ID: 1163681423

View in Genome Browser
Species Human (GRCh38)
Location 19:18684486-18684508
Sequence ATTCCCTCAGCTGTCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163681423_1163681427 -1 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681427 19:18684508-18684530 TGGTCAGATCCTGTCCCCCAGGG No data
1163681423_1163681428 0 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681428 19:18684509-18684531 GGTCAGATCCTGTCCCCCAGGGG No data
1163681423_1163681429 1 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681429 19:18684510-18684532 GTCAGATCCTGTCCCCCAGGGGG No data
1163681423_1163681434 12 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681434 19:18684521-18684543 TCCCCCAGGGGGTCCAGAGGGGG No data
1163681423_1163681426 -2 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681426 19:18684507-18684529 ATGGTCAGATCCTGTCCCCCAGG No data
1163681423_1163681436 13 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681436 19:18684522-18684544 CCCCCAGGGGGTCCAGAGGGGGG No data
1163681423_1163681433 11 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681433 19:18684520-18684542 GTCCCCCAGGGGGTCCAGAGGGG No data
1163681423_1163681431 9 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681431 19:18684518-18684540 CTGTCCCCCAGGGGGTCCAGAGG No data
1163681423_1163681432 10 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681432 19:18684519-18684541 TGTCCCCCAGGGGGTCCAGAGGG No data
1163681423_1163681440 22 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681440 19:18684531-18684553 GGTCCAGAGGGGGGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163681423 Original CRISPR ATTCCCTCAGCTGTCCAAGA GGG (reversed) Intronic