ID: 1163680269

View in Genome Browser
Species Human (GRCh38)
Location 19:18677480-18677502
Sequence CTGGCTCCTTCTCGACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163680269_1163680270 -6 Left 1163680269 19:18677480-18677502 CCTGCAAGTCGAGAAGGAGCCAG No data
Right 1163680270 19:18677497-18677519 AGCCAGCCACGAAAGCATCTTGG No data
1163680269_1163680278 30 Left 1163680269 19:18677480-18677502 CCTGCAAGTCGAGAAGGAGCCAG No data
Right 1163680278 19:18677533-18677555 AGGCAGAGGGAACAGCGAAGAGG No data
1163680269_1163680272 -3 Left 1163680269 19:18677480-18677502 CCTGCAAGTCGAGAAGGAGCCAG No data
Right 1163680272 19:18677500-18677522 CAGCCACGAAAGCATCTTGGAGG No data
1163680269_1163680276 17 Left 1163680269 19:18677480-18677502 CCTGCAAGTCGAGAAGGAGCCAG No data
Right 1163680276 19:18677520-18677542 AGGAGCGCAATCCAGGCAGAGGG No data
1163680269_1163680274 10 Left 1163680269 19:18677480-18677502 CCTGCAAGTCGAGAAGGAGCCAG No data
Right 1163680274 19:18677513-18677535 ATCTTGGAGGAGCGCAATCCAGG No data
1163680269_1163680275 16 Left 1163680269 19:18677480-18677502 CCTGCAAGTCGAGAAGGAGCCAG No data
Right 1163680275 19:18677519-18677541 GAGGAGCGCAATCCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163680269 Original CRISPR CTGGCTCCTTCTCGACTTGC AGG (reversed) Intergenic
No off target data available for this crispr