ID: 1163679060

View in Genome Browser
Species Human (GRCh38)
Location 19:18670129-18670151
Sequence CAGGGCGCGGAGGGGTGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163679060_1163679070 4 Left 1163679060 19:18670129-18670151 CCTTTCCACCCCTCCGCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 408
Right 1163679070 19:18670156-18670178 TCCCTGGCCTGCCCTGTTTTTGG 0: 1
1: 1
2: 3
3: 15
4: 268
1163679060_1163679077 20 Left 1163679060 19:18670129-18670151 CCTTTCCACCCCTCCGCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 408
Right 1163679077 19:18670172-18670194 TTTTTGGGTCAACATTGCTACGG 0: 1
1: 0
2: 0
3: 16
4: 232
1163679060_1163679072 5 Left 1163679060 19:18670129-18670151 CCTTTCCACCCCTCCGCGCCCTG 0: 1
1: 0
2: 1
3: 31
4: 408
Right 1163679072 19:18670157-18670179 CCCTGGCCTGCCCTGTTTTTGGG 0: 1
1: 0
2: 3
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163679060 Original CRISPR CAGGGCGCGGAGGGGTGGAA AGG (reversed) Exonic
900242918 1:1625464-1625486 GAGGGGGCGGAGGGCTGGGAGGG - Intronic
900427598 1:2587587-2587609 CAGGGCAGGGAGGGGTAAAACGG - Intronic
900552623 1:3264372-3264394 CTGGGCCAGGAGGGGAGGAAAGG + Intronic
900552709 1:3264630-3264652 CCGGGCCAGGAGGGGAGGAAAGG + Intronic
900916074 1:5639528-5639550 CAGGACGGGGAGGGGAGGTAGGG + Intergenic
901018577 1:6245004-6245026 GAGGGAGGGGAGGGGAGGAAGGG - Intronic
901630852 1:10647515-10647537 CAGGGCCAGGTGGGGTGGACTGG - Intronic
902201522 1:14836933-14836955 CTGGGGGCGGAGGAGTGGACGGG - Intronic
902619145 1:17640330-17640352 CAGGGGGCAGGGGTGTGGAACGG + Intronic
903042694 1:20543136-20543158 CAGGGAGCGGAGGGGAGGACAGG - Intergenic
904918148 1:33985238-33985260 CAGGGAGGGGTGGGGTGGATGGG - Intronic
905044423 1:34984908-34984930 CAGGGTCCGGGGGGGTGGGAGGG + Intronic
905239916 1:36574951-36574973 CTGGAGGAGGAGGGGTGGAAAGG + Intergenic
905309128 1:37037411-37037433 GAGGGAGGGGAGGGGAGGAAGGG - Intergenic
905741682 1:40376545-40376567 GAGGGCTTGGAGGGGTGGAATGG - Intronic
906668911 1:47640814-47640836 CAGGGTGGGGCGGGGTGGGAGGG + Intergenic
907000346 1:50846403-50846425 CAGGACGCGAAGGGGCGGGATGG - Intronic
910188859 1:84574509-84574531 AAGGGCGGGGAGGGGCGGGAGGG + Intergenic
913047826 1:115089190-115089212 GAGGGAGGGGAGGGATGGAAGGG - Intronic
914440367 1:147700306-147700328 CAGGGAGGGGAGGGATGGAGGGG - Intergenic
916414384 1:164578937-164578959 GAGGGCGTGGAGGGGTGGGTAGG - Intronic
917739391 1:177947761-177947783 CAGGGAGGGGAGGGGAGGGAAGG + Intronic
919974572 1:202602359-202602381 CAAGGTGCTGAGGGCTGGAAGGG - Exonic
920260615 1:204685542-204685564 CAGGGCGCGGAGAGGGGGTGGGG - Intronic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
921274718 1:213507604-213507626 CAGGGCTCTGAGCGGTGGATGGG - Intergenic
922471896 1:225882104-225882126 CAAGGAGCGCAGGGCTGGAATGG + Intronic
922550919 1:226493806-226493828 CATGGCGGGGAGGGGTGGGGTGG - Intergenic
923326097 1:232881426-232881448 CACGGAGAGGAGGGGTGGCATGG - Intergenic
923505295 1:234600228-234600250 CGGGGCGGGGCGGGGCGGAACGG - Intergenic
1062867457 10:868031-868053 CAGGATGGGGTGGGGTGGAAGGG - Intronic
1063114950 10:3066986-3067008 GATGGCGGGGAGGGGTGGAATGG - Intronic
1064270033 10:13856618-13856640 CAGGGCGCGGGGGTGTGGGAAGG + Intronic
1065261301 10:23926200-23926222 CAGGGCCGGGATGGGTGGAGGGG + Intronic
1067084317 10:43229897-43229919 CATGGCGCGGAGGTGGGGCAGGG + Intronic
1067413374 10:46084589-46084611 CAGGGTGGGGAGGAGTAGAATGG + Intergenic
1068956012 10:62818929-62818951 CAGGGCGCGGAGGGCAGGACCGG + Intronic
1069873486 10:71547447-71547469 CAGGCAGCGCAGGTGTGGAAGGG + Intronic
1071712574 10:88064104-88064126 CAGGGCAGGGTGGGGTGGGATGG - Intergenic
1073152861 10:101323595-101323617 CAGGGTGCTGATGGGTGGAGAGG - Intergenic
1073325446 10:102642306-102642328 ACGGGCGCGGTGGGGGGGAAGGG - Intergenic
1074190206 10:111128899-111128921 CAGGGGGCAGGGGGGAGGAAGGG - Intergenic
1075668613 10:124247961-124247983 CAGGGCCCAGAGGGGTAGAAAGG + Intergenic
1076291338 10:129348381-129348403 CCCGGCTCGGAGGGGTGGATTGG - Intergenic
1076291355 10:129348432-129348454 CCCGGCTCGGAGGGGTGGACTGG - Intergenic
1076291399 10:129348584-129348606 CCTGGCTCGGAGGGGTGGACTGG - Intergenic
1076300019 10:129418928-129418950 CGGGGCGGGGAGGGGTGTTAGGG - Intergenic
1076520140 10:131076252-131076274 TGGGTTGCGGAGGGGTGGAAGGG - Intergenic
1077397182 11:2330641-2330663 CAGGGCCTGGAGGTGTGGAAGGG + Intergenic
1077495375 11:2884504-2884526 CGGGGCGGGGAGGGGGGTAAGGG + Intronic
1078250576 11:9613610-9613632 CTGGGGTCGGAGAGGTGGAAAGG - Intergenic
1078334013 11:10450200-10450222 CAGAGCGAGGAGGGTTGGAGAGG + Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078511587 11:11988434-11988456 CAGAGCCCGGAGCAGTGGAAGGG - Intronic
1079101251 11:17543708-17543730 CCGGGTGCGGTGGGGAGGAAGGG - Intronic
1080556586 11:33422545-33422567 GAGGGAGAGGAGGGGGGGAAGGG - Intergenic
1080844533 11:36015302-36015324 CAGGGGGCGGGGGGGGGGAATGG - Intronic
1081020149 11:37936479-37936501 CTGGGCTCGGAGGGGTGGAGGGG - Intergenic
1081614668 11:44583543-44583565 CAGGCGGCAGAGGTGTGGAAGGG + Intronic
1081851583 11:46278236-46278258 ACGGGTGCCGAGGGGTGGAACGG - Intronic
1083609569 11:63998593-63998615 CGGGGCGCGGAGGGAAAGAAGGG + Exonic
1083609854 11:63999561-63999583 CTGGGCGGGGAGGGGTGAGAGGG + Intronic
1083662044 11:64255934-64255956 CAGGGGGCGGAGGGGTGCCCAGG + Intronic
1084208070 11:67607422-67607444 CAGGGCGCAGAGCAGTGGACGGG - Intronic
1086737914 11:90329900-90329922 GAGGGGGAGGAGGGGAGGAAGGG - Intergenic
1086754677 11:90545057-90545079 CAGGTCGTGAAGGGGAGGAAAGG - Intergenic
1087754183 11:102037596-102037618 CAGGTGGTGGTGGGGTGGAAGGG + Intergenic
1088897809 11:114091393-114091415 CAGGGGGTGGAGGAGAGGAAGGG - Intronic
1089403718 11:118180493-118180515 CTGTGCCCGGAGGGGTGGACTGG + Intergenic
1089615833 11:119694243-119694265 CAGGGAGAAGAGGGGTGGGAAGG + Intronic
1089668354 11:120034491-120034513 CAGGCTGCAGAGGGGTTGAAGGG - Intergenic
1090047348 11:123347572-123347594 CAGGGAGGGAAGGGGTAGAAGGG - Intergenic
1090095877 11:123741455-123741477 CAGGGCGGGGAGGAGGGGGAGGG - Intronic
1091740669 12:2959016-2959038 CCGGGGGCGGGGGGGTGGACGGG - Intergenic
1091937597 12:4445867-4445889 CAGGGCGATGATGGGTGGAGGGG - Intergenic
1092141457 12:6186454-6186476 CACGGCTGGGAGAGGTGGAATGG + Intergenic
1092218577 12:6698541-6698563 GAGGGCTGGGAGGGCTGGAAGGG - Intronic
1092994847 12:13940193-13940215 CAGGGCACTGAGGGGTGAATGGG - Intronic
1096778500 12:53978452-53978474 GTGGGCGCGGCGGGGAGGAAAGG - Intergenic
1097092594 12:56519054-56519076 CAGGGTGGGGAGGGGTGGGATGG + Intergenic
1097862797 12:64534713-64534735 TAGGGTGGGAAGGGGTGGAATGG + Intergenic
1099614118 12:84912923-84912945 CGGGGCGCGGAGGGGTAGCCAGG + Intronic
1101857134 12:108453149-108453171 CAGGATGGGGAGGTGTGGAATGG - Intergenic
1101913103 12:108875472-108875494 GAGGGAGTGGAGGGGAGGAAAGG - Intronic
1101942592 12:109111114-109111136 CAGGGCGGGGAGGAGGGGCAAGG - Intergenic
1103611510 12:122127039-122127061 CAGGGCGCGGAGGGCAGGACTGG - Intronic
1103913271 12:124363429-124363451 AAGGGTGCTGCGGGGTGGAAGGG + Intronic
1105503260 13:20990029-20990051 GAGGGTGCCGAAGGGTGGAAAGG + Intronic
1106173141 13:27306456-27306478 CAGGATGAGGAAGGGTGGAACGG - Intergenic
1107605222 13:42049177-42049199 CGGGGCGGGGAGGGGTGGGGCGG + Intronic
1111552516 13:89833407-89833429 CAGGCCACTGAGAGGTGGAAAGG + Intergenic
1112506607 13:99979988-99980010 CAGCGCGCCGAGGGGCGGACGGG + Intergenic
1113737888 13:112690722-112690744 CAGGGCGCTGCGGGCGGGAAGGG - Intronic
1113741220 13:112713894-112713916 CAGGGGTGGGAGGAGTGGAAGGG - Intronic
1113741282 13:112714066-112714088 CAGGGGTCGGGGGAGTGGAAGGG - Intronic
1114617630 14:24076649-24076671 CAGGCCTGGGATGGGTGGAAGGG - Intronic
1115850026 14:37583892-37583914 CCGGGCGAGGAGGGGCGGGACGG - Intergenic
1117072572 14:52069495-52069517 CAGGGCGCGGGCGGGTGGCGGGG + Intergenic
1117353461 14:54902500-54902522 CAGCCCGCGGACGGCTGGAAGGG - Exonic
1118236346 14:64008665-64008687 GAGGGTGGGGAGTGGTGGAATGG + Intronic
1118292602 14:64540324-64540346 CACGGGGAGGAGGCGTGGAAGGG - Intronic
1118616744 14:67579252-67579274 AAGGGCAAGGAGTGGTGGAAGGG - Exonic
1119601730 14:75981192-75981214 GAGGGCTGGGAGGGGTGGCAAGG + Intronic
1121317751 14:92972176-92972198 CAGGCTGCGGAGGCCTGGAAAGG - Intronic
1121676197 14:95754912-95754934 CAGGGCATGGTGGGGTGGGATGG + Intergenic
1122126327 14:99580463-99580485 CAGTGAGGGGAGGGGGGGAAGGG + Intronic
1122222785 14:100251757-100251779 AAGGGAGGGGAGGGGAGGAAGGG - Intronic
1122239035 14:100349703-100349725 CAGGGCCCTGAGGGATGCAAAGG - Intronic
1122417033 14:101554986-101555008 CAGGGTGGGGCGGGGTGGGATGG - Intergenic
1122690309 14:103529125-103529147 CCGTGCGCGGAGGGGGGGAGGGG + Intergenic
1123131778 14:105993070-105993092 CAGGGCCTAGAGGGGTGGACTGG - Intergenic
1123149536 14:106167532-106167554 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1123173043 14:106391879-106391901 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1123224045 14:106883539-106883561 CGGGGCGCGCGGGGGTGGCACGG - Intergenic
1123582010 15:21724198-21724220 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1123618657 15:22166794-22166816 CAGGGGCTGGAGGGGTGGACTGG - Intergenic
1124469338 15:29969017-29969039 CACGGCCTGCAGGGGTGGAAGGG - Intergenic
1124911138 15:33921925-33921947 CAGGGAGCGGAGGGTGGGGAGGG + Intronic
1128061199 15:64736973-64736995 CAGGGCAGGGTGGGGCGGAACGG + Intergenic
1128089771 15:64911716-64911738 TCGGGCGCGGAGGGGTGGGCAGG + Intronic
1128777676 15:70336010-70336032 CAGGGCCCAGAGAGATGGAAAGG - Intergenic
1128779742 15:70351575-70351597 CAGGGGGCTGAGTGGAGGAATGG - Intergenic
1129172857 15:73818387-73818409 CAGGGCACGGTAGGGTGGAGAGG + Intergenic
1129523174 15:76198477-76198499 CTGGGAGCGAAGGGGTGGCAAGG - Intronic
1129683661 15:77672263-77672285 GAGGGAGGGGAGGGGTGAAAGGG - Intronic
1129983610 15:79897007-79897029 CAGGGCGCCGAGGGCGGGACTGG - Exonic
1130224571 15:82047053-82047075 CGGGGCACGGAGGGGAGGGATGG - Intergenic
1130941608 15:88514297-88514319 CAGGTCGGGGTGGGGTGGCAGGG + Intronic
1131264967 15:90910400-90910422 CAGGTAGAGGAGGGGTGGGAAGG + Intronic
1131431721 15:92393799-92393821 CCGGGCGCGGGGCGGGGGAAGGG + Intergenic
1131511379 15:93051218-93051240 CTGGGTGTGGAGGGGTGGGAAGG + Intronic
1131976675 15:97953424-97953446 AAGGGTGCTGATGGGTGGAAGGG + Intergenic
1132005096 15:98219323-98219345 TAAGGCTCGGAGGGGTGGAGAGG + Intergenic
1132309411 15:100846143-100846165 AAGGGAGAGGAGGGGTGGCAAGG + Intergenic
1132522296 16:397338-397360 GGGGACGCGGAGGGGAGGAAGGG + Intronic
1132591766 16:729216-729238 CATGGCGCCGAGGGGTGGGCGGG - Intronic
1134299029 16:12973109-12973131 GGGGGAGCGGAGGGGTGAAATGG - Intronic
1134524091 16:14931079-14931101 AGGGGCGCGGCGGGGTGGCAGGG + Intronic
1134548811 16:15129856-15129878 AGGGGCGCGGCGGGGTGGCAGGG - Intronic
1134711682 16:16329564-16329586 AGGGGCGCGGCGGGGTGGCAGGG + Intergenic
1134719534 16:16372863-16372885 AGGGGCGCGGCGGGGTGGCAGGG + Intergenic
1134947892 16:18339022-18339044 AGGGGCGCGGCGGGGTGGCAGGG - Intergenic
1134955146 16:18379129-18379151 AGGGGCGCGGCGGGGTGGCAGGG - Intergenic
1135047957 16:19169325-19169347 GAGGGGGCGGAGGGGTGGGCCGG + Intronic
1135573635 16:23568130-23568152 CAGAGAGAGTAGGGGTGGAAGGG - Intronic
1136680521 16:31959253-31959275 CAGGGGCTGGAGGGGTGGACTGG + Intergenic
1136684956 16:31988638-31988660 CAGCGTGAGGAGAGGTGGAAGGG + Intergenic
1136780862 16:32900799-32900821 CAGGGGCTGGAGGGGTGGACTGG + Intergenic
1136884201 16:33921631-33921653 CAGCGTGAGGAGAGGTGGAAGGG - Intergenic
1137235621 16:46614997-46615019 CAGGTGGAGGAGAGGTGGAAAGG - Intronic
1138641409 16:58390984-58391006 CAAGGTGCAGTGGGGTGGAAAGG - Intronic
1139250626 16:65492129-65492151 CATGGGAGGGAGGGGTGGAAGGG - Intergenic
1139385612 16:66567075-66567097 CAGGGGGTGGTGGGGAGGAAAGG - Intronic
1139490862 16:67285230-67285252 CAGGGCGGGGAGGGCAGTAAAGG + Intronic
1141729466 16:85812105-85812127 CAGGACGCGGAGGGAAGCAAAGG + Intergenic
1203083514 16_KI270728v1_random:1164828-1164850 CAGGGGCTGGAGGGGTGGACTGG + Intergenic
1143484201 17:7244053-7244075 CAGGGCAGAGAGGGGTGGGAGGG + Exonic
1143613991 17:8038994-8039016 CAGGGCGGGGAGGGGCGGGGCGG - Intergenic
1143628468 17:8123938-8123960 CTGGGGACGCAGGGGTGGAAGGG - Intronic
1144144217 17:12381711-12381733 GAAGGCGCGCAGGGGTGCAAGGG + Intergenic
1144339578 17:14300921-14300943 CAGGACGAGGGGGTGTGGAAAGG - Intergenic
1146640095 17:34533824-34533846 CAGTACGCGGATGGGTGAAAGGG + Intergenic
1146893483 17:36524307-36524329 CTGGGCACTGAGGGGTGGCAGGG - Intronic
1147056440 17:37838844-37838866 CAAGGCGTGGAGGTGTGGATGGG - Intergenic
1147110418 17:38257285-38257307 AAGGGGGCGGAGGGGAGGGAAGG + Intergenic
1147455637 17:40536516-40536538 CAAGGCGGGAAGGGGTGGAGAGG + Intergenic
1147819789 17:43234741-43234763 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147821101 17:43242139-43242161 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147825509 17:43267587-43267609 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147826640 17:43274054-43274076 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147827529 17:43278932-43278954 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147828637 17:43285093-43285115 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147829740 17:43291244-43291266 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147830824 17:43297366-43297388 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147831523 17:43300995-43301017 CCGGGCGAGGAGGAGGGGAAAGG - Intergenic
1147884809 17:43677345-43677367 CAGGGCTTGGAGAGCTGGAAAGG + Intergenic
1147921228 17:43918183-43918205 CAGGGCGCTGAGGGTGGGAGAGG - Intergenic
1147965207 17:44190946-44190968 CCGGGGAGGGAGGGGTGGAAAGG + Exonic
1147991110 17:44334008-44334030 CAGGGCTGGGAGGGCTGGGAGGG + Intergenic
1148168683 17:45501805-45501827 CAGGGCGCTGAGGGTGGGAGAGG - Intergenic
1148211974 17:45814043-45814065 CAAGGCACGGAGGGCAGGAAAGG - Intronic
1148280128 17:46341136-46341158 CAGGGCGCTGAGGGTGGGAGAGG + Intronic
1148302356 17:46559073-46559095 CAGGGCGCTGAGGGTGGGAGAGG + Intronic
1148419090 17:47531146-47531168 AAGGGGGCGGAGGGGAGGGAAGG - Exonic
1148503177 17:48107437-48107459 CCGGGAGCAGAGGGGTGTAAGGG - Intronic
1148547833 17:48530660-48530682 GAGGGCGCGGAGCTGGGGAAGGG + Exonic
1148577104 17:48719897-48719919 CGAGACGCGGAGGGGTGGAGGGG - Intergenic
1148610530 17:48961698-48961720 CAGGGCGCAGAGGGAAGGGAGGG - Intronic
1149429050 17:56582224-56582246 CTGGGAGCGGTGGGGTGGAAGGG + Intergenic
1149913244 17:60585338-60585360 CAGGGGGCGGGAGGGTGGCAGGG + Intronic
1150213609 17:63454960-63454982 CAGGGAGGGGAGGGAGGGAAGGG - Intergenic
1150399877 17:64848255-64848277 CAGGGCGCTGAGGGTGGGAGAGG - Intergenic
1150409899 17:64934538-64934560 CAGGGCGGGGACGGGTGAATGGG + Intergenic
1151612142 17:75183081-75183103 CAGGACGCGGTGGCGTGGGACGG - Intergenic
1152390528 17:80001482-80001504 CTGGGCCCGGAGGGGTGGGCGGG + Intronic
1152649313 17:81484581-81484603 CAGGGCGCGAAGGGGTCCCAAGG - Intergenic
1152699849 17:81813408-81813430 CAGGTCCCGGTGGGGTGGAGAGG + Intronic
1152853001 17:82648594-82648616 CAGGGCGGGGAGGGGCGGGGCGG + Intergenic
1154066344 18:11110683-11110705 CGGGGCGGGGAGGGGCGGAAAGG - Intronic
1154070856 18:11149861-11149883 CAGGGCCCGGCCGGGTGGACTGG - Intergenic
1154106051 18:11523921-11523943 AAGGGCGTGGAGGAGGGGAAAGG - Intergenic
1155286460 18:24293721-24293743 TGGGGGGCTGAGGGGTGGAAGGG + Intronic
1156752459 18:40475444-40475466 CAGGGAGGGGAGGGGAGGAGAGG + Intergenic
1156920894 18:42521593-42521615 CAGGGAGCGGAGGGGAGGGTAGG - Intergenic
1157539670 18:48491463-48491485 CAGGGTGGGGTGGGGAGGAATGG - Intergenic
1160373769 18:78395674-78395696 CAGGGCACGGAGGGTAGGATGGG - Intergenic
1160706089 19:531090-531112 GAGGGCTCTGAGGGGTGGGAGGG - Intergenic
1160725731 19:617016-617038 CAGGGCGCGGGGGGGAGGCTGGG + Exonic
1160951881 19:1671816-1671838 GAGGGCGCGGTGGGGGCGAAGGG - Intergenic
1161479402 19:4503172-4503194 CAGGGGGAGGAAGGGTGGAGGGG - Exonic
1161508054 19:4654756-4654778 CAGGGCGTGGAGGCGTGGTGTGG + Exonic
1161580427 19:5077749-5077771 CAGGGGCTGCAGGGGTGGAAGGG + Intronic
1161849753 19:6732216-6732238 CAGGGCGGGGAGGGCTGCACAGG - Intronic
1162101553 19:8342407-8342429 CAGGGAGCGGAGGAGAGGGAAGG - Intronic
1162301179 19:9846051-9846073 CAGGGAGAGGAGGGGTGGGAGGG + Intronic
1162561546 19:11420689-11420711 CGGCGCCCGGAGGGGAGGAAGGG - Exonic
1163390792 19:17028614-17028636 AGGGGCCCGGAGGGGTGGCATGG - Intergenic
1163533005 19:17861690-17861712 CAGGGAGCGGGTGGGTGGCATGG + Intronic
1163647385 19:18497355-18497377 CAGCGGGCAGAGGGGAGGAAGGG + Intronic
1163679060 19:18670129-18670151 CAGGGCGCGGAGGGGTGGAAAGG - Exonic
1163729391 19:18940722-18940744 CAGGGACTGGAGGGGTGGCAGGG - Intronic
1164159684 19:22618146-22618168 GAGGTCGCGCAGGGGTGGACTGG - Intergenic
1165063583 19:33216646-33216668 CAGGAAGCGGAGGGAAGGAAAGG - Intronic
1165735646 19:38173837-38173859 CAGGGCGGGGAGCAGTGCAAAGG + Intronic
1166137455 19:40786185-40786207 CAGAGGGCTCAGGGGTGGAATGG + Intronic
1166329316 19:42069448-42069470 CGGGCCGGGGAGGGGAGGAAGGG + Intronic
1167512087 19:49900719-49900741 GAGGGAGCGGAGGGGAGGAAAGG + Intronic
1168278347 19:55289445-55289467 GAGGGGGCAGAGGGCTGGAAGGG - Intronic
1168310792 19:55459608-55459630 CAGTGCGGGGCGGGGGGGAAAGG - Intronic
925292265 2:2755793-2755815 CAGAGCCCGGTGTGGTGGAAGGG - Intergenic
925394758 2:3525218-3525240 CAGGGAGAGGGGCGGTGGAAGGG + Intergenic
927156559 2:20224474-20224496 CGGGGCGAGGAGGGTGGGAACGG + Intronic
927218195 2:20681931-20681953 CAGGGCATGGAAGGGTGGGAAGG + Intergenic
927783732 2:25958242-25958264 CATGTGGCAGAGGGGTGGAAGGG - Intronic
928194121 2:29202074-29202096 CAGGGCCAATAGGGGTGGAAGGG - Intronic
929436516 2:41932651-41932673 CAGGGAGAGCAGGGGTGGACAGG - Intergenic
931705814 2:64945156-64945178 CATGGGGCACAGGGGTGGAACGG + Intergenic
932086966 2:68771263-68771285 CAGGGCGGGGAAAGGTGGGAAGG - Intronic
932442097 2:71743998-71744020 CAGGGGTGGGAGGGGTGGCAGGG - Intergenic
932591675 2:73071334-73071356 CAGGGCGCCGCGGGCGGGAAAGG + Intronic
933573555 2:84040910-84040932 CAGGGCAGGGAGGGAGGGAAGGG - Intergenic
933685093 2:85135298-85135320 CAGGGAGCCTAGGGGTGGAGTGG - Intronic
934605542 2:95692527-95692549 CAGGTCACTGAGGGGAGGAAAGG - Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936539007 2:113335067-113335089 CAGGTCACTGAGGGGAGGAAAGG - Intergenic
936685729 2:114823922-114823944 CAGGGCAAGGATGGATGGAAAGG + Intronic
937897084 2:126985600-126985622 CAGAGCGGGGAGGGAGGGAAGGG - Intergenic
937988415 2:127648989-127649011 GAGGGAGGGGAGGGGAGGAAGGG + Intronic
938664642 2:133521991-133522013 CAGGGCAAGGTGAGGTGGAAAGG - Intronic
940751240 2:157628916-157628938 CAGGGGGCGGAGGCGCGGCAGGG - Exonic
942101634 2:172589598-172589620 CAGGGCAGGGAGGTGTGAAATGG + Intronic
944636203 2:201678351-201678373 GAGGGCGTGGGTGGGTGGAAGGG - Intronic
947499113 2:230659404-230659426 TGGGGTGCGGAGGGGTGGAAGGG + Intergenic
947527438 2:230887018-230887040 CAGGGAGGGGAGGGAGGGAAGGG + Intergenic
947716032 2:232339248-232339270 CAGGCCGCAGAAGGGAGGAACGG + Intronic
948122694 2:235543094-235543116 CAGGGGGCGGGGGGGGGGGAGGG - Intronic
948255914 2:236567906-236567928 CAGGGCGCGGGGCTGTGGGAGGG + Intronic
948489394 2:238302825-238302847 CAGTGTGTGGAGGGGTGGAGGGG + Intergenic
948657397 2:239485143-239485165 CATGGCGAGGAGGGGAGGGAGGG + Intergenic
1169246364 20:4028310-4028332 GAGGGAGGGGAGGGGAGGAAGGG - Intergenic
1169522877 20:6391958-6391980 CGGGGTGGGGAGGAGTGGAAGGG + Intergenic
1171036103 20:21714124-21714146 AAGGGCGCAGAGGGCTGGGAAGG - Intronic
1171249606 20:23638003-23638025 CAGGCCGCGGTGGGGTGGGGCGG - Intronic
1172360780 20:34311506-34311528 CTGGGCGCGGAGGGGCGGAGAGG + Intronic
1172859028 20:38033158-38033180 CAGGGCGTGGAGGCGTGAAAAGG + Intronic
1173439878 20:43066685-43066707 CATAGCACGGAGTGGTGGAAGGG + Intronic
1174317120 20:49712460-49712482 CAGGCGGGGGAGGGGTGGGAGGG + Intronic
1175762636 20:61571778-61571800 CAGGGAGGGGAGGGGCGGGAAGG - Intronic
1175777145 20:61660585-61660607 CAGGAGGCAGAGGGGTGGACGGG + Intronic
1175938760 20:62527476-62527498 TAGGGCGAGGAGGGGTGAACAGG - Intergenic
1176053853 20:63134585-63134607 CACGGCCCGGAGAGGTGGCAGGG + Intergenic
1176054012 20:63134939-63134961 CGGGGCCCGGAGGGGTGGCAGGG + Intergenic
1176054052 20:63135027-63135049 CGGGGCCCGGAGGGGTGGCAGGG + Intergenic
1176054103 20:63135150-63135172 CAGGGCCCGGAGAGGTGGCAGGG + Intergenic
1176054110 20:63135168-63135190 CAGGGCCCGGAGAGGTGGCAGGG + Intergenic
1176054178 20:63135327-63135349 CGGGGCCCGGAGGGGTGGCAGGG + Intergenic
1176054267 20:63135522-63135544 CGGGGCCCGGAGGGGTGGCAGGG + Intergenic
1176128727 20:63487345-63487367 CAGAGCAGGGAGGGGTGGAAAGG + Intergenic
1176846889 21:13883823-13883845 CAGTGGGGGGAGGGGTGGTAGGG - Intergenic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179492109 21:41747284-41747306 CAGGGCTGGGATGTGTGGAAGGG + Intronic
1179893779 21:44350515-44350537 CAGGGCGCGGTGGGGTGCAAGGG + Intronic
1179893796 21:44350564-44350586 CAGGGCACGGCGGGGTGCAGGGG + Intronic
1179893812 21:44350613-44350635 CAGGGCGCGGTGGGGTGCAGGGG + Intronic
1179893828 21:44350661-44350683 CAGGGTGCGGTGGGGTGCAGGGG + Intronic
1180042382 21:45287305-45287327 TAGGGCCAGGAGGGGTGGGATGG - Intronic
1180881875 22:19209960-19209982 CATGGTGCAGAGGGCTGGAATGG + Intronic
1180979822 22:19873256-19873278 CAGGGCTCTGAGGAGTGGACAGG - Intergenic
1181036297 22:20171396-20171418 GAGGGAGGGGAGGGGTGCAAGGG + Intergenic
1181312470 22:21952703-21952725 CAAGGCGCACAGGGGTGAAATGG - Intronic
1181528439 22:23502758-23502780 CAGGGGATGGAGGGGTGGAGGGG - Intergenic
1182024446 22:27107011-27107033 CTGGGCGCAGAGAGATGGAAAGG + Intergenic
1182060202 22:27391749-27391771 CTGGGGGCGGGGGGGTGGGAGGG + Intergenic
1182336761 22:29588786-29588808 CAGGGAGAGGAGGGGTGGGTGGG - Intergenic
1183202509 22:36395428-36395450 CATGGTGTGGAGGGGAGGAAAGG - Intergenic
1183281105 22:36933166-36933188 CTGGGCAGGGAGGGGTTGAAAGG + Intronic
1183413837 22:37671557-37671579 CAGGGGGCAGAGGCGGGGAAAGG - Intergenic
1183742852 22:39678226-39678248 CAGGGCACGGAGGAGTGGAGGGG + Intronic
1183947542 22:41335233-41335255 CAAGGCTCTGAGGGGTGGAGTGG - Intronic
1184034402 22:41911585-41911607 CAGGGAGGGGAGGGGAGGGAAGG - Intronic
1184422826 22:44391735-44391757 CAGGGAGTGGAGGAGAGGAAGGG - Intergenic
1184567610 22:45301558-45301580 CAGGGTGGGCAGGGGTGGGATGG - Intergenic
1184953433 22:47862584-47862606 CAGGGGGCCGGTGGGTGGAAGGG - Intergenic
950153590 3:10707057-10707079 CAGGGCAAGGAGGGGTGGCCAGG + Intronic
950183039 3:10928362-10928384 CAGGGCGCAGAGGAGAGGGATGG + Intronic
950554319 3:13686049-13686071 GAGGGGGCGCAGGGGTGGCAGGG + Intergenic
950873527 3:16249669-16249691 CAGGCTGGGGAGGGGTGCAAAGG + Intergenic
952669398 3:35948012-35948034 CATGGAGAGGAGGGATGGAAAGG + Intergenic
952834375 3:37591081-37591103 CAGGGGCAGGAGGGGTGGCATGG - Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
952990421 3:38826604-38826626 CAGGGTGGGGAGGGGAGAAAGGG + Intergenic
953786650 3:45916299-45916321 CAGGGTGGGGTGAGGTGGAATGG + Intergenic
954412214 3:50375745-50375767 CAGGGGGCGCTGGGGTAGAAGGG + Intronic
956701102 3:71959136-71959158 CAGAGAGTGGTGGGGTGGAAGGG + Intergenic
957527259 3:81393063-81393085 AAAGGCAGGGAGGGGTGGAAAGG - Intergenic
960115245 3:113886149-113886171 CAGGGCAGAGAGGGGTGGGAGGG - Intronic
961164129 3:124751873-124751895 GGGGGCGCGGGGGGGGGGAAGGG - Intergenic
961236819 3:125374889-125374911 CAGGGCGCGGAGGGTGGGTTGGG - Intronic
961726792 3:128936074-128936096 CAGGGCTTGGAGGGGTGGTGAGG - Intronic
961796305 3:129411450-129411472 AAGGGAGCGGAGGGGTGGCCTGG - Intronic
962977673 3:140459787-140459809 CTGGGGTAGGAGGGGTGGAAGGG - Intronic
965066099 3:163850638-163850660 CAGGGGGTGGAGGGGAGGAGGGG + Intergenic
965321844 3:167261227-167261249 GAGGTGGCGGAGGGGTGCAATGG + Intronic
965404094 3:168249443-168249465 CTGGGCGCTGGGGGCTGGAAGGG - Intergenic
965730232 3:171763516-171763538 AAGGGAGCGGAGGGGAGGAGAGG + Intronic
966678122 3:182611294-182611316 CAGGCCACCGAGAGGTGGAAAGG - Intergenic
968473168 4:791192-791214 CGGGGGGCGGAGGGGTGGGCTGG + Intronic
968840292 4:2999246-2999268 CTGGGTGGGGAGTGGTGGAAGGG + Intronic
968941001 4:3637569-3637591 CAGGCCGCGGCGGGGTGGACAGG + Intergenic
969540859 4:7787997-7788019 CTGGGCCCGGAGGGGAGGGAGGG - Intronic
973529331 4:51819212-51819234 CAGGAACCGGAGGGGTGGGATGG + Intergenic
978778269 4:112523772-112523794 GAGGGGTGGGAGGGGTGGAAGGG - Intergenic
979684633 4:123497797-123497819 TAGGGTGGGGAGAGGTGGAATGG - Intergenic
981617309 4:146655232-146655254 CAGGGGGCGCAGGCGGGGAATGG - Intergenic
981782123 4:148442393-148442415 CCGGGCGCGGAGGGGCTGAGAGG + Exonic
982354230 4:154449126-154449148 CAGGGTGCGAAGGGGCAGAAAGG - Intronic
983418345 4:167485856-167485878 CAGGTCGGGGAGGGGAGTAATGG + Intergenic
985491160 5:180483-180505 CAGTGCCCTGAGGGGTAGAAAGG + Intronic
986452979 5:7884665-7884687 CAGGGTGTGGAGGGTAGGAAGGG - Intronic
986827042 5:11533061-11533083 CAGGGGGCGGAGAAGAGGAAAGG + Intronic
988043097 5:25912547-25912569 CAAGGCGTGGGGGTGTGGAAGGG - Intergenic
989253541 5:39342820-39342842 CAGTGGGCCTAGGGGTGGAAAGG - Intronic
991606472 5:68406869-68406891 CAGGGCACCGAGGGGTCAAAGGG + Intergenic
992031499 5:72726035-72726057 CAGGCCACTGAGAGGTGGAAAGG - Intergenic
992164532 5:74036253-74036275 CAGGGAGCGGAAGAGAGGAAGGG - Intergenic
993148999 5:84135742-84135764 CAGGGCACAGAAGGATGGAAAGG - Intronic
996562151 5:124842699-124842721 CGGGGGGCAGAGGGGTGCAAGGG + Intergenic
998266074 5:140668809-140668831 CAGGGAGGGGAGGGGAGGCAAGG - Intronic
998400190 5:141844734-141844756 CAGGCCTCAGAGGGGAGGAAAGG - Intergenic
998433978 5:142091156-142091178 CAGGGGCTGGAGGGGAGGAATGG + Intergenic
999076859 5:148804518-148804540 CAGGGGGAGGAGGGGTCGAGGGG + Intergenic
1000210928 5:159105342-159105364 CAGGGAGCAGAGGAGAGGAAAGG + Intergenic
1001734912 5:173989613-173989635 CCGGGCGCGGCGGGGCGGGACGG + Intronic
1002044182 5:176532870-176532892 CAGGGCTCGGAGGAGGGGCACGG - Intronic
1002065394 5:176649163-176649185 CAGGGCCTGGAGGTTTGGAATGG + Intronic
1002714837 5:181220337-181220359 CAGAGCGGCGACGGGTGGAAGGG + Intergenic
1002897783 6:1389491-1389513 CAGGGCGGGGTGGGGGGGGAGGG + Intergenic
1005672883 6:28124839-28124861 CCGGGAGAGGATGGGTGGAAGGG + Intronic
1006023585 6:31132868-31132890 GAGGGTGGGGAGGAGTGGAAAGG + Intronic
1006225889 6:32535669-32535691 CAGGCCTCAGAGGGGAGGAATGG - Intergenic
1006472422 6:34236484-34236506 CAGGGCGTGTGGGGGTGGACGGG - Intergenic
1006535806 6:34697645-34697667 CAAGGCGGGGAGGGGTGGGGGGG + Intergenic
1006577691 6:35058157-35058179 GAGGGTGAGGAGGGGAGGAAGGG + Intronic
1007178775 6:39913629-39913651 CAGGGAGAGAAGAGGTGGAAGGG + Intronic
1007610931 6:43148254-43148276 AAGGGAGGGGAGGGGGGGAAAGG + Intronic
1010656582 6:78518525-78518547 CAGAGGGAGGTGGGGTGGAAGGG - Intergenic
1011497228 6:87948978-87949000 GAGGGCAGGGAGGTGTGGAAGGG - Intergenic
1012237742 6:96837739-96837761 CAGGGCAGGGAGCGGTCGAAAGG - Intergenic
1012431383 6:99167175-99167197 GAGGGAGAGGATGGGTGGAAGGG + Intergenic
1012465864 6:99515532-99515554 GAGCGCGGGGAGGGGTGAAAGGG + Intronic
1013353510 6:109327272-109327294 CAGGCCACTGAGAGGTGGAAAGG + Intergenic
1013653321 6:112218828-112218850 GAGGGCGAGGAGGGCTGGCAGGG + Intronic
1014045345 6:116877675-116877697 GTGGGGGCGGAGGGGAGGAAAGG - Intronic
1014542468 6:122693295-122693317 CAGGGGGCGGTGGGGAGTAAAGG - Intronic
1016271841 6:142299458-142299480 GAGGGTGAGGTGGGGTGGAATGG + Intergenic
1018088580 6:160326052-160326074 CAGGGAGAGGAGAGGTGGCAAGG - Intergenic
1019453088 7:1109752-1109774 CAGGGCCCGGCGGGCGGGAAGGG - Intronic
1019655636 7:2193393-2193415 CTGGGTGCGGAGGCGGGGAAGGG - Intronic
1020409774 7:7878325-7878347 CAGGAGGCAGAGGGGTTGAAAGG - Exonic
1022334110 7:29406553-29406575 CAGGGCGGGGAGGGGAGGGGAGG - Intronic
1023000263 7:35801187-35801209 CTGGTCGCGGAGGGGGGGAGGGG + Exonic
1023081882 7:36533977-36533999 CAGGGCCCAGAGGGGCGGCAGGG - Intronic
1023533459 7:41183160-41183182 AAGGGAGGGGAGGGGAGGAAAGG - Intergenic
1023939881 7:44762670-44762692 CAGGGCGCTGAGGCCAGGAAAGG + Intronic
1024988026 7:55212860-55212882 CAGGGCGAGGAGGGCAGGCAGGG + Intronic
1024989815 7:55224324-55224346 CAGGACACTGAGGTGTGGAATGG - Intronic
1025231111 7:57203813-57203835 CAGGGAGCGGATGGGTGACAGGG - Intergenic
1026155550 7:67822712-67822734 CTGGGTGGGGTGGGGTGGAATGG - Intergenic
1027232555 7:76281398-76281420 CAGGGCACGGAGGGGGGAGAGGG - Intronic
1027681893 7:81232596-81232618 CAGGGCAAGCAGGGGTGGGAGGG + Intergenic
1028723188 7:94057752-94057774 CGGGGGGTGGAGGGGTGGCAGGG - Intergenic
1032023157 7:128421335-128421357 CAGGGGGCAGGGAGGTGGAACGG + Intergenic
1034331010 7:150282183-150282205 CCCGGGGAGGAGGGGTGGAATGG + Intronic
1034422109 7:150995750-150995772 GAGGGGGTGCAGGGGTGGAATGG - Intronic
1034534937 7:151720748-151720770 AAGGGGGCAGAGGGATGGAAAGG + Intronic
1034667033 7:152827670-152827692 CCCGGGGAGGAGGGGTGGAATGG - Intronic
1037858319 8:22387493-22387515 CAGGACGTGGAGGAGTGAAAGGG + Intronic
1038047477 8:23777955-23777977 CAGGGAGGGGAGAGGAGGAAAGG + Intergenic
1038408816 8:27342499-27342521 CAGGGCGCTGTGGGCAGGAAAGG - Intronic
1038774147 8:30512991-30513013 CAGGGTGGGGTGGGGTGGGAAGG - Intronic
1040866338 8:52052300-52052322 CAGGGTGGGGAGGGAAGGAAGGG - Intergenic
1040871129 8:52101001-52101023 CAGGGCGCAGAGGGGAAGAGAGG + Intergenic
1041266866 8:56074267-56074289 CGGGGCGTGTAGGGGCGGAAAGG - Intronic
1044828725 8:96224245-96224267 CAGAGTGGGGAGGGATGGAAGGG + Intergenic
1047423869 8:124728435-124728457 CCGGGCGCGCAGGAGTGAAAAGG - Intergenic
1048965041 8:139609099-139609121 CGGGGCGGGGTGGGGTGGGATGG - Intronic
1049292561 8:141812391-141812413 CAGGGCGGGGAGGGCGGGGAGGG + Intergenic
1049362061 8:142216576-142216598 CAGTGCGGGGAGGGGTGGGGTGG - Intronic
1049493175 8:142915668-142915690 CAGGGCGGGGAAGGGTGGGGAGG - Intronic
1049567606 8:143349303-143349325 CAGGGGGCAGGGGGGTGGGAGGG - Intronic
1049594476 8:143477099-143477121 CAAGGCCCGGAGGGGTTGCAGGG - Intronic
1049640162 8:143711767-143711789 CTGGCTGCGGAGGGGTGGGAAGG - Intronic
1049696413 8:143986268-143986290 GAGGGGCAGGAGGGGTGGAATGG - Intronic
1051712280 9:19944112-19944134 CAGGGGAGGGAGGGGAGGAATGG + Intergenic
1052849004 9:33364633-33364655 CAGGGAGAGGATGGGTGAAAGGG + Intronic
1053312692 9:37029452-37029474 CAGTGCGCGCCGGGGTGGAGTGG + Intronic
1053329237 9:37188647-37188669 GAGGGAGGGGAGGGGAGGAAGGG - Intronic
1054748346 9:68878895-68878917 CAGGGGGTGAAGGGTTGGAAGGG + Intronic
1057432146 9:95004692-95004714 CAGGGCGCGGAGCCGGGGGAGGG + Intronic
1058110890 9:101029597-101029619 TAGGACGCAGAGGGGTGGAAGGG - Intronic
1058233563 9:102461517-102461539 CAGGGGGTGGCGGGGTGGAATGG + Intergenic
1059321226 9:113471639-113471661 GAGAGCGGGGAGGGGAGGAAGGG - Intronic
1059632714 9:116141925-116141947 AAGGGAGGGGAGGGGAGGAAAGG + Intergenic
1059758489 9:117316476-117316498 CAGGGTGGGGAGCGATGGAAGGG + Intronic
1061096055 9:128457138-128457160 CTGGGGGCAGAGGGGAGGAAGGG - Intronic
1061433125 9:130543691-130543713 AGGGGAGCGGAGGGGAGGAAAGG + Intergenic
1061487684 9:130928649-130928671 CTGGGGGCGGTGGGGCGGAAGGG + Intronic
1061955175 9:133957546-133957568 CAGGGCGAGGAGGGGAGGCCAGG + Intronic
1062194185 9:135264003-135264025 CAGGGAGTGGGGGGGAGGAAAGG - Intergenic
1062572486 9:137191981-137192003 CAGGGCCAGGAGGGGTGGGTGGG + Exonic
1062623913 9:137434529-137434551 AGGGGCGGAGAGGGGTGGAAGGG - Exonic
1062732340 9:138117249-138117271 CAGAGAGCCGAGGGATGGAAGGG + Intronic
1185736443 X:2500346-2500368 CAGGCCCCGGAGGGGAGGAGCGG - Intronic
1186567257 X:10676730-10676752 CTAGGAGGGGAGGGGTGGAAGGG + Intronic
1187419578 X:19122630-19122652 CTGGGCGCGGAGGTGGGGAGCGG + Intronic
1199698966 X:150362903-150362925 GAGGGATCGGAGGGGCGGAAGGG - Intronic
1199894742 X:152118627-152118649 CAGGGTGTGGGGGGGTGGGAGGG + Intergenic
1200210079 X:154343151-154343173 AAGGGGGCGGAGGAGAGGAAGGG - Intergenic
1200220773 X:154388941-154388963 AAGGGGGCGGAGGAGAGGAAGGG + Intergenic
1200795093 Y:7333530-7333552 AGGGGAGGGGAGGGGTGGAAGGG - Intergenic
1201226567 Y:11824444-11824466 GAGGGCGGGGAGGGGAGGAAAGG - Intergenic