ID: 1163681193

View in Genome Browser
Species Human (GRCh38)
Location 19:18683620-18683642
Sequence CGGCGCTTGCGCGGTGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163681185_1163681193 -9 Left 1163681185 19:18683606-18683628 CCCGTGGGCCCAGCCGGCGCTTG 0: 1
1: 0
2: 0
3: 5
4: 171
Right 1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG 0: 1
1: 0
2: 0
3: 2
4: 62
1163681180_1163681193 9 Left 1163681180 19:18683588-18683610 CCTGCGCACTGCTCGCCGCCCGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG 0: 1
1: 0
2: 0
3: 2
4: 62
1163681178_1163681193 20 Left 1163681178 19:18683577-18683599 CCGCCGGCGCGCCTGCGCACTGC 0: 1
1: 0
2: 4
3: 9
4: 132
Right 1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG 0: 1
1: 0
2: 0
3: 2
4: 62
1163681179_1163681193 17 Left 1163681179 19:18683580-18683602 CCGGCGCGCCTGCGCACTGCTCG 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG 0: 1
1: 0
2: 0
3: 2
4: 62
1163681184_1163681193 -6 Left 1163681184 19:18683603-18683625 CCGCCCGTGGGCCCAGCCGGCGC 0: 1
1: 0
2: 1
3: 16
4: 195
Right 1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG 0: 1
1: 0
2: 0
3: 2
4: 62
1163681186_1163681193 -10 Left 1163681186 19:18683607-18683629 CCGTGGGCCCAGCCGGCGCTTGC 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG 0: 1
1: 0
2: 0
3: 2
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163681193 Original CRISPR CGGCGCTTGCGCGGTGGCAC GGG Intergenic
900135790 1:1116414-1116436 CGACGCTTGTGCGGTCGCCCGGG - Intergenic
900187981 1:1341931-1341953 CGGTGCTTGGGTGGAGGCACAGG - Intronic
902089642 1:13893089-13893111 CGGCGCTCGCGCGGGGACGCGGG + Intergenic
907883983 1:58576664-58576686 CGGCGGTGGGGCGGTGGCGCAGG + Exonic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
1070806712 10:79275082-79275104 CGCCTCTTGTGCGGGGGCACTGG - Intronic
1071529312 10:86377044-86377066 GGGCAATTGCGCGGTGGCTCAGG - Intergenic
1084669192 11:70595290-70595312 GGGCGCTTGGAGGGTGGCACTGG - Intronic
1090224856 11:125063642-125063664 CGACGCTGGCTCGGTGACACTGG + Intronic
1090780384 11:130002201-130002223 CGGCGGTTGCGCGGGCGCTCCGG - Intronic
1096388208 12:51209294-51209316 CAGGGCTTGGGCGGTGGCAGTGG - Intronic
1096668071 12:53180493-53180515 CGGCGCGTGCGCCGTGGCCGGGG - Intronic
1103595369 12:122021874-122021896 CGGCGCTTGCGCACTGGGCCAGG + Exonic
1104889747 12:132134574-132134596 CGGCCCTTCCACAGTGGCACGGG - Intergenic
1108596758 13:51956173-51956195 TGGCTGCTGCGCGGTGGCACTGG - Intronic
1112580576 13:100674181-100674203 CGGCGCGAGCGCGGGGCCACCGG - Intronic
1114793086 14:25681178-25681200 CGGCGCTTACGGGCCGGCACAGG - Intergenic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123413006 15:20074431-20074453 CGGCAGCTGCGCGGCGGCACCGG - Intergenic
1123522348 15:21081544-21081566 CGGCAGCTGCGCGGCGGCACCGG - Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1129199155 15:73988556-73988578 CGGAGCTTGAGGGGTGGCACCGG - Intronic
1132987874 16:2777358-2777380 CGGCGGCTGCGGGGCGGCACGGG - Intergenic
1139088547 16:63617463-63617485 CGGCGCTCGCGGGCCGGCACGGG - Intergenic
1140478776 16:75251579-75251601 CGGCAGCTGCGCGGCGGCACCGG - Intronic
1143212262 17:5197097-5197119 GGGCCCTGGCGCGGTGGCTCAGG - Intergenic
1145370504 17:22303030-22303052 TGGCGACTGCGCGGTGGCAGGGG - Intergenic
1160745392 19:708990-709012 CGGCGCGGGGGCGGCGGCACCGG - Intergenic
1160822999 19:1067064-1067086 CGCCGCTCGCGGGGTGGGACCGG - Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163372087 19:16906972-16906994 CGGAGCTTGCGCAGTGCCTCAGG + Exonic
1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG + Intergenic
1164428431 19:28165965-28165987 CGGCCCTTGAGGGTTGGCACTGG + Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1167158954 19:47755442-47755464 CGGAGCTGGCGCGGCGGCAGAGG + Exonic
925406886 2:3611686-3611708 CGGGGCTGGGGCTGTGGCACGGG + Intronic
927052911 2:19348053-19348075 TGGCGCTTGCGCAGTGGGAGAGG + Intergenic
934966676 2:98730555-98730577 CGGCGCTTTCGCGGGGGCCGCGG - Intronic
946373924 2:219297025-219297047 CTCCCCCTGCGCGGTGGCACAGG + Exonic
948050498 2:234976192-234976214 CGGCTCCTGCGGGGTGGCCCGGG + Intronic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1178913343 21:36693534-36693556 AGGCACTGGGGCGGTGGCACTGG - Intergenic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1184856750 22:47150514-47150536 CCGGGCTTGCTGGGTGGCACCGG + Intronic
953505875 3:43485149-43485171 GGGCCCTGGCGCGGTAGCACTGG + Intronic
954146158 3:48635329-48635351 AGGCGCTCGCGCGGGGCCACCGG + Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
986859013 5:11904456-11904478 CGCCGCTCTCGCGGCGGCACTGG - Intergenic
1003873666 6:10419602-10419624 CGACGCATGCGCGCTGGCCCAGG + Intronic
1004403756 6:15312519-15312541 CGGCGCTGGCATGGGGGCACAGG - Intronic
1016378719 6:143450814-143450836 CGGCGGCTGCGCGGCGGCAGCGG + Intronic
1016965873 6:149718132-149718154 CGTCGCTTGCGCGGGGGCCGAGG + Exonic
1019195639 6:170280965-170280987 CGCCGCGGGCACGGTGGCACGGG - Intergenic
1031317277 7:120273379-120273401 CGGCGTTGGCGCGGTGGGGCCGG - Intergenic
1034457031 7:151176149-151176171 CGGAGCAGGCGCGGTGGCAGGGG + Exonic
1035266030 7:157690775-157690797 CAGCGGCTGCGCGGCGGCACGGG + Intronic
1035659175 8:1333934-1333956 AGGCGCATATGCGGTGGCACAGG + Intergenic
1050898243 9:10910965-10910987 CGGCACTCGCGGGCTGGCACCGG + Intergenic
1051546998 9:18288035-18288057 CTGAGCCTGAGCGGTGGCACTGG + Intergenic
1057024664 9:91725800-91725822 CGGGGCTTGCACGGAGGCCCAGG - Intronic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic
1186496555 X:10015918-10015940 CAGCGCATCCGCGGTGGCGCCGG - Intronic
1196663688 X:118294633-118294655 CGGCACTTGCAGGCTGGCACGGG - Intergenic
1201416493 Y:13752927-13752949 CGGGGCCTGCGCGGAGGCTCTGG + Intergenic