ID: 1163680956

View in Genome Browser
Species Human (GRCh38)
Location 19:18682306-18682328
Sequence TCCCTCTCTTGAGGGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163680944_1163680956 12 Left 1163680944 19:18682271-18682293 CCTGAATATAAACTTTCAATATT No data
Right 1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG No data
1163680941_1163680956 23 Left 1163680941 19:18682260-18682282 CCCTGCAGCCTCCTGAATATAAA No data
Right 1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG No data
1163680943_1163680956 15 Left 1163680943 19:18682268-18682290 CCTCCTGAATATAAACTTTCAAT No data
Right 1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG No data
1163680942_1163680956 22 Left 1163680942 19:18682261-18682283 CCTGCAGCCTCCTGAATATAAAC No data
Right 1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163680956 Original CRISPR TCCCTCTCTTGAGGGAGGGA GGG Intergenic
No off target data available for this crispr