ID: 1163681432 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:18684519-18684541 |
Sequence | TGTCCCCCAGGGGGTCCAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1163681423_1163681432 | 10 | Left | 1163681423 | 19:18684486-18684508 | CCCTCTTGGACAGCTGAGGGAAT | No data | ||
Right | 1163681432 | 19:18684519-18684541 | TGTCCCCCAGGGGGTCCAGAGGG | No data | ||||
1163681424_1163681432 | 9 | Left | 1163681424 | 19:18684487-18684509 | CCTCTTGGACAGCTGAGGGAATG | No data | ||
Right | 1163681432 | 19:18684519-18684541 | TGTCCCCCAGGGGGTCCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1163681432 | Original CRISPR | TGTCCCCCAGGGGGTCCAGA GGG | Intronic | ||