1:201622147-201622169 GGGGGGAGGTGGGTAGGGAATGG + Intergenic
919990031 1:202703255-202703277 GGGGAGCGGTGGCCGGGGGTGGG - Intronic
920034683 1:203058297-203058319 GGAAAGGGGTGGTCTGGGAACGG + Intronic
920035291 1:203061289-203061311 GAGGAGAGTTGGGCTGGGGAGGG + Intronic
920456657 1:206106832-206106854 GGGGTGAGGTTGCTGGGGAAAGG - Intergenic
920467614 1:206202510-206202532 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
920514051 1:206571397-206571419 GGAGAGAGTTGGCCTGGGATGGG + Intronic
922125039 1:222713224-222713246 CGGGAGAGGTGGCCAGACAACGG - Intronic
922226485 1:223650195-223650217 GGGCAGAGGTGGCCTTGGAGAGG + Intronic
922249739 1:223837812-223837834 GGGTGGAGGTGGCATGGGAAGGG - Intronic
922402784 1:225277112-225277134 GGGGGGAGGGGGACGGGGAAGGG + Intronic
922617838 1:226973648-226973670 GAGGACAGGGGGCCTGGGGAGGG - Intronic
922777665 1:228223949-228223971 GGGGAGAAGTGGCCGGGGGATGG + Intronic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
923079974 1:230643919-230643941 GGGGAGAGGTGCCCTGGAAGAGG + Intronic
923144388 1:231187690-231187712 TGGGAGAGGCGGGGTGGGAAAGG + Intronic
923228705 1:231963514-231963536 GGTGAGGGGTGGGCTGGGAGAGG - Intronic
923738319 1:236633040-236633062 GGGGAGGGGAGGCCAGGGGAGGG - Intergenic
1062824443 10:557736-557758 GGGGAGAGGATGGGTGGGAAGGG + Intronic
1062947872 10:1474697-1474719 GGGGAGAGAATGCGTGGGAATGG + Intronic
1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG + Intergenic
1063376626 10:5558111-5558133 GGAAGGAGGTGGCCGGGGAAGGG + Intergenic
1063400329 10:5737536-5737558 GGGCAGAGGTTGCCTGGGGGAGG - Intronic
1063464932 10:6236918-6236940 GGGGAGAGGAGGGCTGGGGCCGG + Intergenic
1063482139 10:6385315-6385337 GGAGGGAGGTGGGCAGGGAAGGG - Intergenic
1063517647 10:6712310-6712332 GGGGAAAGGGGTGCTGGGAAGGG + Intergenic
1063720367 10:8574426-8574448 GGGGAGAGATGACCTGGGTACGG + Intergenic
1063954600 10:11254878-11254900 GGGGAGAGATGGGATGGAAAGGG - Intronic
1064594195 10:16926745-16926767 GGGGGGTGGTGGCATGGAAAAGG + Intronic
1065008659 10:21402511-21402533 GTTCAGCGGTGGCCTGGGAATGG - Intergenic
1065022087 10:21509518-21509540 GGGGAATGATGGCCTGGAAACGG - Intergenic
1065814294 10:29470437-29470459 GTGGAGAGGTGCCCGTGGAAGGG - Exonic
1066447060 10:35492939-35492961 GGGGAGAGCTGGCCTGAGGGTGG - Intronic
1067095780 10:43298703-43298725 GGGCAGGGGTGTCCTGGGACAGG - Intergenic
1067172824 10:43922098-43922120 GGGCAGGGGTGCCCTGGCAAAGG + Intergenic
1067753474 10:48986647-48986669 CGGGACAGATGGCCTGTGAAGGG + Intergenic
1067902350 10:50255326-50255348 AGGGAGAAATGGCCAGGGAAAGG + Intergenic
1068213162 10:53948806-53948828 AGGGAGAGTTGGACTGTGAAGGG - Intronic
1068669153 10:59707267-59707289 GGGGAGAGGAGGGAAGGGAAGGG + Intronic
1068918154 10:62455227-62455249 GGAGAGAGCTGGACAGGGAAGGG + Intronic
1068971449 10:62962565-62962587 GGGGACAGATGGCCTTGCAAGGG - Intergenic
1069065545 10:63938413-63938435 AGGGAGAGGTGGCTCTGGAAAGG + Intergenic
1069381772 10:67849265-67849287 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1069570191 10:69490051-69490073 AGAGAGAGGAGGCCTGGGATGGG - Intronic
1069706175 10:70460182-70460204 GGGGAGGGGAGGCCTGGGGCAGG - Intergenic
1069824150 10:71245103-71245125 GGGGAGAGGAGGTCAGAGAAGGG - Intronic
1070227295 10:74522955-74522977 GGGGAAGGGTGGGCAGGGAAGGG - Intronic
1070479623 10:76869535-76869557 GGTGAGAGGTGAGCTGGGGATGG - Intergenic
1070757940 10:79005118-79005140 GTGGAGATGTGTCCTGAGAAAGG + Intergenic
1070804741 10:79264441-79264463 GGGGAGAGGTGCCCTGAGAAGGG - Intronic
1070825487 10:79388096-79388118 GGGGACAGGTGGCCTGCCCAAGG - Intronic
1071253541 10:83845210-83845232 GGGGTGGGGGGGCCAGGGAAGGG - Intergenic
1071402682 10:85291281-85291303 GGTAGGAGGTGGGCTGGGAAAGG + Intergenic
1071520523 10:86329268-86329290 GGGGAGAGGCAGCCTGGCCAAGG - Intronic
1072211324 10:93249200-93249222 GGAGAGAGGTGGGGCGGGAACGG + Intergenic
1072359536 10:94646407-94646429 TGGGAGAGGGAGCTTGGGAAGGG + Intergenic
1072749919 10:97970545-97970567 GGGGAGAGCTGGCCTGAGGCAGG - Intronic
1073147369 10:101289673-101289695 GGGGAGTAGTGGCCTCTGAAGGG - Intergenic
1073249873 10:102114821-102114843 GGGGCCCGGTGGCCTGGGGAGGG - Intronic
1073372096 10:102999645-102999667 GCGGAGAGGTGGGGGGGGAAGGG - Intronic
1074135788 10:110625549-110625571 GGTGACAGGTGGCCTGGAATGGG - Intergenic
1074198321 10:111208557-111208579 GTGGAGAGGTGCCATGGAAAAGG - Intergenic
1074392712 10:113071528-113071550 GGAGAGAGGTGGCGGGGGGACGG - Intronic
1074610787 10:115019237-115019259 GGGTGGAGGTGGACTGGGGAGGG - Intergenic
1075031800 10:119029308-119029330 GGGGAGAGAAGGGCCGGGAAGGG - Intergenic
1075070436 10:119316662-119316684 AGGGAGAGGTGCCCAGGGCAAGG + Intronic
1075080783 10:119382159-119382181 GGAGGGAGCTGGCCTGGGCAGGG - Intronic
1075310140 10:121407010-121407032 GGGTAGAGGTGGCGTGGGAAGGG - Intergenic
1075325185 10:121525982-121526004 GGAGAGAGGTGGCTTTGAAATGG - Intronic
1075362870 10:121855142-121855164 GCAGAGAGGGGGCCTGGGAGAGG - Intronic
1075382189 10:122028766-122028788 GGGGAGCGGAGGCAAGGGAAGGG - Intronic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1075796779 10:125126107-125126129 GTGCAGCGGTGGCCTGGGAGAGG + Intronic
1075852225 10:125598504-125598526 GGGGAGAGGTGGCCTTGTCAAGG - Intronic
1076433807 10:130425929-130425951 GGGGAGAGGGCACCTGGGGAGGG + Intergenic
1076481350 10:130786947-130786969 GGAGGGAGGTGGGCAGGGAAGGG + Intergenic
1076542425 10:131222792-131222814 AGAGAGCGGTGGCTTGGGAAGGG - Intronic
1076542640 10:131223922-131223944 GTGGGGATGTGGCCTGGGGAGGG - Intronic
1076595613 10:131623100-131623122 GGGGAGAGGTGGATGGGGAGAGG + Intergenic
1076595618 10:131623114-131623136 GGGGAGAGGTGGATGGGGAGAGG + Intergenic
1076595628 10:131623139-131623161 GGGGAGAGGTGGATGGGGAGAGG + Intergenic
1076595633 10:131623153-131623175 GGGGAGAGGTGGATGGGGAGAGG + Intergenic
1076828312 10:132981553-132981575 GGGGACAGGTGGGCAGGGCATGG - Intergenic
1076869341 10:133185851-133185873 GGGGAGAGGTGGGAGGGGAGGGG + Intronic
1077080609 11:723017-723039 GGGTGGAGGTGGGCTGGGGAGGG - Intronic
1077106320 11:844050-844072 GGGGGGAGGGGGTCAGGGAAGGG - Intronic
1077182912 11:1224471-1224493 GGGGAGGGGTTGCCTGGGTTGGG + Intronic
1077185653 11:1234322-1234344 AGGGAGGGGTGGGCAGGGAAGGG + Intronic
1077215480 11:1393653-1393675 GTGGAGAGGGGTCCTGGGATGGG + Intronic
1077239438 11:1502881-1502903 GGGAAGAGGCGACCAGGGAAGGG + Intergenic
1077264314 11:1641612-1641634 GGGTGGAGGTGGTCTGGGAGTGG - Intergenic
1077274861 11:1699927-1699949 GGTGAGACGGGGCCTGGGATAGG - Intergenic
1077307016 11:1873036-1873058 GGGGAGAGGTGCACAGGGAGGGG - Intronic
1077387650 11:2278448-2278470 GGGGTGAGGTGGGATTGGAACGG - Intergenic
1077392285 11:2305593-2305615 GGGGCAAGGTGGGGTGGGAAAGG - Intronic
1077451685 11:2652107-2652129 GCTGGGAGGTGGCCTGGGAAGGG + Intronic
1077520776 11:3032561-3032583 GGGCAGAGGTGGGCTGGGTGAGG + Intronic
1077556947 11:3230475-3230497 GGGGAGAGGTGGCCCGGGGCGGG + Intronic
1078352689 11:10607606-10607628 GGGGCGGGGAGGCCTGGGAGGGG + Intronic
1078670648 11:13362047-13362069 AGAGAGAAGGGGCCTGGGAATGG + Intronic
1079253466 11:18805658-18805680 GGGGAAAGGAGGACAGGGAAGGG + Intergenic
1079319040 11:19435212-19435234 TGGGAAAGGTGGACAGGGAAAGG - Intronic
1079861748 11:25681151-25681173 GGGGAGAGCAGGGGTGGGAAGGG + Intergenic
1080201720 11:29679114-29679136 GGGTACAGATGCCCTGGGAATGG - Intergenic
1080431102 11:32200676-32200698 GGTGCCAGGTGGGCTGGGAAGGG + Intergenic
1080785017 11:35467233-35467255 GTGGGAAGCTGGCCTGGGAAGGG - Intronic
1081484417 11:43516560-43516582 GGGAAGAGGTGTCCTAAGAAAGG - Intergenic
1081536771 11:44002293-44002315 GGGGCGAGGTGGCATCTGAAGGG - Intergenic
1081782343 11:45721924-45721946 GGGGAAAGGTGGCCGGGAATGGG - Intergenic
1081794573 11:45810746-45810768 GGGGAGAGGAGGAGTGGGGAAGG - Intronic
1081966320 11:47172252-47172274 GGGGAGAGGTGGTATGGTAGAGG - Intronic
1082080120 11:48006319-48006341 CGAGAGAGGTGGAGTGGGAAAGG + Intronic
1082106010 11:48222626-48222648 GGGGCAAGGTGGACTGGGAATGG - Intergenic
1083077241 11:60053710-60053732 GGGTAGTGGGGGCCTGGGAGGGG + Intergenic
1083202482 11:61129012-61129034 GAGGTGAGGTGGCCAGGGAGAGG + Intergenic
1083234620 11:61343666-61343688 GGAGAGAGGGTCCCTGGGAAAGG - Intronic
1083298569 11:61728304-61728326 GTGGAGAGGTGACCTGGAGAAGG - Intronic
1083687946 11:64388581-64388603 GTGCAGAGGTGCCCTGGGAGGGG + Intergenic
1083713703 11:64564008-64564030 GGGCACAGGTGGCCTGGGCATGG - Intronic
1083789209 11:64973162-64973184 GGGGAGTGGGGGCCTGGGCGCGG + Intergenic
1083859610 11:65412811-65412833 GGAAAGAAGAGGCCTGGGAAGGG + Exonic
1083899830 11:65638230-65638252 GGGGAGAGGTGGCCTAGCCGTGG + Intronic
1084371932 11:68750744-68750766 GGGGAGGGGCGGCCAGGAAAGGG + Intronic
1084372038 11:68751007-68751029 GGGGAGGGGCGGCCGGGGAGGGG + Intronic
1084372058 11:68751049-68751071 GGGGAGGGGCGGCCAGGGGAGGG + Intronic
1084712540 11:70852904-70852926 GGGGAGGGGTTGCCTTGGCAAGG + Intronic
1084928675 11:72535923-72535945 GGGGAGGGGAGGGGTGGGAAGGG + Intergenic
1084934005 11:72577343-72577365 TGTGGGAGGTGGCCTGGGCAGGG + Exonic
1084953829 11:72680947-72680969 GGGGTGGGCTGTCCTGGGAATGG + Intergenic
1085038977 11:73315883-73315905 GGGGAGAGGGGGCTGGGGACAGG - Intronic
1085273456 11:75283713-75283735 GGGGAGAGGTGGGAGGGGGAAGG - Intronic
1085402606 11:76243597-76243619 GGGAAGAGGTGCCCAGGGACGGG + Intergenic
1085454140 11:76656263-76656285 GGGGAGAGGCAGTCAGGGAAGGG + Intergenic
1085460509 11:76690282-76690304 GGGAAGAGGTGGCCTTGGGTGGG + Intergenic
1085645403 11:78219203-78219225 GGGGAGAGGGGAGATGGGAAGGG + Exonic
1085887329 11:80535916-80535938 GGTCAGGGGTGGCATGGGAAAGG + Intergenic
1087793300 11:102430039-102430061 TGGGAGAGGTGGCATGGGGAAGG - Intronic
1088452040 11:109992659-109992681 AGGAAGAGGTGGCCTAGGAGGGG - Intergenic
1089307887 11:117538120-117538142 AGGGTGTGGTGGTCTGGGAATGG + Intronic
1089326999 11:117664107-117664129 TGGGAGAGGAGGCCAGGGGAGGG + Intronic
1089587749 11:119520837-119520859 GGGGAAAGGGGGCCTGGGGAGGG + Intergenic
1089780416 11:120869740-120869762 AGGAAGAGGGGGCCTGGGGAGGG + Intronic
1089853254 11:121518262-121518284 GGGGAGAAGTGCCCTGGGGAGGG + Intronic
1090269216 11:125374211-125374233 TGGGTGAGGTGGCCTGAGAATGG + Intronic
1090440919 11:126725095-126725117 GGTGAGAGGTGGCCAGGAGAAGG + Intronic
1091041242 11:132283945-132283967 GAGGAGAGGAGGCCAGGAAAAGG - Intronic
1091198285 11:133750314-133750336 CAGGAGAGGTGTCCAGGGAAAGG + Intergenic
1091211418 11:133864442-133864464 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1091303305 11:134521625-134521647 GGGAAGGGGTGGCCAGGGAGAGG - Intergenic
1091652547 12:2320678-2320700 GAGAAGAGGTGGCCTTGGAGGGG - Intronic
1092077451 12:5685442-5685464 GGGCAGAGGTGGCATGGTGAGGG - Intronic
1092092122 12:5812100-5812122 GGGGAGGCGAGGCCAGGGAAGGG + Intronic
1092119364 12:6033396-6033418 TGGGAAAGCTGGCCTGGGCAGGG + Intronic
1093256416 12:16873551-16873573 GGGGAGTGGGGGCCTGGGGAGGG - Intergenic
1094108850 12:26839728-26839750 GGGGAAAGGTGGCTGGGGATAGG - Intergenic
1094161859 12:27399097-27399119 GGGCATCTGTGGCCTGGGAAGGG + Intronic
1094172421 12:27507662-27507684 TGGGAGAGGTGGGATGGGGATGG - Intergenic
1095662511 12:44753918-44753940 AGGGAAATGTGGCCTAGGAAGGG - Intronic
1096116216 12:49057007-49057029 TGGGAAAGATGGCTTGGGAATGG - Intronic
1097019200 12:56007826-56007848 GGGGAGACGTGGGCGGGGGAAGG + Intronic
1097195909 12:57242458-57242480 GGGAAGAGGAGGCCTGGGACGGG - Intergenic
1100117058 12:91319665-91319687 GGGAGGAGGTGGTCAGGGAAAGG + Intergenic
1100141233 12:91621335-91621357 GGGAAGAGCTGGCATGGGATGGG - Intergenic
1100292924 12:93234753-93234775 GGTGACAGCTGGCTTGGGAAAGG + Intergenic
1100455199 12:94744977-94744999 GGTGAGAGGTGGCCTGGAGCCGG + Intergenic
1100670754 12:96810043-96810065 GGAGAGAGGAGGCAAGGGAAAGG + Intronic
1100861029 12:98807326-98807348 GGGGGGAGGTGAGCTGGGAGAGG - Intronic
1100959308 12:99944933-99944955 GGGGAGAGGTAGCCAGGTGAAGG + Intronic
1101157370 12:101940544-101940566 GGGGAGAGGAGGGAAGGGAAAGG + Intronic
1101285516 12:103307836-103307858 GGGGAGAGGGGTGCTGTGAAAGG + Intronic
1102054782 12:109888211-109888233 GGGGAGAGGTGGGAAGGAAAAGG + Intergenic
1102108606 12:110347021-110347043 GGGGAGAGGTGGGGTGGGGTGGG - Exonic
1102300229 12:111766356-111766378 GGAGAGAGGCGGCCAGGGCAAGG - Intronic
1103407561 12:120686839-120686861 TGGGAAAGGTGGCCTGGGGGGGG - Intergenic
1103608228 12:122104294-122104316 AAGGAGAGGATGCCTGGGAAGGG - Intronic
1103800480 12:123534112-123534134 GGGGAGGGGCGGCCGGGGCACGG - Intergenic
1104674858 12:130705476-130705498 GGGGAGAGGCTGGCAGGGAAGGG + Intronic
1104684426 12:130775633-130775655 GGGGATAGGTGGGCCGGGTAGGG - Intergenic
1104811032 12:131620599-131620621 GGGGGAAGGCGGCCTGGAAATGG + Intergenic
1104897675 12:132172324-132172346 GGTGGGAGGTGGACTGGGATGGG - Intergenic
1104991449 12:132625957-132625979 GGTGTGGGGAGGCCTGGGAAGGG + Intronic
1105330748 13:19412886-19412908 GGTGAGAGGTGGCCAGGGGCAGG - Intergenic
1105437714 13:20391564-20391586 GGCGAGGGGTGGGCAGGGAAGGG + Intergenic
1105918825 13:24941660-24941682 GGTGAGAGGTGGCCAGGGGCAGG - Intergenic
1106231649 13:27825599-27825621 GAGGAGAGGTGGCCTGAGGCTGG - Intergenic
1106444125 13:29809236-29809258 GGGGAGAGGGAGCTTGAGAAAGG + Intronic
1106547931 13:30746359-30746381 GGGGAGAGATAGCCATGGAAAGG + Intronic
1106551171 13:30772353-30772375 GGGGAGAGGAGTCAGGGGAAAGG + Intergenic
1106759920 13:32858301-32858323 GGGGAGAGGTGGCAAGACAAGGG + Intergenic
1107066029 13:36214820-36214842 CGTGAGAGCTGCCCTGGGAAGGG - Intronic
1107212069 13:37869815-37869837 GGGGAGGGGCGGCCCGGGAGGGG + Exonic
1107482350 13:40795190-40795212 GGTGAGAGGCGGCCTGGGGCAGG - Intronic
1107853495 13:44592389-44592411 GCGGAGAGGAGGCCCTGGAAAGG - Intergenic
1108408095 13:50124610-50124632 GGGGAGAGGGGGCGGGGGAGAGG - Intronic
1109062502 13:57634910-57634932 TGGGGGAGGTGGCCAGGGAGGGG - Exonic
1110113338 13:71779782-71779804 GAGTAGAGGTGGCCAGGGATGGG - Intronic
1110472506 13:75876045-75876067 GGGGTGTGGTGGGCTGGGAATGG - Intronic
1110860667 13:80341746-80341768 GGGGAGAGGTAGACTTGAAATGG - Intergenic
1111450633 13:88410274-88410296 TGGGAGAGTGGGCCTGAGAAAGG - Intergenic
1112082108 13:95983020-95983042 AAGGAGAAGTGGCCTGGGTATGG - Intronic
1112435405 13:99388451-99388473 GGAGAGAGGAGGGCTGGGGATGG + Intergenic
1113092176 13:106627708-106627730 GGTGAGCGTTGGCCTGAGAAAGG + Intergenic
1113285797 13:108847810-108847832 GGGGAGGGATGGGATGGGAAAGG - Intronic
1113655617 13:112066707-112066729 GGGGGGAGGAGGCCCGGGAGGGG - Intergenic
1113670169 13:112170801-112170823 GGTGAGAGGAGGCCTTGGGAGGG + Intergenic
1113851561 13:113421214-113421236 GGGTAGAGGTGTCCTGGGGGTGG - Intergenic
1113851618 13:113421348-113421370 GGGTAGAGGTGTCCCGGGAGTGG - Intergenic
1114318385 14:21526526-21526548 GGGGGGAGCTGGCCAGGGACCGG - Intronic
1114402914 14:22426426-22426448 GGGGAGAGGAGGCAGGGGGAAGG - Intergenic
1114599401 14:23942206-23942228 GGGAAGGGGTGGTATGGGAAGGG - Intergenic
1114629660 14:24150915-24150937 GGGCTGAGCTGGTCTGGGAAAGG + Intronic
1114636196 14:24188329-24188351 CGGGAGAGGTGGGCTGGGCCTGG - Exonic
1115724182 14:36194721-36194743 GGGGAGAGGGGGAGGGGGAAGGG + Intergenic
1115975811 14:38995769-38995791 AGGGAGAGCTTGCCTGAGAAGGG - Intergenic
1116128803 14:40826176-40826198 GGGGGGTGGAGGCCTGGGAGAGG + Intergenic
1116994586 14:51309180-51309202 GGGGAAATGTGGGATGGGAAGGG + Intergenic
1117060602 14:51958646-51958668 GGGGAGAGGAGGCCATGGAGTGG - Intronic
1117463308 14:55968146-55968168 TGGGAGTTGTGGCCTGGGTAGGG + Intergenic
1118722672 14:68605556-68605578 GGCTAGAGGAGGCCTGGGACAGG - Intronic
1118740625 14:68737022-68737044 GTGGAGTGGTGGCCTGGCACAGG - Intergenic
1119426917 14:74541707-74541729 GGGTAGAGGTTTCCTAGGAAGGG - Intronic
1119573331 14:75695791-75695813 GGGGAGGGGAGGGCAGGGAAGGG - Intronic
1119921561 14:78451087-78451109 GGGAAGAGGTGGCCAGAGACAGG - Intronic
1120736971 14:88064288-88064310 GGGGAGAGGTGGGTGGAGAACGG + Intergenic
1120984226 14:90319497-90319519 GGGGTGAGGTGGGCGGGGCAGGG - Intronic
1121114427 14:91333688-91333710 GGGGCAAGATGGCCTGGGAGAGG + Intronic
1121124227 14:91395675-91395697 GGGGGCTGGTGGCCTGGGGAGGG - Intronic
1121156430 14:91689270-91689292 GGGGAGTAGAGGACTGGGAAGGG - Intronic
1121337982 14:93088924-93088946 GGGGAGAGCGGGCCTGGGTGGGG - Intronic
1121339938 14:93099220-93099242 GGGGAGTGTTGGTCTGGGGAGGG - Intronic
1121405198 14:93715597-93715619 AGGGAGAGGTGAGCTGGGCAAGG + Intergenic
1121464884 14:94109330-94109352 GGGGAGGGGAGGGCAGGGAAGGG + Intronic
1121485441 14:94310914-94310936 GGGAAATGGTGGCCTGGCAAGGG - Intronic
1121547108 14:94770377-94770399 GGGGAGAGGTGCCAAGGGGAGGG + Intergenic
1121780799 14:96620948-96620970 GGGGAGAAGTGGAATGGGCATGG - Intergenic
1121818339 14:96945091-96945113 GGGCAGTGGTGGGCTGGGCAAGG - Intergenic
1121853412 14:97244750-97244772 GAAGAGAGGTGACGTGGGAATGG + Intergenic
1122007765 14:98719276-98719298 GGGGAGAGGAGGCCAGGGAAGGG + Intergenic
1122041870 14:98993584-98993606 AGGGAGAGGTGGGAGGGGAAGGG - Intergenic
1122042290 14:98997448-98997470 GGGCACAGGTGGCATGGAAATGG + Intergenic
1122473319 14:101987197-101987219 TGGGAGAGGTGGCCTCTGATGGG - Intronic
1122798112 14:104216503-104216525 AGGGTGAGGTGACCTGGGAAAGG - Intergenic
1122847211 14:104506486-104506508 GGGGTGAGGTCGCCAGGGAGGGG - Intronic
1122898375 14:104771686-104771708 GGGGAGGGGCAGGCTGGGAACGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123114742 14:105889626-105889648 GTGCAGAGTTGGCCTGGGAGGGG + Intergenic
1202851470 14_GL000225v1_random:23099-23121 GGGGAGTGGTGGTGTGGGAGGGG - Intergenic
1123582008 15:21724192-21724214 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123618655 15:22166788-22166810 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123987177 15:25656255-25656277 GGGGAGAGGGGGCTTGAGGAAGG + Intergenic
1124722458 15:32121806-32121828 GGGGAGAGATCACCTTGGAAGGG + Intronic
1124963943 15:34419394-34419416 GGGGAGAGGGGGCCTGGAGACGG - Intronic
1124980557 15:34565625-34565647 GGGGAGAGGGGGCCTGGAGACGG - Intronic
1125505124 15:40263465-40263487 GGGAACTGGGGGCCTGGGAAGGG - Intronic
1126053896 15:44711766-44711788 GCGGCGGGGTGGCCTGGGAGTGG + Intronic
1128104425 15:65032856-65032878 TGGGAGAGCTGATCTGGGAATGG + Intergenic
1128153620 15:65378098-65378120 GGGGAGAGGGGGCTGGGGGAGGG - Intergenic
1128601205 15:68996919-68996941 GGGGAGGAGTGGACTGGAAAAGG + Intronic
1128616422 15:69114100-69114122 GGTGAGGGGTGGCCTTTGAAGGG - Intergenic
1128705293 15:69833884-69833906 AGGGAGAGGTGGGCTTGGCATGG - Intergenic
1128743840 15:70100288-70100310 GAGGAGGGGTGGCCTGTGAAAGG + Intergenic
1129467990 15:75734524-75734546 AGGCAGAGGTGGCCTGGGCGTGG - Intergenic
1129709141 15:77811406-77811428 GGGGAGAGGTGGTCTGGAGCTGG - Intronic
1129890966 15:79071728-79071750 GGGGAGGGAAGACCTGGGAAGGG - Intronic
1130085790 15:80777840-80777862 GGGGAGAGGGGCCCTGGGTCGGG + Intergenic
1130398009 15:83521454-83521476 GGGGAGGGGAGAGCTGGGAATGG + Intronic
1130459655 15:84151644-84151666 AGGCAGAGGTGGCCTGGGCCTGG - Intergenic
1130553837 15:84909234-84909256 TGGCAGAGGTGGCCTGTGAGGGG - Intronic
1131108901 15:89751895-89751917 GGCTAGAGGTGGCCTGGGGTTGG - Intergenic
1131171090 15:90178774-90178796 GTAGAGAGGTGGCCAGAGAAAGG + Intronic
1131346746 15:91656452-91656474 GGGGAGAGGAGGGAAGGGAAGGG - Intergenic
1131356145 15:91748982-91749004 GGGGAGGGGTGGTGTGGCAATGG + Intergenic
1131837709 15:96407978-96408000 GGGGCGAGATGCCCTGAGAAGGG + Intergenic
1132046502 15:98567131-98567153 GGGGAGAGATGGCCTATGCATGG + Intergenic
1132157080 15:99503140-99503162 GGGGGGAGGAGGGGTGGGAAGGG + Intergenic
1132341163 15:101079292-101079314 GGGGAGAGGGGGTGAGGGAAAGG + Intergenic
1132393984 15:101459072-101459094 GAGGAGAGGTGGCCTGGAGAGGG - Intronic
1132665048 16:1077823-1077845 GGAGAAGGGTGGGCTGGGAATGG - Intergenic
1132725603 16:1337012-1337034 GGGCAGAGGTGGCCTGGCTCTGG + Intronic
1133283882 16:4681684-4681706 GGGGACAGCTGGCCTGGGACAGG - Exonic
1133768786 16:8855714-8855736 GTTGAGGGGTGGCCTGGGCAGGG + Intronic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1133968142 16:10546599-10546621 GGGCAGAGGTCACCTGGGATGGG + Intronic
1134488547 16:14678359-14678381 GGAGAGAGGTGGCTTGGGCAGGG - Intronic
1134599019 16:15518826-15518848 GGGGAGAGGCGGACAGGGGAAGG + Intronic
1135119191 16:19750894-19750916 AGGAAGAGGTGGACTGGGACTGG + Intronic
1135479771 16:22813420-22813442 GGGGAGAGGTGGGGTGACAATGG + Intergenic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136414710 16:30096127-30096149 GGGGTGGGCTGGCCTGGGAGTGG + Exonic
1136573239 16:31108943-31108965 GGGGAGAGGTCGCCCGGGTCTGG + Intronic
1136609017 16:31355151-31355173 GCAGAGAGGTGGCCAGGGGAAGG - Intronic
1137238964 16:46638633-46638655 TGGGTGATGTGCCCTGGGAAAGG + Intergenic
1137253451 16:46757031-46757053 GCGGGGAGGTGGCCTGGGCTGGG - Intronic
1137256442 16:46778755-46778777 GTGGAGAGGAGGCCCTGGAAAGG - Intronic
1137615233 16:49842296-49842318 GGGGAGGGGAGGCGAGGGAAGGG + Intronic
1137617015 16:49854696-49854718 GGGGAGAGGAGGCCAGGGGAGGG + Intronic
1137665791 16:50248216-50248238 AGGGAGAGGTGGGCGGGGCAAGG - Intronic
1137676389 16:50305734-50305756 GGTGAGATGGGGGCTGGGAAGGG - Intronic
1137691308 16:50429984-50430006 GGGCAGAGGTGGCCTGAGATGGG + Intergenic
1137720564 16:50625274-50625296 GGGGAGGTTTGGCCTGGGGAGGG - Intronic
1137773830 16:51039811-51039833 CAGGAGAAGTGGCCTGGAAAAGG - Intergenic
1138252125 16:55509372-55509394 GGGGAGAGGTGGTCTGAGGGGGG + Intronic
1138351332 16:56347752-56347774 GGGGAGGGGTGGGGAGGGAAGGG - Exonic
1138410719 16:56837770-56837792 GGGCATAGGTGGCCTGGCACTGG - Intronic
1138423689 16:56916404-56916426 AGGAAGTGGTGGGCTGGGAAGGG - Intergenic
1138423880 16:56917495-56917517 AGGAAGTGGTGGGCTGGGAAGGG - Intergenic
1138496846 16:57414012-57414034 GGGGACAGGTGGCCAGGGGCAGG + Intronic
1138532998 16:57645361-57645383 GGGGGGTGGTGGGGTGGGAAGGG - Intronic
1138540498 16:57684680-57684702 TGAGAGAGGGGGCCTGAGAAAGG + Intronic
1139290325 16:65852470-65852492 GGGGAGAGGAGAACTGGGTATGG - Intergenic
1139327658 16:66164672-66164694 AGGGAGAACTGGCCTGGCAAAGG + Intergenic
1139328372 16:66169060-66169082 GGGGAGAGGATGCCTGGCAGAGG - Intergenic
1139341048 16:66268010-66268032 GGGGAAAGGAGGACAGGGAATGG + Intergenic
1139505499 16:67396323-67396345 GGGGAAAGCAGGCCCGGGAAGGG + Intronic
1139754555 16:69132300-69132322 GGGGAGGGGTGGCCGGGAAGGGG - Intronic
1139845083 16:69915111-69915133 CGGGACAGGTGGCCTGGCAGTGG - Intronic
1139949015 16:70660287-70660309 TGGGAGAGGACCCCTGGGAAGGG + Exonic
1140026737 16:71297656-71297678 GGGGAGAGGAAGGCAGGGAAGGG - Intergenic
1140135139 16:72199127-72199149 GGGGAGAGGTGACCTTGGGTTGG - Intergenic
1140193569 16:72838316-72838338 GGCAAGAGGCAGCCTGGGAAGGG + Intronic
1140859445 16:79006254-79006276 GAGGAGACCTGTCCTGGGAATGG + Intronic
1141298964 16:82795497-82795519 TGGGACAGGTGGCCAGGGCATGG - Intronic
1141497505 16:84420134-84420156 GAGAAGAGGTGGCTGGGGAAAGG - Intronic
1141589161 16:85056297-85056319 GTTGAGAGGGGGCCTCGGAAAGG - Intronic
1141676885 16:85522385-85522407 GGGGAGGGATGGGCTGGGGAGGG - Intergenic
1141876655 16:86829492-86829514 GGTGAGAGATGGCCTTGGATAGG + Intergenic
1141947769 16:87322415-87322437 GCTGAGATGTGGCCTGGGGAGGG - Intronic
1141968583 16:87464177-87464199 GGGGAGAGGAGGGCTGAGCAGGG + Intronic
1142088283 16:88196287-88196309 GGAGAGAGGTGGCCTGGGTCAGG + Intergenic
1142271050 16:89089414-89089436 GAGGAGAGGTGCCCTGGGGAGGG - Intronic
1142288653 16:89182262-89182284 GGGGAGGGGAGGCTTGGGGAGGG - Intronic
1142328525 16:89434510-89434532 GGGCTCAGGTGGCCTGGGCAGGG - Intronic
1142367281 16:89657126-89657148 GGGGGTCGGGGGCCTGGGAAGGG + Intronic
1142494120 17:297220-297242 TGGGAGAGGTGCCCTGGGTGGGG - Intronic
1142666196 17:1465260-1465282 GAGGAGAGGTGTCCTGGCCAGGG + Exonic
1142683139 17:1562083-1562105 AGGGAGAGCTGGCCCGGGACTGG - Intronic
1143129946 17:4671868-4671890 AGGGAGAGGTGGAGAGGGAAGGG - Exonic
1143190187 17:5034811-5034833 AGGGAGAGGTGGCCGGGGGCGGG + Intronic
1143273577 17:5693557-5693579 GGAGAGAGGTGGGAGGGGAAGGG + Intergenic
1143514207 17:7411312-7411334 GAGGAGAGGAAGCCTGGGTAAGG + Intronic
1144052438 17:11508569-11508591 GGGGAGAGGTGGGAAAGGAAGGG - Intronic
1144649512 17:16998298-16998320 GGGGTGGGGTGGCATGGGGATGG + Intergenic
1144891328 17:18495946-18495968 GGGAGGAGGTGGCTTGGGGAAGG + Intergenic
1145042006 17:19583918-19583940 GGGGTGAGTTGGCATGGGATAGG + Intergenic
1145140895 17:20448371-20448393 GGGAGGAGGTGGCTTGGGGAAGG - Intergenic
1145257111 17:21331801-21331823 TGGGAGGGGTGGGGTGGGAATGG - Intergenic
1145272034 17:21409940-21409962 GGGGAGGTTTGGCCTGGAAAGGG + Intronic
1145319526 17:21756237-21756259 TGGGAGGGGTGGGGTGGGAATGG + Intergenic
1145794923 17:27649909-27649931 GGGAGGAGGTGGCTTGGGGAGGG + Intergenic
1145809417 17:27755627-27755649 GGGAGGAGGTGGCTTGGGGAGGG + Intergenic
1146291776 17:31612924-31612946 GGAGAGAGGTGGCAGGAGAAAGG - Intergenic
1146948443 17:36889954-36889976 GGGAAGAAGAGGCCTGGGACAGG - Intergenic
1147235156 17:39051592-39051614 GGAGAGAGGTAGGCTGTGAAAGG + Intergenic
1147359173 17:39920610-39920632 AGGGAGAGGTGACTGGGGAAAGG + Intergenic
1147421039 17:40322283-40322305 GGGAAGAGGTGGCAGGGGAGAGG + Intronic
1147421044 17:40322297-40322319 GGGGAGAGGTGGCAGGGGCTAGG + Intronic
1147426334 17:40347600-40347622 GGGGAGAGATGGCATGACAAAGG - Intronic
1147439336 17:40437862-40437884 GGGCAGAGGTGGCATTGGTAGGG - Intergenic
1147582670 17:41636076-41636098 GGGAGGATGGGGCCTGGGAAGGG - Intergenic
1147880074 17:43647725-43647747 GAGGAGAGGTGGCCAGGGATGGG - Intronic
1147881402 17:43656411-43656433 GCGGGGAGGTGGCCTGTAAAGGG + Intronic
1148074370 17:44927066-44927088 GGGCACAGGTGCCCTGGGGAGGG + Exonic
1148129374 17:45253957-45253979 GGGAAGAGCTGGCATGGGGAAGG - Intergenic
1148503811 17:48111787-48111809 GGGGAGAGGTGGCCTAGTTGAGG + Intronic
1148545908 17:48518921-48518943 GAGGATAGGTGGGCTGGGATGGG - Intergenic
1148557546 17:48587469-48587491 GGGGAGACTAGCCCTGGGAAGGG + Intronic
1148809123 17:50279138-50279160 GGGGAGTGGTGGCCAGGGCCAGG + Intronic
1148821428 17:50361955-50361977 GGGGAGAGGAGGCTTGGGAAAGG - Intronic
1148944547 17:51248529-51248551 GGGGAGAGATTGAGTGGGAAAGG - Intronic
1149993998 17:61397386-61397408 GGGGAGGGGGTTCCTGGGAAGGG + Intergenic
1149995903 17:61405795-61405817 TGGGAGAGGTGGAACGGGAAGGG - Exonic
1150483831 17:65530770-65530792 TGGGAGAAGAGGCCTGGAAATGG - Intronic
1150785695 17:68161395-68161417 GGAGAGAGGTAGGCTGTGAAAGG - Intergenic
1151391049 17:73786792-73786814 GGGTAGGGGTGGGGTGGGAATGG + Intergenic
1151518537 17:74612825-74612847 GGGGAGAGGTGGGGAGAGAAGGG - Intronic
1151547271 17:74800814-74800836 CAGGAAAGGTGGCCTGGGGAGGG + Intronic
1151684573 17:75639240-75639262 GGGGACAGGTGGCCAGGGGCTGG - Exonic
1151706491 17:75771552-75771574 GCGGGGAGGTGGCATGGTAATGG + Intergenic
1152368216 17:79869630-79869652 GGGGTGGGGTGGTCTGGGAGAGG - Intergenic
1152410537 17:80120502-80120524 GAGGAGAGGTGACATGGGAAGGG - Intergenic
1152426946 17:80223170-80223192 GGGGAGATGTGAGCTGGGGAAGG - Intronic
1152438096 17:80288374-80288396 CGGGAGAGATGGCCTGGGAGTGG + Intronic
1152460806 17:80441426-80441448 TGGGAGAGATGGCCTGGGCTGGG - Intergenic
1152628734 17:81400109-81400131 GGGGGAGGGTGGCCAGGGAAGGG - Intronic
1152636563 17:81432769-81432791 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152636588 17:81432818-81432840 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152783489 17:82236618-82236640 GGGGAGGGGTGGTGTGGGAAGGG + Intronic
1152799571 17:82324507-82324529 GAGGGGAGGGGGCCTGGGCAGGG - Intronic
1153342935 18:3994103-3994125 TGGGGAAGGTGGCCTAGGAAAGG - Intronic
1153637410 18:7124911-7124933 GGGGAGACGTGAGCTAGGAAAGG + Intergenic
1153687179 18:7557982-7558004 GGGGAGAATGGGACTGGGAATGG - Intergenic
1153768140 18:8394242-8394264 GGGCTGAGGTGAGCTGGGAAAGG + Intronic
1153795617 18:8619218-8619240 GAGGAGAAGTGACCTGGGCATGG + Intronic
1154065473 18:11103004-11103026 GGGGAGGGGTGCACTAGGAATGG + Intronic
1154354669 18:13616066-13616088 GGGGAGGAGTGGGCTGGAAAGGG - Intronic
1154437449 18:14357729-14357751 GGGGAGACGAGACCTGGGCATGG - Intergenic
1154960588 18:21304775-21304797 GAGGAGAGGGGGAATGGGAATGG + Intronic
1154993142 18:21615099-21615121 AGCCAGAGGTTGCCTGGGAAAGG - Intronic
1155064266 18:22255108-22255130 AGGGAGAGGCAGTCTGGGAAGGG - Intergenic
1155343549 18:24836908-24836930 GGGGAAAGGGAGCCTAGGAAGGG + Intergenic
1156744508 18:40372498-40372520 AGGGAGAGCTGGCCCAGGAAAGG - Intergenic
1156863287 18:41862991-41863013 GGGGAGAGGAGGTGAGGGAATGG + Intergenic
1157081735 18:44533014-44533036 GTAGGAAGGTGGCCTGGGAAGGG + Intergenic
1158058683 18:53312894-53312916 GGGGAGAGGAGGGAAGGGAAAGG + Intronic
1158111636 18:53946464-53946486 GGGAAGAGGTGGGAGGGGAAAGG + Intergenic
1158165358 18:54533677-54533699 AAGGAGAGGTGGCTAGGGAATGG + Intergenic
1158389171 18:57029901-57029923 CTGGAGAGCTGGCTTGGGAAAGG + Exonic
1158408373 18:57180625-57180647 TGGGAAAGGTAGCCTGGGAGAGG - Intergenic
1158431744 18:57394753-57394775 GGGGAGTGGGGGGCTAGGAAAGG - Intergenic
1158451135 18:57566492-57566514 GGAGAGAGATGGCCTAGAAAGGG - Exonic
1158949050 18:62475006-62475028 TGGGAGCGAAGGCCTGGGAAGGG + Intergenic
1159883684 18:73884155-73884177 GGGCACAGGTGCCGTGGGAAAGG + Intergenic
1160001210 18:75025585-75025607 GGGGAGAGGTGGTGGGGAAAAGG - Intronic
1160072781 18:75643057-75643079 GGGGAGAGGTGGCCTCAGAAAGG + Intergenic
1160542162 18:79629809-79629831 GGGGACGGGAGGCGTGGGAAGGG + Intergenic
1160550823 18:79692929-79692951 GGGGAGCAGTGCCCAGGGAAAGG + Intronic
1161663238 19:5560021-5560043 GGGGAGAGGTGGAGGGGGATAGG + Intergenic
1161776327 19:6264232-6264254 GGGGAGGGGTGGAGGGGGAATGG - Intronic
1162057249 19:8072006-8072028 AGGCAGGGGTGGCCAGGGAATGG - Intronic
1162246687 19:9407125-9407147 GGGGGGAGGTGACCTGGAATGGG + Intergenic
1162367223 19:10256855-10256877 GGGGTGGGGGGGCCAGGGAAGGG + Intronic
1162413181 19:10518540-10518562 GAGGAGCAGTGGCCTGGGAGAGG - Intergenic
1162422375 19:10573126-10573148 GGGGAGAGGGGGGCCGGGCACGG + Intronic
1162783250 19:13018282-13018304 CAGGAGCGGTGGCCTGGGATCGG - Intronic
1162876812 19:13626660-13626682 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
1162877087 19:13628347-13628369 GGGGAGAGGAGGAGAGGGAAGGG + Intergenic
1162898100 19:13777546-13777568 GGGCAGAGGCAGTCTGGGAAAGG + Intronic
1162899333 19:13785292-13785314 GGGGAGAGGTGAAGGGGGAATGG - Intergenic
1162914934 19:13869529-13869551 TGGGGGAGGTGGCCTGCGGAGGG + Intronic
1163182500 19:15614577-15614599 GGACAGAGGGGGCCTGTGAAGGG - Intergenic
1163365934 19:16876228-16876250 GGTGAGAGGAGGCCTGGGGCTGG + Exonic
1163547672 19:17949299-17949321 GGGGCGATGTGGCCTTGGCAGGG - Intergenic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1164719766 19:30423797-30423819 GGGGAACGGGGGCCTGGGAGCGG + Intronic
1164986444 19:32652046-32652068 GGGGAGGAGTTGCCTGGGATAGG + Intronic
1165095227 19:33406554-33406576 GGGGAGAGCTGGGCTGGGACAGG + Intronic
1165113606 19:33515752-33515774 TGGGAGAGGTGGGCTGGGCTGGG - Intronic
1165171071 19:33891968-33891990 GGGTAGAGATGGCCTAGGTAGGG - Intergenic
1165320925 19:35084697-35084719 GCAGAGAGGTGCCCTGGGAGTGG + Intergenic
1165412468 19:35670504-35670526 GGGGAGAGGAGGCGAGGGGAGGG - Intronic
1165459909 19:35938185-35938207 TGGGAGAGATGGCCAGAGAAAGG - Intronic
1165807171 19:38587513-38587535 GGGGAGAGGTGACCTAGTACTGG + Intronic
1165863537 19:38922008-38922030 AGAGAAAGCTGGCCTGGGAATGG + Exonic
1165945040 19:39436758-39436780 GGGGCGGGGTGTTCTGGGAAAGG - Intronic
1165955370 19:39499054-39499076 GGTGGGAGGTGGCGTGGAAAGGG + Intronic
1166558783 19:43718663-43718685 GGTGAGAGGCGGCCTGGGGGAGG - Exonic
1166690359 19:44818731-44818753 GGGGAGTGGAGTCCTGGGAAGGG - Exonic
1166711754 19:44942179-44942201 GCGGGGAGGTGGCCGGGGGAGGG + Intergenic
1166766200 19:45252980-45253002 GGGCAGGGGGCGCCTGGGAATGG - Intronic
1166862819 19:45819580-45819602 TGAGAGGGGTGGCCTGGGACTGG - Intronic
1167075045 19:47243350-47243372 GGGGCGAGGGGGCCGGGGAGGGG - Intergenic
1167211400 19:48136130-48136152 GGAGAGAGCAGGCCAGGGAAGGG + Intronic
1167591526 19:50406884-50406906 AGGGTGAGGTAGCCTGGGGAGGG - Intronic
1167722901 19:51190980-51191002 GGGCCGAGGTGGCCTGGGAAAGG - Intergenic
1167742048 19:51329623-51329645 GGGGAGTGGTGGCAAGGGTAGGG - Exonic
1167772840 19:51531547-51531569 GGGGAGAGGTGCCGTGGGGCTGG - Intronic
1168357869 19:55713644-55713666 GGGGAGAGGTGGGGAGGGAGAGG - Intronic
1168357878 19:55713665-55713687 GGGGAGAGGTGGGGAGGGAGAGG - Intronic
1168705939 19:58470361-58470383 GGGGAGTGGGTGCCTGAGAAGGG + Intronic
925296124 2:2778808-2778830 GGGGTGAGGTGGGCAGGGAGGGG - Intergenic
925813415 2:7723749-7723771 CAGGAGAGTTTGCCTGGGAATGG + Intergenic
925872777 2:8285344-8285366 GGGGAGAGGTGGGCGTGGAAGGG - Intergenic
925881077 2:8353029-8353051 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
925881086 2:8353049-8353071 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
925881103 2:8353089-8353111 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
926210979 2:10869083-10869105 TGGGAGAGGTGCCCTGAGAGAGG + Intergenic
926212036 2:10878460-10878482 GGGGAGGTGTGGCCTGAGAGGGG + Intergenic
926440363 2:12882691-12882713 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
926541265 2:14183225-14183247 GGCCACGGGTGGCCTGGGAAAGG - Intergenic
927240939 2:20919130-20919152 TGGGTGAGATGGCCTGGGAGGGG - Intergenic
927471917 2:23384026-23384048 GGGAGGAGCTGGCCTGGGGAGGG - Intergenic
927675935 2:25106216-25106238 GGGGAAAGGGGGCCTAGGAGAGG + Intronic
927702573 2:25277328-25277350 GGGAAGCCCTGGCCTGGGAACGG - Intronic
927707151 2:25303488-25303510 CTGGAGAGGTGGCCTGGCACCGG - Intronic
927723657 2:25404356-25404378 GGGCAGAAGAGGCTTGGGAAGGG + Intronic
928166623 2:28977017-28977039 GGGGGGGCGTGGCCTGTGAAGGG + Intronic
928685265 2:33743145-33743167 TGGTAGTGGTGGCCTGGTAATGG + Intergenic
929537311 2:42791892-42791914 TGGCAGAGGTGGCCTAGGGAGGG + Intronic
929564802 2:42977568-42977590 GGGGAGTGGTGGGCGGGGAGAGG + Intergenic
929601375 2:43206739-43206761 GGGGAGAGGTGCCCTGAGGCTGG - Intergenic
929602470 2:43212983-43213005 GAGGAGTGGTGGCCTGGAAGAGG + Intergenic
929936337 2:46297072-46297094 GGGGAGAGGCAGCCTGCGCAGGG - Intronic
931191325 2:60003074-60003096 GACGAGAGGAGGCATGGGAAGGG + Intergenic
932430522 2:71671416-71671438 AGGGAGAGGGGGCCTGGGAGTGG + Intronic
933770562 2:85741556-85741578 GCTGGGAGGTGGCATGGGAAAGG - Intergenic
934488388 2:94738530-94738552 GGGGAGAAGAGACCTGGGCATGG + Intergenic
934555828 2:95286659-95286681 GGGGAGAGGAGGGGAGGGAAGGG - Intronic
934773323 2:96921671-96921693 GGGCAGGGGTGGCCAGGGCATGG + Intronic
934775565 2:96934976-96934998 AAGGAGAGGTGCCCTGGGGATGG - Intronic
934780842 2:96968694-96968716 GGGCTGAGGGGGCCTGGGACGGG - Intronic
935656097 2:105424870-105424892 AGGGAGTGGGGGCCTGGGAGAGG + Intronic
935918822 2:107986955-107986977 GGGTAGAGGGGGCCGAGGAAAGG + Intronic
936103103 2:109600753-109600775 GAGCAGAGGTGGAGTGGGAATGG - Intronic
936117035 2:109710770-109710792 GGTGAGAGGAGACCTGGGGAAGG + Intergenic
936447481 2:112607287-112607309 GGGAAGGGGAGGCCAGGGAAGGG - Intergenic
937064376 2:119006244-119006266 GGGGTGGGGTGAGCTGGGAAGGG - Intergenic
937953867 2:127408359-127408381 GGGGAGCGGTGGCCTCGCAGAGG + Intergenic
937987302 2:127643858-127643880 GGGGCTGGGGGGCCTGGGAAGGG - Intronic
938120878 2:128632264-128632286 TGAGAGAGCAGGCCTGGGAAGGG - Intergenic
938247622 2:129791310-129791332 GACCAGAGGTGGACTGGGAAGGG - Intergenic
938580092 2:132637924-132637946 GGAGAGGTGTGGGCTGGGAATGG + Intronic
938957702 2:136314601-136314623 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957711 2:136314621-136314643 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957720 2:136314641-136314663 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957729 2:136314661-136314683 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957738 2:136314681-136314703 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
938957759 2:136314726-136314748 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
939136236 2:138297961-138297983 GTGGAGATGTGTCTTGGGAATGG - Intergenic
940193433 2:151066683-151066705 GGGGAGTGGGGGCCTAGGAGAGG - Intergenic
940849074 2:158671376-158671398 GGGGTGGGGAGGGCTGGGAAGGG + Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941350364 2:164425366-164425388 GGGGGTAGGAGGCCTGGGCAGGG - Intergenic
942377957 2:175356220-175356242 TGGGAGAGGAGGCATGGGATTGG + Intergenic
942511292 2:176704868-176704890 GGGGAGGGGTAGTCAGGGAAAGG + Intergenic
943512931 2:188848601-188848623 TAGGGGAGGTGGACTGGGAAAGG + Intergenic
944333648 2:198502690-198502712 GGGGAGAAGGGGCAAGGGAAAGG - Intronic
944494622 2:200294483-200294505 GGGGAGAGGTGGAACTGGAAAGG - Intergenic
944584017 2:201157833-201157855 GTGGTGAGGTGGAGTGGGAAGGG - Intronic
944586711 2:201179234-201179256 GTGGAGAGGAGGCCCTGGAAAGG - Intergenic
944933414 2:204544058-204544080 GAAGAGAGCTGGCCTGAGAATGG + Intergenic
944933712 2:204545786-204545808 GGGGAGGGGCGGCCGCGGAAAGG - Intronic
945185553 2:207136110-207136132 GGGAAGGGGTGGTGTGGGAAAGG - Intronic
946187829 2:217991129-217991151 GGGGAGAGGTAGGCAGGGACAGG + Intronic
946194220 2:218023497-218023519 GGAGACAGGTGGGCCGGGAATGG - Intergenic
946326390 2:218986604-218986626 GGGTGGAGGAGGCCTGGGAATGG + Intergenic
946446909 2:219747911-219747933 GGGGAGGGGAGGGCAGGGAAAGG - Intergenic
946622432 2:221573549-221573571 GAGGAGGGGCGGCCTGGGAAGGG - Intronic
946855272 2:223944765-223944787 GGGGCGAGGTGGGCTGGGAGGGG + Intronic
947179299 2:227397920-227397942 GGGGAGAGGTGGAAGGGGATGGG + Intergenic
947669612 2:231927878-231927900 GGGAAGGGGTAGCCTGAGAAAGG - Intergenic
947700357 2:232229301-232229323 GGGTACAGGTGGGTTGGGAATGG - Intronic
947985001 2:234440256-234440278 GTGAGGAGGTGGCCAGGGAACGG + Intergenic
948248473 2:236506194-236506216 GGGAAGAGGAGACCTGGCAAAGG - Intronic
948491265 2:238314844-238314866 GCGGGGAGGTGGCCAGGGAGTGG - Intergenic
948840827 2:240648074-240648096 GGGCAGAGGTGGCCAGAGAGGGG + Intergenic
1168745063 20:232363-232385 GGGGAAAGGTGACCTTTGAATGG - Intergenic
1168797905 20:623845-623867 GGGAGGAGGTGGCCTGTGAGTGG - Intergenic
1168957511 20:1844690-1844712 GGAGAGTGGTGGGCTTGGAATGG + Intergenic
1169723383 20:8702996-8703018 GGGGAGAGGTGGACAGAGAGAGG + Intronic
1170306476 20:14944231-14944253 AGGGAGAGGAGGGCTGGGGAAGG + Intronic
1170427425 20:16248807-16248829 AGGGAGAAGTGGGCAGGGAAGGG - Intergenic
1170632979 20:18080977-18080999 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1171085747 20:22236648-22236670 GGGGAGAGGTAGGCTAGGAGAGG - Intergenic
1171300920 20:24059610-24059632 GGGGAGTGGTGGGAAGGGAAAGG + Intergenic
1172646612 20:36474281-36474303 GGGGAAAGGTGGCCTGGGTTAGG + Intronic
1172693848 20:36808451-36808473 GGGGAGAGAGGGACAGGGAAGGG - Intronic
1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG + Intergenic
1172803557 20:37595440-37595462 GGGGGGATGTGGAATGGGAAGGG - Intergenic
1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG + Intergenic
1173201945 20:40960951-40960973 GAGGAGCGGGGGCCAGGGAAGGG + Intergenic
1173315305 20:41937929-41937951 GGGGAAAGGTGGTCTGCGATAGG - Intergenic
1173427843 20:42958288-42958310 GGGGAGAGGAGGGGAGGGAAGGG + Intronic
1174050249 20:47762696-47762718 GGGTACAGGGGGGCTGGGAAGGG + Intronic
1174366960 20:50062299-50062321 GGTGAGAGGAGGCCTATGAAGGG - Intergenic
1174543583 20:51308417-51308439 GGGGCGGGGTGGCGAGGGAAGGG - Intergenic
1175084192 20:56445208-56445230 AGGGAGAGGTGGAGTGGGAAAGG - Intronic
1175488161 20:59360346-59360368 GGGGGGAGTTGGCGAGGGAAAGG - Intergenic
1175739136 20:61408341-61408363 GGGGTGGTGTTGCCTGGGAATGG + Intronic
1175787918 20:61723648-61723670 AGGGAGAGGTTTCCTGGGCAGGG + Intronic
1175863050 20:62160293-62160315 GGGGAGAGGTGGGGTGGGGTGGG + Intronic
1175908837 20:62395034-62395056 GGGGAGACGGGGCCGGGGAGCGG + Intronic
1176839604 21:13827910-13827932 GGGGAGACGAGACCTGGGCATGG + Intergenic
1177667605 21:24181398-24181420 GGGGGGTGGTGGGCTGGGTAGGG - Intergenic
1177890669 21:26800336-26800358 GGAGAAGGGTGGCCTGGAAAGGG - Intergenic
1178129463 21:29555206-29555228 GAGAAGTGGTGGCGTGGGAATGG - Exonic
1179163675 21:38918289-38918311 GGGGTGGGGTGGCCAGGGCAGGG + Intergenic
1179357354 21:40673086-40673108 GATGGGAGGTGGCCAGGGAAGGG - Intronic
1179954747 21:44732344-44732366 GGGGAAAGGAGCACTGGGAATGG + Intergenic
1180037516 21:45257410-45257432 GTGGAGATGAGGCCCGGGAATGG - Intergenic
1180095303 21:45553658-45553680 GGGGTGTGGGGGACTGGGAAGGG - Intergenic
1180095516 21:45554103-45554125 GGGGTGTGGGGGACTGGGAAGGG - Intergenic
1180095651 21:45554384-45554406 GGGGCGTGGGGGACTGGGAAGGG - Intergenic
1180104390 21:45608379-45608401 GGGGAACCGTTGCCTGGGAAGGG - Intergenic
1180635535 22:17260273-17260295 GGGGAAATGTGGTCTGGGCATGG - Intergenic
1180820110 22:18821343-18821365 AGAGAGAGGTGGCGTGGGAGGGG - Intergenic
1180920705 22:19520137-19520159 GGGCACAGGTGGCCTGGGCTAGG + Intronic
1181206333 22:21255815-21255837 AGAGAGAGGTGGCGTGGGAGGGG - Intergenic
1181437264 22:22918102-22918124 GGGGGGGGGTGGCCTGGGTCGGG + Intergenic
1181513964 22:23401189-23401211 GGGGAGAGGTCCCCAGGGATGGG + Intergenic
1181541099 22:23573781-23573803 TGGGAAAGGTGACTTGGGAAGGG - Intronic
1181550998 22:23639138-23639160 TGGGAAAGGTGACTTGGGAAGGG - Intergenic
1181583650 22:23841537-23841559 AGGGAGACGTGGCCCGGGAAGGG + Intergenic
1181619153 22:24076334-24076356 GGTGGGAGGTGGAATGGGAAGGG + Intronic
1181698370 22:24606610-24606632 GGGGAGGAATAGCCTGGGAAAGG + Intronic
1181797282 22:25319549-25319571 TGGGAAAGGTGACTTGGGAAGGG + Intergenic
1181859354 22:25806155-25806177 AGGGAGAGGTTGCCCTGGAATGG + Intronic
1182423085 22:30257925-30257947 AGGGAGTGGTGGCCTGGGAGGGG - Intergenic
1182462123 22:30490529-30490551 GGGAGCAGGCGGCCTGGGAACGG + Intronic
1182471848 22:30553744-30553766 TGTGGGAGGTGGCCTGGGATAGG + Intergenic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182483173 22:30622826-30622848 GTGGCCAGGTGGCCTGGGAAGGG + Intronic
1182592126 22:31389503-31389525 GGGGAGGGGAGGCAAGGGAAGGG - Intergenic
1183078501 22:35441649-35441671 GGGCAGAGGAGGACTGGGCAAGG + Intergenic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183259103 22:36782752-36782774 GGGGAGGGCTGTTCTGGGAAGGG - Intergenic
1183284390 22:36953111-36953133 GGGCAGAGGTGCCCTGGGTTGGG + Intergenic
1183346677 22:37311995-37312017 GTGGGGAGGTGGCCAGGCAAGGG - Intronic
1183513236 22:38248138-38248160 GGGGAGAGGCTGGCTGGGACAGG - Intronic
1183578383 22:38706569-38706591 GGGGCGAGGGGGCCCGGGCAGGG + Intronic
1183647479 22:39134840-39134862 GGGTAGACATGGCATGGGAAGGG - Intronic
1183739028 22:39659909-39659931 AGGGAGAGGTGGCCTGGATGGGG + Intronic
1184072625 22:42155274-42155296 GGCGAGAGGTGGCCTGGCATGGG + Intergenic
1184210870 22:43034921-43034943 GGGGAGGGGAGGGGTGGGAAGGG + Intergenic
1184918806 22:47591176-47591198 GGGCAGAGGGGGCCTCGGAGGGG + Intergenic
1185236249 22:49715089-49715111 GGGCAGTGGTTGCCTGGGGAGGG + Intergenic
1185409404 22:50674344-50674366 GGGGGGAGGGGGCCTGAGACGGG - Intergenic
1203220587 22_KI270731v1_random:39608-39630 AGAGAGAGGTGGCGTGGGAGGGG + Intergenic
1203270237 22_KI270734v1_random:47214-47236 AGAGAGAGGTGGCGTGGGAGGGG - Intergenic
949709789 3:6860892-6860914 GGGGGGAGGTTTCCTCGGAATGG - Intronic
950098953 3:10345765-10345787 GGGGAGAGGGGGCCAGGGTGAGG - Intronic
950118283 3:10465108-10465130 GGGGAGAGGAGGCTTGGGGCTGG - Intronic
950352932 3:12374773-12374795 GGGGACAGGAGGCTGGGGAAGGG + Intronic
950813603 3:15674444-15674466 GGGGAGAGTAGGTCTGGCAAGGG + Intronic
950912032 3:16605028-16605050 TGGGAGAGGCGGCCTGGCAGTGG - Intronic
951809146 3:26680218-26680240 GTGGAGAGGTGGTATTGGAAAGG - Intronic
952338721 3:32427437-32427459 CGGGAGAGGTGCCCTCGGTATGG + Intronic
952584363 3:34873120-34873142 GGAGAGAGATGGCCTGGAAAGGG + Intergenic
953478805 3:43230937-43230959 TGGGAGAGGTTGCAGGGGAAGGG + Intergenic
953863036 3:46561552-46561574 GGGGAGAGGTTGGCAGGGGAAGG + Intronic
953878715 3:46680722-46680744 GGAGGGAGGCAGCCTGGGAAGGG + Intronic
953960623 3:47263337-47263359 GGACACAGGTGGCCTGGGGAAGG - Intronic
954130655 3:48559080-48559102 GAGGACAGCTGGCCTGGGCAGGG + Intronic
954159479 3:48710565-48710587 GGGCAGGTGAGGCCTGGGAAAGG - Intronic
954535744 3:51358162-51358184 GGAGAGAGGGAGCCTGGGCAGGG + Intronic
954592448 3:51794463-51794485 GGGGAGTGGTGGCGGGGGAGGGG - Intergenic
954608769 3:51933358-51933380 GGTGGGAGGCGGCCTGGGGAGGG - Intergenic
954796163 3:53162139-53162161 GCGGAGGGGTGGGGTGGGAAGGG - Intronic
954948379 3:54446799-54446821 AGGGAGGGGAGGCCAGGGAAGGG - Intronic
954964529 3:54598584-54598606 TGGGAGAGATGTCCTGGGAAAGG - Intronic
955883245 3:63570213-63570235 CGGGTGAGGGGGCCAGGGAAAGG + Intronic
955930723 3:64054201-64054223 GGAGAGAGGTGCCAGGGGAAAGG + Intergenic
955931107 3:64057833-64057855 GGAGAGAGGTGCCAGGGGAAAGG - Intergenic
956890369 3:73607396-73607418 GGGAGGAGGTGTCCTGGGGAGGG - Intronic
960197401 3:114786284-114786306 GGGGAGTGGGGGTCTGGGGAAGG - Intronic
961033809 3:123628615-123628637 AGGGAGAGCTGCCCAGGGAAAGG - Intronic
961036645 3:123647137-123647159 GGGCAGAGGTGGCTGGGGTAGGG + Intronic
961039632 3:123668512-123668534 GGGGAGGGGTGGGCTGCAAAGGG + Intronic
961186671 3:124920901-124920923 GGGCAGAGGTGACATGGCAAAGG + Intronic
961372626 3:126440800-126440822 GGGCAGAGGTGGGCTGGGAAGGG - Intronic
961662881 3:128479725-128479747 GGGGTGTGGTGGCCTGTGAGGGG - Exonic
961666828 3:128497922-128497944 GGGGAGGGGCGGCCGGGGAGTGG - Intergenic
961676292 3:128568970-128568992 GGGCAGGGGCGGCCTGGGAATGG + Intergenic
961678115 3:128580490-128580512 GGGGACAGGCTGCCTGAGAATGG + Intergenic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962748350 3:138414316-138414338 GGGGAGAGGTGGCAGGGCAGGGG - Intergenic
962901961 3:139769214-139769236 GGGGAGAGGGGGCAAGGGGAGGG + Intergenic
963084750 3:141426518-141426540 GAGGAGAGGAGGCCGGGGGAGGG + Intronic
963354055 3:144188103-144188125 GGGCAGATGTGGCTTTGGAAGGG + Intergenic
964011135 3:151893221-151893243 GGGGAGAGTGGGCCTGGAAACGG - Intergenic
965547558 3:169931719-169931741 TGAGAGAGGTGGCCAGGGAATGG + Intronic
966339326 3:178907556-178907578 GGGGTGAGGTTGACAGGGAAAGG + Intergenic
966402648 3:179563177-179563199 GGGGAGGGGAGGGCTGGGAGCGG - Intronic
967179252 3:186888955-186888977 AGGCAGAGGTGGCCAGGGAAGGG - Intergenic
967184092 3:186930676-186930698 GGGGAGGGGAGTCCTGGGCAGGG + Exonic
967191902 3:186991876-186991898 GAGGGGAGGTGGCTGGGGAAAGG - Intronic
967217396 3:187222073-187222095 GGGGAGAGGAAGCCAGGGCAGGG + Intronic
967253239 3:187564423-187564445 GGGGAGAGCTGGGCAGGGTAAGG + Intergenic
967812822 3:193774865-193774887 CGGGAGAGGAGGCATGAGAATGG + Intergenic
968129110 3:196182097-196182119 AGGGAGAGGAAGCCTGGGAGGGG - Intergenic
968310804 3:197681752-197681774 AGGGAGAGGTGGCGTGTCAAAGG - Intronic
968548424 4:1210339-1210361 TGAGGGAGGTGGCCTGGGCAGGG - Intergenic
968599706 4:1503205-1503227 GGGGAGAGCTGGCCTGCCCACGG + Intergenic
968606589 4:1538353-1538375 GGGGAGAGGTGGGAGGGGAGGGG + Intergenic
968611372 4:1558653-1558675 GGGGAGAGGAGGGAAGGGAAAGG + Intergenic
968659100 4:1791921-1791943 GGGGAACGGTGTCCTGGGAGCGG + Intergenic
968882695 4:3309542-3309564 GAGGAGCTGGGGCCTGGGAATGG + Intronic
968882855 4:3310124-3310146 GAGGAGCTGGGGCCTGGGAATGG + Intronic
968886582 4:3337673-3337695 CGGGAGAGGGGGCCTGGGGGAGG + Intronic
968901779 4:3435505-3435527 GGGGAGAGGGGGCTTTGGAGAGG - Intronic
968914567 4:3491806-3491828 GGGGAGAGGTGGTGGTGGAAGGG + Intronic
968938165 4:3624404-3624426 GGGGAGGGGCAGCCTGGGAGGGG + Intergenic
968938184 4:3624457-3624479 GGGGAGGGGCAGCCTGGGAGGGG + Intergenic
969183735 4:5460617-5460639 AGGGAGAGGTGGGATGGGAGGGG + Intronic
969293416 4:6254936-6254958 GGTGTGTGGTGGCCCGGGAAAGG + Intergenic
969690696 4:8702532-8702554 GGAAAGAGGTGGCCAGGGACTGG + Intergenic
969978998 4:11135035-11135057 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
970011526 4:11464846-11464868 GGGGACTGGTGGCCTGGAGAAGG - Intergenic
970420139 4:15898360-15898382 GGGGACAGATGTCTTGGGAAGGG - Intergenic
970772909 4:19637994-19638016 GGGGAGGGGAGGCGAGGGAAGGG - Intergenic
971309818 4:25515494-25515516 GGGGAGGGGTGGCCAGGGTTGGG - Intergenic
971330063 4:25674647-25674669 GGGGACAGGGGCCCTGGGAGTGG + Intronic
971771262 4:30899773-30899795 GGGGTGAGGTGGGCTGGGAATGG + Intronic
972461408 4:39307025-39307047 GGTGAGAGGTGGCATGAGGATGG - Intronic
972579903 4:40385951-40385973 GGGGAGGGGAGGCCAGGGGAGGG + Intergenic
972633024 4:40857817-40857839 GGGGAGGGGTGGTTGGGGAAGGG + Intronic
973629864 4:52810366-52810388 GGGGAGGGGTGGCATGAGATGGG + Intergenic
973811168 4:54571613-54571635 GGAAAGAGGAGGCCTGGGAGAGG + Intergenic
975132342 4:70842030-70842052 TGGGAGAGGGGGTGTGGGAAGGG + Intergenic
975185467 4:71397133-71397155 GGGGAGAGGAGGTCTGGGCCTGG + Intronic
975556733 4:75672990-75673012 GGTGGGAGGCCGCCTGGGAAGGG - Intronic
975651560 4:76598588-76598610 GGGTAGAGGTGGCCAGGAAGTGG + Intronic
975811107 4:78170878-78170900 GGAGGGAGGTGGCCTGAGAAAGG - Intronic
976658087 4:87510597-87510619 GTGGAGAGGTGAGCTGGAAAGGG - Intronic
977216139 4:94286168-94286190 GGAGAGAGGTGGTATGAGAATGG + Intronic
978193668 4:105945651-105945673 GGGGAGAGATGGCTTGGGCCAGG - Intronic
978833360 4:113116494-113116516 GGGGTGAGCAGGTCTGGGAAGGG - Intronic
979468705 4:121071286-121071308 TGAGCGAGGTGGCCTGGGACCGG - Intronic
981018912 4:140004735-140004757 AGGGAGAGCGGGTCTGGGAAGGG - Intronic
981088630 4:140709722-140709744 GGGGTGGGGTGGTCTGGGGATGG + Intronic
981857052 4:149307295-149307317 GGGGAGAACATGCCTGGGAATGG + Intergenic
982075135 4:151731100-151731122 GGGGAGAGGGGGAGGGGGAAGGG - Intronic
982337885 4:154260195-154260217 GGGGAAAGGAGGCCCGGCAATGG - Intronic
982771587 4:159401719-159401741 GGGGAGTGGGGGGCTGGGCAGGG - Intergenic
982918654 4:161247419-161247441 GGGGAGAGGTGGATGGGAAAAGG - Intergenic
983026561 4:162744951-162744973 AGGAAGAGGTGGCTTGTGAAGGG - Intergenic
983172543 4:164552214-164552236 GGGGAGAGGTGACTTTGAAACGG - Intergenic
983173310 4:164559565-164559587 AGGAAGAGGGGGCCTGGGAGAGG - Intergenic
983875743 4:172872815-172872837 CGGGAGAGGTGGGGTGGGATAGG - Intronic
984261862 4:177452313-177452335 GGGGAGAGGAGGGGTGGGGAGGG - Intergenic
984402063 4:179279004-179279026 GAGGAGAGGAGGCAAGGGAAGGG - Intergenic
984507525 4:180638251-180638273 AGGGAGAGCTTGCCTGGGTAAGG + Intergenic
984714193 4:182911428-182911450 GGGGAGGGGTGGCCTGTGTCCGG - Intronic
985538025 5:475358-475380 GGGGAGACGTGGGCCGGGCAGGG - Intronic
985656193 5:1132635-1132657 GGGGAAAGCTGGCCCTGGAATGG - Intergenic
985784873 5:1888156-1888178 GGGGCGAGGTGGCGGGGGCAGGG - Intergenic
985872779 5:2570454-2570476 GTGGAGGTGGGGCCTGGGAAGGG - Intergenic
986190980 5:5495657-5495679 TGGGAGAGGTGCCCTGGGGCGGG - Intergenic
986191216 5:5497830-5497852 TGGGAGAGGTGCCCTGGGGCGGG - Intergenic
987091542 5:14512169-14512191 AGGGAGAGATTGACTGGGAAGGG - Intronic
987289520 5:16495464-16495486 GGGAAGAGGTGGCCTGGGCCTGG - Intronic
987683899 5:21171808-21171830 AGGGAGAGGAGGGCAGGGAAAGG + Intergenic
988055452 5:26088426-26088448 GGGGGGTGGGGGGCTGGGAAGGG + Intergenic
989623737 5:43410132-43410154 GAGGACAGGTGGCCTTGGCAAGG - Intronic
990207970 5:53450691-53450713 GGGAAGGGCTGGCCTGGGCAAGG - Intergenic
990310292 5:54531185-54531207 GGGAAGAGTTGGCTTTGGAAAGG + Intronic
990484575 5:56245318-56245340 GGTGAGAAGTGGTCTGGGATTGG - Intergenic
991522556 5:67516738-67516760 GGGATGAGGTGGTCTAGGAAGGG + Intergenic
991930649 5:71750173-71750195 GGGCAGTGGTGGCATGGGGAAGG + Intergenic
992088726 5:73299698-73299720 GGGGTGAGGAAGCCTGGGAGAGG - Intergenic
992153076 5:73925610-73925632 GGGGAGGGGTTGACTGGAAAGGG - Intronic
992579012 5:78151908-78151930 GGGGAGAGGAGGGATGGGGACGG - Intronic
992833767 5:80620459-80620481 GGGGAGAGTTTGCTTGGGGAAGG + Intergenic
993013345 5:82508687-82508709 GGGGAGAAGTGGCCTAGTAAGGG - Intergenic
993322752 5:86494305-86494327 GGGTGGAGGTGGCATGGGTAGGG - Intergenic
994040187 5:95250006-95250028 GGAGAGTGGGGGCCTGGGAGAGG + Intronic
994050752 5:95359489-95359511 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
995747552 5:115419335-115419357 AGGGAGAGGTGGACAGGGAAGGG + Intergenic
995994607 5:118283102-118283124 GGGGAGAGGTGGGGAGGGGATGG + Intergenic
996548616 5:124707196-124707218 GAGGATAGGTGGCCAGGGTAGGG + Intronic
996598294 5:125230505-125230527 GGGGAGGGAGGGACTGGGAAAGG - Intergenic
996693427 5:126366669-126366691 GGGGTCAGGTTGCCTGGAAAAGG - Intronic
996876351 5:128244391-128244413 AGGGAGAGGTTGACTAGGAAGGG - Intergenic
997413571 5:133708177-133708199 AGGGAGAGGTGGGGAGGGAAGGG + Intergenic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
997580260 5:135012528-135012550 GGGGAGGGGTGTTCTGGGACTGG + Intergenic
997647127 5:135489098-135489120 GGGGAGAGGACGGCTGGGCAAGG + Intergenic
998132888 5:139660088-139660110 GGGGAGAGGTGGTCTCTGCAGGG - Intronic
998498433 5:142611284-142611306 GGTGAGAGGAGTCCTGGGCACGG - Intronic
998681589 5:144473778-144473800 GGGGAGAGCTGGCCTCAGACTGG - Exonic
999278996 5:150352364-150352386 GTGGAGAAGTGGGCAGGGAATGG + Intergenic
999286080 5:150395099-150395121 TGGGGGAGGTGGACTGGGCAGGG - Intronic
999770280 5:154770449-154770471 CGGGAGAGGTAGCCTAGGCAGGG - Intronic
1000929621 5:167235630-167235652 AGGGAGAGCTGGTCTGAGAAAGG - Intergenic
1001026244 5:168226568-168226590 GGGGAGAGGTGGTGATGGAAGGG - Intronic
1001397281 5:171426429-171426451 GGGGAGGGCTGGCCTTAGAAGGG + Intronic
1001547990 5:172582379-172582401 TGGGAGAGGGAGCCTGGGGAAGG + Intergenic
1001622183 5:173096491-173096513 GGGGAGAGGAGGGCAGGGGAGGG - Intronic
1001963840 5:175896380-175896402 GGGGAGGGGAGGGCTGGGGAAGG - Intergenic
1002065173 5:176648123-176648145 AGGGAAAGGAGGCCGGGGAAGGG - Intronic
1002093795 5:176819132-176819154 GGGGAGGGCTGGCCAGGAAAGGG - Intronic
1002129063 5:177068458-177068480 GGAGAGAGCTTGCCTGAGAAAGG - Intronic
1002405074 5:179024049-179024071 GAGGGGGCGTGGCCTGGGAAGGG + Intronic
1002441186 5:179265324-179265346 GGGGAGAGGTGGCGGGGGAAGGG + Intronic
1002471719 5:179439500-179439522 GGAGTGGGGTGGCCTGGGCACGG - Intergenic
1002634388 5:180599942-180599964 GGGGTGGAGTGGCCTGGGAGTGG + Intergenic
1002697586 5:181100938-181100960 GGGGAGGGGTGGGCAGGGGAGGG - Intergenic
1002697614 5:181100988-181101010 GGGGAGGGGTGGCGAGGGGAGGG - Intergenic
1002697629 5:181101018-181101040 GGGGAGGGGTGGCGAGGGGAGGG - Intergenic
1002876796 6:1217811-1217833 GGGGAGAGGTGTCCAGGGAGAGG + Intergenic
1003114663 6:3275960-3275982 GGGCAAAGGTGACCTGGGCAGGG + Intronic
1004201741 6:13555065-13555087 GGGAAGAGCTGGGCTGGGGATGG + Intergenic
1005044520 6:21629183-21629205 GGGGAATGGTGGCAGGGGAATGG - Intergenic
1005583021 6:27251323-27251345 GGGAAGAGGAGGCCAGAGAAGGG + Intronic
1006320956 6:33319144-33319166 GGGGGAAGGTGGGCTGGGCAGGG + Exonic
1006339390 6:33438309-33438331 AGGGAAAGGTGACTTGGGAATGG + Intronic
1006340959 6:33446786-33446808 GGTGAGGGGCGGCCTGGGGAGGG + Exonic
1006405198 6:33841153-33841175 TGGGAGTGGGGGCCTGGGACTGG - Intergenic
1006436020 6:34026600-34026622 GGGGTGTGGAGGCCTGGGGAGGG - Intronic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1006747322 6:36352467-36352489 GGGGTGAGAGGGCCTGGGAAGGG - Intergenic
1007163321 6:39810575-39810597 GGGGAGAGGTGGGCTGGGGTGGG - Intronic
1007400484 6:41599877-41599899 GGGGAGAGGCGGGCAAGGAAGGG - Exonic
1007581349 6:42962085-42962107 GGGGAGAGGAGGCAGAGGAACGG + Intronic
1007725558 6:43913718-43913740 GTGGCCAGGTGGCCTGGGAAGGG + Intergenic
1007762849 6:44143699-44143721 GGGGAGGGGTGGACAGGGACCGG + Intronic
1007781927 6:44259324-44259346 GGGAAAAGGTGACTTGGGAAAGG + Intronic
1007946543 6:45832265-45832287 GGGGTGAGGGGTACTGGGAAGGG - Intergenic
1008080754 6:47192303-47192325 GAGGGGAGGTCGACTGGGAATGG + Intergenic
1008328599 6:50217868-50217890 GGGGAGATTTGGCCTGGGCAGGG + Intergenic
1009004172 6:57761747-57761769 GAGGAGAGGTTGCCACGGAATGG + Intergenic
1010220192 6:73442182-73442204 GGGCAGAGGTGGCCTTTGAAAGG - Intronic
1012337341 6:98077150-98077172 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1012498833 6:99865625-99865647 GGGGAGAGATGAAGTGGGAATGG + Intergenic
1012624982 6:101393806-101393828 GGGGTGAGGTGGGCGGGGAGGGG - Intergenic
1013479702 6:110543244-110543266 GGGGAGAGCTGGCATGAGCAGGG - Intergenic
1013792703 6:113855201-113855223 GGGGAGACGGGGGCTGGGAGTGG - Intergenic
1014497985 6:122150976-122150998 AGGAGGAGGTGGCCTGGCAAAGG - Intergenic
1015127437 6:129770422-129770444 GGTTAGAGGTGGGGTGGGAAAGG - Intergenic
1015256391 6:131183702-131183724 GGGGTGGGGTGGACTGGGACAGG + Intronic
1015351326 6:132223858-132223880 GGAGAGAGGTGGATGGGGAAAGG - Intergenic
1015605381 6:134950138-134950160 GGGAAGATGGGGGCTGGGAAGGG - Intergenic
1016232643 6:141825161-141825183 GGGGAGTTGTGGACTGGAAAAGG - Intergenic
1016940046 6:149475788-149475810 GTTGGGGGGTGGCCTGGGAAGGG + Intronic
1017716903 6:157219106-157219128 GGGGAGTGGGGGCCGGTGAATGG + Intergenic
1017977310 6:159369480-159369502 GGCCAGAGGTCTCCTGGGAAAGG + Intergenic
1018162167 6:161055700-161055722 GGGGTGATGGGGCTTGGGAATGG + Intronic
1018424846 6:163671172-163671194 GGGGCGGGGTGGGGTGGGAAAGG + Intergenic
1018457281 6:163963413-163963435 GGGGAGAGGTGGCTGGGGAACGG + Intergenic
1018465248 6:164038126-164038148 TGGGAGAGGTGGGCAGGGATGGG + Intergenic
1018706920 6:166470111-166470133 AGGCAGAGGTGGCCTGGGGTTGG + Intronic
1018732154 6:166659373-166659395 GGTGAGGGGTGGCCGGGGAGGGG + Intronic
1018783866 6:167092985-167093007 GGGGGGAGGTGGCCAGGCAGAGG + Intergenic
1018839533 6:167508110-167508132 GAGGAGAGGTGGCAGGGGAAGGG - Intergenic
1018839833 6:167508919-167508941 GAGGAGAGGTGACAGGGGAAGGG - Intergenic
1018890269 6:167977465-167977487 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890290 6:167977513-167977535 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890311 6:167977561-167977583 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890332 6:167977609-167977631 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890353 6:167977657-167977679 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890394 6:167977753-167977775 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890413 6:167977801-167977823 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018890434 6:167977849-167977871 GGGGAGAGGAGGCCCCGGATGGG - Intergenic
1018910861 6:168100352-168100374 GGGGAGAGGCGGCATGGGTCGGG + Intergenic
1019278357 7:187774-187796 GGGGAGACCTGGACTGGGCAAGG - Intergenic
1019520780 7:1459687-1459709 GGGGCCAGGAGGCGTGGGAACGG - Intergenic
1019665422 7:2249830-2249852 GGGCAGAGGTGGGCAGGGGAGGG - Intronic
1019701471 7:2476601-2476623 AGGGAGATATGGGCTGGGAAGGG - Intronic
1019703775 7:2487895-2487917 GGGGAGGGTGGGCCTGGAAATGG + Intergenic
1019727811 7:2612612-2612634 TGGGAGAGGTGAGCTGTGAATGG + Exonic
1019967695 7:4513538-4513560 GGGGAGGAATGGCCTGGAAATGG - Intergenic
1020170290 7:5839845-5839867 GGGGAAAGCTGACCTCGGAAGGG + Intergenic
1021072387 7:16256762-16256784 GGGGAGTGGGGGGCTGGGAGAGG + Intronic
1021904295 7:25317815-25317837 GGGGAAAGGTGGCCTAGAGATGG + Intergenic
1022194734 7:28053862-28053884 GGTGTGAGGTGGGGTGGGAAAGG - Intronic
1022958711 7:35404574-35404596 GGAGAGAGGTAGCATGGTAAAGG - Intergenic
1023062719 7:36343537-36343559 GGGGAGAGGAGGGGAGGGAAGGG + Intronic
1023273642 7:38494373-38494395 GGGGACAGGTGGACTGAGCAAGG + Intronic
1023466080 7:40456628-40456650 GGGGTGGGGTGGCCTGTGATGGG + Intronic
1023632823 7:42180553-42180575 GTGGAGTGATGGCCTGGAAAAGG + Intronic
1023864580 7:44232698-44232720 GGGGAGGGGCGGCCAGGGCATGG + Intronic
1024505677 7:50159301-50159323 GGAGAGAGGCGGGCTGGGCAGGG - Exonic
1025776913 7:64568543-64568565 GGGGAGTGGTGGCAGGGGTAAGG + Intergenic
1026468436 7:70674175-70674197 GGGGAGGGGGGCCCTGAGAAAGG + Intronic
1026846274 7:73700640-73700662 GGAGAGAGGTGGGATGGGGAGGG + Intronic
1026902803 7:74046371-74046393 GGGGGGAGCAGGCCTGGGATGGG - Intronic
1026990779 7:74584163-74584185 GGGGAAAGAGGGCCTGGGTACGG + Intronic
1028443695 7:90893915-90893937 AGAGAGTGGTGGCATGGGAATGG + Intronic
1028899088 7:96075849-96075871 GGGGAGAGGGGGCCTCTCAAGGG - Intronic
1029124039 7:98285262-98285284 GGGCAGAGGTGGGCTGTGGAGGG + Intronic
1029452241 7:100647559-100647581 GGGGTCAGGTGGGCTAGGAAAGG - Intronic
1029526094 7:101094822-101094844 GGGGGGAGGGGGGCAGGGAACGG + Intergenic
1029600357 7:101559680-101559702 GGGGTGAGGTGGCCTCTGAAGGG - Intergenic
1029629936 7:101743873-101743895 TGGGGGAGGTGGCCTGGGCCGGG - Intergenic
1029647724 7:101868834-101868856 TGGGAGCAGTGGCTTGGGAAGGG + Intronic
1030380022 7:108800886-108800908 GGGGAGAGGAGGGGAGGGAAGGG - Intergenic
1030731468 7:112994818-112994840 GGGGAGTGGTGGTGTGGGAATGG + Intergenic
1030963790 7:115962993-115963015 GGGGAGAGGGGGACTGGGGGAGG - Intronic
1031196472 7:118620893-118620915 GGGGAGTGGAGGGCTGGGGAGGG - Intergenic
1032541017 7:132703422-132703444 GGGCTGAGGTGGGCTGGGCATGG - Intronic
1032595752 7:133238203-133238225 GGGGAGAGGTGGATAGGGAAAGG - Intergenic
1032989803 7:137381275-137381297 GGGGGGGGGTGGGATGGGAAAGG - Intronic
1033089232 7:138369871-138369893 TGGGCAAGGTGGCCAGGGAATGG - Intergenic
1033141812 7:138834004-138834026 GCTGAGAGTGGGCCTGGGAAAGG - Intronic
1033411977 7:141126332-141126354 CAGGAGAGGTGGGCTGGGACTGG + Intronic
1033673177 7:143512071-143512093 TGGGGGTGGTGGGCTGGGAATGG - Intergenic
1034208132 7:149336472-149336494 GGGGATAGGTGGCGGGGGCAAGG + Intergenic
1034258969 7:149742298-149742320 GGGGAGAGCTGGTCAAGGAAAGG + Intergenic
1034462253 7:151204439-151204461 GGGGAGAGGTGGGGTGGGACCGG - Intronic
1034830171 7:154302194-154302216 GGGTAGTGGTTGCCTGGGACTGG - Intronic
1035153251 7:156892738-156892760 GAGGAGAGGTGGGGAGGGAAGGG + Intronic
1035153267 7:156892768-156892790 GGGGAGAGGAGGGGTGGGGAGGG + Intronic
1035730077 8:1847998-1848020 GAGGGAAGGTGGCCCGGGAATGG + Intronic
1036638026 8:10564844-10564866 GGGGAGAGAAGGCCCTGGAAAGG + Intergenic
1036908761 8:12733150-12733172 GGGGAGAGGTGGCCTTGGGCAGG + Intronic
1037498523 8:19463509-19463531 GGGGAGGGGTGGTGAGGGAAGGG + Intronic
1037723719 8:21466359-21466381 GGGGAAGGGTGGGGTGGGAATGG + Intergenic
1037985262 8:23287088-23287110 TGGGAGAAGTGGCTTGGGGATGG - Intronic
1039058284 8:33553921-33553943 GGGGAGAGGTGGGAGGGGAGGGG - Intronic
1039250565 8:35659872-35659894 GGGTAGTGGTGGCCTGGGGAAGG - Intronic
1039413581 8:37375457-37375479 GAGGAGAGGGGGCCTGGGGGTGG - Intergenic
1039439201 8:37583273-37583295 GGGGAGAGATGGTTGGGGAAAGG - Intergenic
1039448046 8:37648327-37648349 GGGCAGCGGTGGCCTCCGAATGG + Intergenic
1039955930 8:42207267-42207289 GGGGAGAGGCAGTCGGGGAAAGG - Intronic
1040003670 8:42600161-42600183 GAGGAGGGGTGGCTTGGGCATGG + Intergenic
1040681909 8:49820749-49820771 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
1041542028 8:58995989-58996011 GGGGAGAGCAGGCCTGGAAACGG - Intronic
1041851217 8:62395231-62395253 GGGGAGAGGTGGCCAGGCAGAGG + Intronic
1041859160 8:62491815-62491837 GGGGAAAGGAGGACTGAGAATGG + Intronic
1043755984 8:84004740-84004762 GGTGGGAGGTGGACAGGGAAAGG + Intergenic
1043845388 8:85157262-85157284 GGGGAGTGGGGGCCTGGGAGAGG + Intergenic
1044237612 8:89849628-89849650 GGTGAGAGGGGGCATGGGACTGG - Intergenic
1045062835 8:98423904-98423926 AGGGAGAGGCACCCTGGGAAGGG - Intronic
1045530211 8:102977509-102977531 GGGGATAGGAGGGCTGGGATAGG + Intronic
1047124576 8:121946692-121946714 GGGGAGAAGTGGAATGGAAAAGG + Intergenic
1047208166 8:122819942-122819964 TGGGAGGGGAGGCCTGGGGAGGG - Intronic
1047750783 8:127878853-127878875 GGGGAGAAGTGGCCAGGGGTGGG + Intergenic
1047886070 8:129251428-129251450 GGGGAGAGGTCACCTTGGCAGGG - Intergenic
1047928207 8:129701593-129701615 GGGGCGGGGTGGTATGGGAAGGG - Intergenic
1048296149 8:133215613-133215635 GGGGTGAGGAGGACAGGGAAGGG - Intronic
1048572562 8:135667702-135667724 GGGAAGAGGAGGCCAGGGAGAGG + Intergenic
1048955596 8:139533608-139533630 GGTGAGAGGTGGCATTGGGAAGG + Intergenic
1049230105 8:141477528-141477550 GGGGAGACCTGGCGTCGGAAGGG - Intergenic
1049343671 8:142127253-142127275 GGGGAGAGGTTGCCTGTGCTGGG - Intergenic
1049362059 8:142216570-142216592 GGGGAGGGGTGGGGTGGGACAGG - Intronic
1049393095 8:142382046-142382068 GGGGCGCGTGGGCCTGGGAACGG - Intronic
1049463025 8:142738898-142738920 GGGGAGCGGCGGCCTGGGCCTGG - Intergenic
1049591380 8:143464493-143464515 AGGGAGAGGATGCTTGGGAAGGG + Intronic
1049787174 8:144456533-144456555 GGGGAGAGGTGGCCTGGCCTGGG - Intronic
1049832756 8:144712880-144712902 GGGAAGAGGCGCCCTGGGCATGG - Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1050654342 9:7809883-7809905 GGTGAGCGGTGGCCTGAGAGTGG + Intronic
1051287698 9:15513178-15513200 GGGGAGGGGAGGGCAGGGAACGG + Intergenic
1051366363 9:16324196-16324218 GGGGAGAAGTGTCCTGGCCATGG + Intergenic
1052360490 9:27551399-27551421 AGGGAGGTGGGGCCTGGGAAGGG - Intronic
1052706140 9:31995827-31995849 GGGGAGTGGGGGCCTGGGACAGG + Intergenic
1053180278 9:35962415-35962437 GGGGAGAGCTGGGCTGGGGCGGG - Intergenic
1053214325 9:36258226-36258248 GGGGAGGGGAGGCCTGGGGCAGG + Intronic
1053669402 9:40345835-40345857 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1053919198 9:42972076-42972098 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1054380532 9:64485855-64485877 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1054453008 9:65413301-65413323 GGGGAGGGGCAGCCTGGGAGCGG - Intergenic
1054515214 9:66030456-66030478 GGGGAGAAGAGACCTGGGCATGG + Intergenic
1054803844 9:69379408-69379430 GGTGACAGGTGGCCTGGGCTAGG + Intronic
1055266401 9:74499226-74499248 GGAGAGAGGTGGTCTAGGCAGGG + Intronic
1055575097 9:77653003-77653025 GGGGAGTGGGGGCAGGGGAAAGG - Intergenic
1055950203 9:81723357-81723379 AGGAAGAGTTGGCCTGGGAGAGG + Intergenic
1056254869 9:84788730-84788752 TTCGAGAGGTGGCCTGGGATGGG + Intronic
1056710905 9:88991354-88991376 GGGGAGAGGGGGGCGGGGAGAGG + Intronic
1057076842 9:92142361-92142383 GGGGTGAGATGGCCCGTGAAGGG + Intergenic
1057432154 9:95004707-95004729 GGGGAGGGGTGGCGGGGGCAAGG + Intronic
1057432178 9:95004759-95004781 GGGGAGGGGTGGCGGGGGCAAGG + Intronic
1058684203 9:107466116-107466138 GGGGAAACCTGGCCTGAGAACGG + Intergenic
1059734229 9:117085685-117085707 GGGGAAAGGTAGCCTGGGAGGGG - Intronic
1059734980 9:117091679-117091701 GGGGAGAGGTGGAGTGGGGAGGG + Intronic
1059880446 9:118683363-118683385 GGGGAGGGGAGGGCAGGGAAGGG + Intergenic
1060281248 9:122217007-122217029 GGGGTGGGGTGGGGTGGGAAAGG + Intronic
1060295308 9:122339182-122339204 GAGCAGATGTGGCCTGGCAAAGG - Intergenic
1060492552 9:124095608-124095630 GGGGAGATGGTGACTGGGAAGGG - Intergenic
1060495874 9:124118242-124118264 GGGAGGAGGTGGCCAGGGAGAGG + Intergenic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060735361 9:126063452-126063474 GGGAAGAGGTGTCCTTGGCATGG + Intergenic
1060742064 9:126105512-126105534 GTGGAGAGGTGTCCTGGGCCTGG - Intergenic
1060779206 9:126399366-126399388 GGAGAGAGCTGGCCTGGGGACGG + Intronic
1061011091 9:127955065-127955087 AGGAAGGGGTGGCCAGGGAAGGG + Intronic
1061046711 9:128169258-128169280 GGGGAGGGGTGGGGTGGGTAGGG - Intronic
1061086216 9:128400353-128400375 GGGGACAGGTGGCCTGGCTCTGG - Intergenic
1061287998 9:129635198-129635220 TCGGTGAGGTGGCCTGGGGAGGG - Exonic
1061306643 9:129736370-129736392 GGGGAGCGGCTGCCTGGGGAGGG - Intergenic
1061416622 9:130450704-130450726 GAGGACGGGAGGCCTGGGAAAGG + Intronic
1061452914 9:130678301-130678323 GGACAGAGATGGCCTGGGCAGGG + Intronic
1061572623 9:131487157-131487179 GGGCAGCGGCGGCCTGTGAACGG - Exonic
1061592871 9:131609348-131609370 GGCAAGAGGTGGCGTGGGTATGG + Intronic
1061662460 9:132139266-132139288 GGGGAGAGGAGGGGAGGGAAGGG + Intergenic
1061868802 9:133509218-133509240 ATGGAGAGGTGGCCTGGCAGGGG + Intergenic
1062076758 9:134593944-134593966 GGGAAGCGCTGGCCTGGGCAGGG + Intergenic
1062127556 9:134871671-134871693 GTGGGGAGGTGGACTGGGATGGG + Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062261133 9:135663833-135663855 GGGCAGAGGGGGCCCTGGAAGGG + Intronic
1062264095 9:135678902-135678924 GGGGAGAGAAGGCCTGGGCCTGG - Intergenic
1062265742 9:135685735-135685757 GGGGTGGGGTGGCCTGGGGGTGG + Intergenic
1062360605 9:136186233-136186255 GTGAAGAGGTGCCCTGGGAGGGG - Intergenic
1062436237 9:136547728-136547750 GCGGAGGGGCGGCCTGGGAGGGG + Intergenic
1062482570 9:136759361-136759383 GGGGTGAGGGGCCCTGGGGAGGG - Intergenic
1062482604 9:136759429-136759451 GGGGTGAGGGGCCCTGGGAAGGG - Intergenic
1062520176 9:136954483-136954505 GGGAGGAGGTGGCCCGGGACAGG - Intronic
1062520192 9:136954517-136954539 AGGGGGAGGTGGCCCGGGACAGG - Intronic
1062527622 9:136984666-136984688 GGGGGGAGGTGCCCTGGGCCTGG + Intronic
1062572574 9:137192413-137192435 GGGGACAGGCAGCCTGGGAGGGG - Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1185460905 X:332425-332447 GGGGAGGGGTGGGCTGGGTCGGG + Intergenic
1185705617 X:2264277-2264299 GGGTAGAGGTGCTCTGGGCACGG - Intronic
1186609965 X:11129595-11129617 GGAGAGAGGTGGAAGGGGAAAGG - Intergenic
1186968865 X:14818228-14818250 GGAGAGTGGTGCCCTGGGAATGG + Intergenic
1187105946 X:16241948-16241970 TGGGAGAGAAGGACTGGGAAAGG - Intergenic
1187281166 X:17859820-17859842 GGGGAGAGGTGGGGAGGGCACGG - Intronic
1188313047 X:28641206-28641228 GGGGAGTGGTGGGCTGGGGGAGG - Intronic
1189129707 X:38485422-38485444 GGGGAGAGGCGGGGTGGGGAAGG + Intronic
1189129719 X:38485446-38485468 GGGGAGAGGCGGGGTGGGGAGGG + Intronic
1189129731 X:38485470-38485492 GGGGAGAGGCGGGGTGGGGAGGG + Intronic
1189129743 X:38485494-38485516 GGGGAGAGGTGGGGTGGGGAGGG + Intronic
1189469624 X:41303597-41303619 GGGGAGAGGTGGAATTGGATGGG - Intergenic
1189779666 X:44502055-44502077 GGGAAGAGGAGGCCTGAGGAGGG - Intergenic
1189908181 X:45783273-45783295 GTGCAGCAGTGGCCTGGGAAGGG + Intergenic
1191162435 X:57345177-57345199 GGGGAGAGGAGGGAAGGGAAGGG - Intronic
1192013683 X:67303677-67303699 GGGGATGGGGGGCCAGGGAAGGG + Intergenic
1192263811 X:69525054-69525076 GGGGAGGGGTGGCCTGACATTGG - Intronic
1192318177 X:70067649-70067671 GGGGAAAGGGGCCCTGGGCAAGG + Intergenic
1193108401 X:77704043-77704065 GGAGAGAGGAGGCCTGAGAGTGG + Intronic
1193601365 X:83510811-83510833 GGGGAGGGGTGGCGAGGGAGTGG + Intergenic
1194628289 X:96251596-96251618 GGGTAGAGATGGGGTGGGAAGGG - Intergenic
1194662877 X:96646044-96646066 GGGGATTGGTGGGCTGGGACGGG - Intergenic
1195113419 X:101670044-101670066 GAAGAGAGATGGCCTGGGCAAGG - Intergenic
1195502047 X:105613176-105613198 CAGGAGAGATGGCCTGGAAATGG - Intronic
1196049241 X:111287924-111287946 GGTGAGAGGTGACATGAGAAAGG - Intergenic
1196845904 X:119896480-119896502 GGGGAGAGGAGGGGAGGGAAGGG + Intronic
1197186316 X:123591261-123591283 GGGGAGAGAGGGCCTGGACAGGG - Intergenic
1197800815 X:130346181-130346203 GGGGAGACTTGGGGTGGGAAGGG + Intronic
1198166782 X:134065413-134065435 GGGGAGGGGTAGGATGGGAAGGG - Intergenic
1198267357 X:135022075-135022097 GGGGACCGGTGCTCTGGGAAGGG - Exonic
1199103833 X:143838161-143838183 GGGGAGAGGAGGCCCTGGAGAGG - Intergenic
1199737027 X:150694008-150694030 GAGGATTGGTGGCCTGGGCAGGG - Intronic
1200106178 X:153714165-153714187 GGGGAGGGGTGGGCTGGGTGCGG - Intronic
1200217981 X:154376944-154376966 GGGGAGGGGTGGCATGGGGGAGG + Intergenic
1200915406 Y:8567022-8567044 AGGCAGAGGTGGCCTGGTATTGG - Intergenic
1201914092 Y:19163985-19164007 AGGGGGTGGGGGCCTGGGAAAGG + Intergenic
1202379581 Y:24263516-24263538 GGGCAGAGGTGGCCTGGGCCTGG + Intergenic
1202491201 Y:25406605-25406627 GGGCAGAGGTGGCCTGGGCCTGG - Intergenic