ID: 1163681430

View in Genome Browser
Species Human (GRCh38)
Location 19:18684517-18684539
Sequence CTCTGGACCCCCTGGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163681430_1163681444 18 Left 1163681430 19:18684517-18684539 CCTGTCCCCCAGGGGGTCCAGAG No data
Right 1163681444 19:18684558-18684580 TTGTGCTCAGTCCTGGAACTTGG No data
1163681430_1163681443 11 Left 1163681430 19:18684517-18684539 CCTGTCCCCCAGGGGGTCCAGAG No data
Right 1163681443 19:18684551-18684573 AGGCAGATTGTGCTCAGTCCTGG No data
1163681430_1163681445 23 Left 1163681430 19:18684517-18684539 CCTGTCCCCCAGGGGGTCCAGAG No data
Right 1163681445 19:18684563-18684585 CTCAGTCCTGGAACTTGGAGTGG No data
1163681430_1163681440 -9 Left 1163681430 19:18684517-18684539 CCTGTCCCCCAGGGGGTCCAGAG No data
Right 1163681440 19:18684531-18684553 GGTCCAGAGGGGGGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163681430 Original CRISPR CTCTGGACCCCCTGGGGGAC AGG (reversed) Intronic