ID: 1163681436

View in Genome Browser
Species Human (GRCh38)
Location 19:18684522-18684544
Sequence CCCCCAGGGGGTCCAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163681423_1163681436 13 Left 1163681423 19:18684486-18684508 CCCTCTTGGACAGCTGAGGGAAT No data
Right 1163681436 19:18684522-18684544 CCCCCAGGGGGTCCAGAGGGGGG No data
1163681424_1163681436 12 Left 1163681424 19:18684487-18684509 CCTCTTGGACAGCTGAGGGAATG No data
Right 1163681436 19:18684522-18684544 CCCCCAGGGGGTCCAGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163681436 Original CRISPR CCCCCAGGGGGTCCAGAGGG GGG Intronic