ID: 1163683509

View in Genome Browser
Species Human (GRCh38)
Location 19:18697086-18697108
Sequence CTGGACCCCCATCCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163683509_1163683513 11 Left 1163683509 19:18697086-18697108 CCAGCAGCTGGATGGGGGTCCAG 0: 1
1: 1
2: 2
3: 16
4: 213
Right 1163683513 19:18697120-18697142 AGGAAGTGCCGCGTGCCTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 43
1163683509_1163683516 18 Left 1163683509 19:18697086-18697108 CCAGCAGCTGGATGGGGGTCCAG 0: 1
1: 1
2: 2
3: 16
4: 213
Right 1163683516 19:18697127-18697149 GCCGCGTGCCTCGAGGGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 83
1163683509_1163683515 17 Left 1163683509 19:18697086-18697108 CCAGCAGCTGGATGGGGGTCCAG 0: 1
1: 1
2: 2
3: 16
4: 213
Right 1163683515 19:18697126-18697148 TGCCGCGTGCCTCGAGGGCCAGG 0: 1
1: 0
2: 2
3: 1
4: 90
1163683509_1163683511 -9 Left 1163683509 19:18697086-18697108 CCAGCAGCTGGATGGGGGTCCAG 0: 1
1: 1
2: 2
3: 16
4: 213
Right 1163683511 19:18697100-18697122 GGGGTCCAGGTGTGTAAATAAGG 0: 1
1: 0
2: 0
3: 22
4: 253
1163683509_1163683514 12 Left 1163683509 19:18697086-18697108 CCAGCAGCTGGATGGGGGTCCAG 0: 1
1: 1
2: 2
3: 16
4: 213
Right 1163683514 19:18697121-18697143 GGAAGTGCCGCGTGCCTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163683509 Original CRISPR CTGGACCCCCATCCAGCTGC TGG (reversed) Intronic
900564966 1:3327734-3327756 CTTGGCCCCCACCCACCTGCAGG + Intronic
900620068 1:3582672-3582694 TTAGACCCCCATCCAGCTCCTGG + Intronic
901586961 1:10303900-10303922 CTGGATCCCCATTCATCAGCTGG - Intronic
903586163 1:24416778-24416800 CCGGACTCCCACCCAGCTGAGGG + Intronic
906614837 1:47226812-47226834 CTGGACTCCCATCCAAGAGCAGG + Intronic
911040587 1:93588149-93588171 CTGGACCCCAAAACTGCTGCTGG + Intronic
911084964 1:93968629-93968651 GTGGACCCCCATATAGCTTCAGG - Intergenic
912451655 1:109770949-109770971 CTGGGCCCCCTTCCAGGAGCTGG + Intronic
918078751 1:181190123-181190145 CCGGACCCCCAGCCCGCAGCGGG + Intergenic
919762960 1:201110019-201110041 CTGCATCCCCAGCCACCTGCAGG - Intronic
920077564 1:203348243-203348265 GTGGACCTCCCTCCTGCTGCTGG - Exonic
920271472 1:204768029-204768051 CTGGACCCCAAGGCAGCTGAAGG - Intergenic
922804406 1:228378087-228378109 CTGCACCCCCGTCCACCTGAGGG + Intronic
922901188 1:229137960-229137982 CTGGCCCCCCATGCAACTACAGG - Intergenic
923692339 1:236206906-236206928 CAGGACCCCCATCCTGTTCCTGG + Intronic
1062957544 10:1550151-1550173 CTGGAACCCCTCCCCGCTGCAGG + Intronic
1062959423 10:1561638-1561660 CTGGTCCCCCATGCAGCTGCTGG + Intronic
1063196350 10:3747262-3747284 CTGGAGCGCCATAAAGCTGCTGG + Intergenic
1067055095 10:43045465-43045487 CTTGACCCCCACACAGATGCAGG - Intergenic
1067706267 10:48608479-48608501 CTGGTCCTCCATGCAGCTTCTGG - Intronic
1067761186 10:49048320-49048342 CTGGACCCCCACCTAGATTCTGG - Intronic
1070327836 10:75399783-75399805 CCGGGCCCCCATCCGGATGCTGG + Exonic
1071312213 10:84353555-84353577 CTGCAGCCCCATTCAGCTGCAGG + Intronic
1072608243 10:97001021-97001043 CTGCACCCCAGCCCAGCTGCTGG + Exonic
1072710897 10:97714853-97714875 CTGGCCCCTCATCCAGCCTCCGG + Exonic
1074127741 10:110543149-110543171 CTGGGGCATCATCCAGCTGCTGG + Intergenic
1074529135 10:114285038-114285060 TTGCACGCCCTTCCAGCTGCTGG + Intronic
1076082997 10:127600360-127600382 CTGGACCTGCATCAAGGTGCTGG - Intergenic
1076257854 10:129042587-129042609 GAGGCCCCCCATTCAGCTGCTGG + Intergenic
1076822460 10:132946282-132946304 CAGGCCCCCCTCCCAGCTGCCGG - Intergenic
1078927374 11:15886834-15886856 CTGGACCACCAGCCTGATGCAGG - Intergenic
1080406542 11:31985057-31985079 CTGGATCCACCTCCAGCTGGTGG - Intronic
1081656379 11:44860339-44860361 CTGGACCACCCTCAAGCTTCAGG + Exonic
1081774375 11:45667297-45667319 CTCCACCCCCATCAAGCTGGAGG + Intergenic
1082078241 11:47991537-47991559 CTGGCCCCTCAGCCAGCAGCAGG - Intronic
1083310941 11:61783526-61783548 CCTGACCTCCATCCAGGTGCTGG + Exonic
1084342447 11:68515104-68515126 CTGGGCCCCCAGCCTGTTGCTGG - Intronic
1084356738 11:68643962-68643984 CTGGGCCCCCAGCCTGGTGCTGG - Intergenic
1085726783 11:78961561-78961583 CTGAAGCCCCAGCCAGCTGCAGG - Intronic
1087205857 11:95392904-95392926 CTGGGCCACCATCCAGTGGCTGG + Intergenic
1088812293 11:113399946-113399968 CTGGACACCCCTCCACCTGGCGG + Exonic
1089001435 11:115055337-115055359 CTGGGCCCCCAGCCAGTGGCTGG + Intergenic
1089014746 11:115156769-115156791 CTGGACCCCCTTCCAGACACCGG - Intergenic
1089332810 11:117701689-117701711 CAGGACCTCAATCCTGCTGCTGG + Intronic
1089863462 11:121611178-121611200 ATAAAGCCCCATCCAGCTGCTGG - Intronic
1089959676 11:122604746-122604768 CTGAACCCCCAGCCCACTGCCGG - Intergenic
1090802001 11:130178852-130178874 CTGCAGACCCAGCCAGCTGCTGG - Intronic
1102009458 12:109609269-109609291 CTTGAGCCCCATCTACCTGCTGG - Intergenic
1105681764 13:22735810-22735832 CTGAACCCACACCCCGCTGCGGG - Intergenic
1105844028 13:24279505-24279527 CTGGGTTCCCATCCAGCTTCGGG - Intronic
1107092716 13:36499692-36499714 CTGGACAACCCTCCATCTGCAGG + Intergenic
1114493425 14:23117414-23117436 GCGGACCCCCATCCTGCTGGGGG - Exonic
1114586172 14:23816033-23816055 CTGTACTCCCACCCAGCTACTGG - Intergenic
1116950703 14:50876000-50876022 CTGTGCCTCCTTCCAGCTGCTGG - Intronic
1122007292 14:98716044-98716066 CTGGGCCCCCAGCCTGTTGCAGG - Intronic
1122050940 14:99059268-99059290 CTGGATTCCCTACCAGCTGCAGG - Intergenic
1122254568 14:100467418-100467440 CAGGACTCCCACCCGGCTGCAGG + Intronic
1122343684 14:101045107-101045129 CTGGACCCGAAGCCAGCTTCAGG + Intergenic
1123757909 15:23411334-23411356 CTGGACACATATCCAGCTCCTGG - Intergenic
1124853497 15:33363791-33363813 CAGGACCCACATGCAGCTGGTGG - Intronic
1127915579 15:63452291-63452313 CTGGACCCCTCTCCTGCTACCGG + Intergenic
1128235227 15:66062467-66062489 CTGGGGCCCCATCCTCCTGCAGG - Intronic
1128808897 15:70555694-70555716 CTGGCCACCCTGCCAGCTGCTGG + Intergenic
1128889317 15:71316724-71316746 CTGGGCCCCCAACAAGCAGCAGG + Intronic
1129287983 15:74541170-74541192 CTGGACCGCCAGCCAGGGGCGGG - Exonic
1130315109 15:82788600-82788622 CTGTCCCCTTATCCAGCTGCGGG - Intronic
1132223529 15:100123392-100123414 CTGGACCCACCTTCAGCTCCTGG - Intronic
1132342934 15:101089515-101089537 CTGGACCCGCGGCCAGGTGCAGG + Intergenic
1132710709 16:1265904-1265926 CTGGTCCCCCACCCAGCTGCCGG + Intergenic
1132793477 16:1706693-1706715 CCGGACCCCCAGCCAGCCCCGGG + Intronic
1138124616 16:54428601-54428623 CAGGACATCCCTCCAGCTGCTGG - Intergenic
1138599633 16:58046934-58046956 CTGCACGCCCTTCCAGCTGGAGG - Intergenic
1139908045 16:70380281-70380303 CTGTTCCCTCAGCCAGCTGCAGG + Exonic
1140261360 16:73383258-73383280 CTGGCCACCCATCCAGCAGCAGG + Intergenic
1142118945 16:88376544-88376566 CGGGAACCCCAGCCAGCGGCTGG - Intergenic
1142343341 16:89538123-89538145 CTGCATCCCCATCCCGCTCCCGG - Intronic
1142387437 16:89774775-89774797 CTAGATCCCCTTCCACCTGCAGG - Intronic
1142904829 17:3034571-3034593 CTGTTCCCCTCTCCAGCTGCGGG + Exonic
1143305728 17:5945230-5945252 CTGTGCCCCCAGCCACCTGCTGG + Intronic
1143539026 17:7558641-7558663 TTGGCCCCCCATCCTGCTCCTGG + Exonic
1143742855 17:8966540-8966562 CTTGACCCGCATCCTTCTGCAGG + Intergenic
1144578319 17:16443707-16443729 CTGGGCCCTCACCCAGCTCCAGG + Exonic
1145005939 17:19337846-19337868 CTCGGCCCCCATCCAGATGTGGG + Intronic
1145101628 17:20081920-20081942 CTGAACGGCCAGCCAGCTGCAGG - Intronic
1148747996 17:49929117-49929139 CTTGAGACCCACCCAGCTGCAGG - Intergenic
1151988838 17:77561163-77561185 ATGAACACCCAACCAGCTGCCGG + Intergenic
1151988900 17:77561534-77561556 ATGGACACCCAACCACCTGCCGG + Intergenic
1151988951 17:77561852-77561874 ATGGACACCCAACCACCTGCCGG + Intergenic
1151989009 17:77562223-77562245 ATGGACACCCAACCACCTGCCGG + Intergenic
1151989071 17:77562594-77562616 ATGGACACCCAACCTGCTGCTGG + Intergenic
1151989095 17:77562753-77562775 ATGGACACCCAACCACCTGCCGG + Intergenic
1151989111 17:77562869-77562891 ATGGACACCCAACCAGCTGCTGG + Intergenic
1152363089 17:79841325-79841347 CTGTACACCCACCCAGCTTCTGG - Intergenic
1152610711 17:81313890-81313912 CCGGCCCCCCACCCTGCTGCAGG - Exonic
1152639136 17:81442447-81442469 CAGGGCCCCCGTGCAGCTGCAGG - Exonic
1152940795 17:83172165-83172187 CTGGCCCCCCATCCAACTCCAGG - Intergenic
1156492922 18:37506901-37506923 CCTGACCCCCTTCCAGCTCCCGG - Intronic
1157281046 18:46346561-46346583 CTTGACCACCTACCAGCTGCGGG + Intronic
1160050828 18:75431615-75431637 CTGGACCCTCATGCTGCTGGAGG + Intergenic
1160358167 18:78246330-78246352 CTGGACCCTGAGCCAGCTGGAGG + Intergenic
1160376357 18:78415621-78415643 CTGTATCCTCATCCAACTGCAGG - Intergenic
1160578423 18:79870029-79870051 CTGGGCCCCCAGCCACCTGGGGG + Intronic
1160780563 19:876208-876230 CTGGTCCCACGTGCAGCTGCCGG + Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160875591 19:1295027-1295049 CTGGACACCCACCTCGCTGCTGG + Intronic
1160906406 19:1453570-1453592 CCGGGCCACCATCCGGCTGCTGG + Exonic
1161200605 19:3012712-3012734 CTGGACCTCCATCTAGGGGCAGG + Intronic
1161235079 19:3193639-3193661 CTGTCCCCCCTCCCAGCTGCTGG + Intronic
1162917477 19:13882116-13882138 CTGGGCGATCATCCAGCTGCAGG - Intergenic
1163186035 19:15640409-15640431 CTTGAACTCCATCCAGCAGCAGG + Intronic
1163634918 19:18433360-18433382 CTGGATCCCCCTCCAGCTCGGGG - Intronic
1163683509 19:18697086-18697108 CTGGACCCCCATCCAGCTGCTGG - Intronic
1164783970 19:30914680-30914702 CTGGACCTCCATCCTGCCGAAGG + Intergenic
1165324209 19:35104744-35104766 CTGGGCCCCCATTAAGCTGTTGG - Intergenic
1165438920 19:35812749-35812771 CTGGTCCCCCCTCCAGGGGCTGG - Exonic
1165831133 19:38730991-38731013 CCTCACCCCCATCCAGGTGCTGG + Exonic
1166500727 19:43339178-43339200 CTGGAGTCCCTTCCAACTGCTGG - Intergenic
1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG + Intergenic
1167070877 19:47221448-47221470 CTGGTGCCCGTTCCAGCTGCAGG - Exonic
1167649384 19:50721143-50721165 CTGGGTTCCCCTCCAGCTGCAGG + Intergenic
927948091 2:27149366-27149388 CTGGACCCCTCTGCAGGTGCAGG - Intronic
931639894 2:64372723-64372745 CTGTACCCCCACCCAGCAGTTGG + Intergenic
933742515 2:85546033-85546055 CTGGACCACCATTCAGATGTTGG - Exonic
936096386 2:109533258-109533280 CTGTTCCTCCATCCAGCAGCAGG - Intergenic
937870767 2:126784516-126784538 CTGGACCCCCAGACAGCCGTTGG - Intergenic
942664844 2:178306545-178306567 CTGGCTCCCCCTCCAGGTGCAGG - Intronic
944539745 2:200743915-200743937 CTGGACACCCGTCCATGTGCTGG - Intergenic
946689850 2:222301744-222301766 CTGGACTCCCATCCAGCTGCGGG - Intronic
948804945 2:240449633-240449655 CGTCACCCCCATCCAGCTCCAGG + Exonic
1169741671 20:8901642-8901664 CTGGCTCCCCATGGAGCTGCTGG + Intronic
1174274045 20:49390654-49390676 TGTGACCTCCATCCAGCTGCAGG - Intronic
1175608315 20:60329618-60329640 CTGGTCACCCACCCATCTGCTGG - Intergenic
1175872867 20:62216632-62216654 CTCGAGCCCCATCCAGCCGGAGG + Exonic
1176422579 21:6527942-6527964 CTGGACCCCCACCAAGTTCCGGG - Intergenic
1176685783 21:9847456-9847478 CTGGACCACCATTCAGCCACTGG - Intergenic
1179425685 21:41276393-41276415 CTGCACCCCCATCCAGGCACAGG - Exonic
1179568672 21:42265046-42265068 CTGGCCCCCCATCCCCATGCAGG + Intronic
1179698072 21:43136258-43136280 CTGGACCCCCACCAAGTTCCGGG - Intergenic
1180048307 21:45319852-45319874 GTGGCCCCACGTCCAGCTGCAGG - Intergenic
1180787460 22:18554792-18554814 CTGGCCCTCCCTCCAGCTGCTGG - Intergenic
1180856909 22:19053172-19053194 CTGGACCCAACTCCAGCTGCAGG + Intronic
1181041583 22:20195017-20195039 CAGGACCCCCCTCCCCCTGCAGG + Intergenic
1181234280 22:21440513-21440535 CTGGCCCTCCCTCCAGCTGCTGG + Intronic
1181244368 22:21494318-21494340 CTGGCCCTCCCTCCAGCTGCTGG - Intergenic
1181830305 22:25555208-25555230 CTGGACCCACAACCAACTGTGGG + Intergenic
1183164059 22:36134197-36134219 CTGGAATCCCAGCCTGCTGCTGG - Intergenic
1184113072 22:42406501-42406523 ATGGGCCCCCATGCAGCTCCTGG + Intronic
1184402348 22:44281334-44281356 CTGGACCTCCGTCCTCCTGCTGG - Intronic
1184648279 22:45907932-45907954 CTGGACCCAGCCCCAGCTGCTGG + Intergenic
1185026616 22:48417741-48417763 CTGGGCCCACCTCCAGCTGCCGG - Intergenic
952855675 3:37768965-37768987 TTGGAACCCCAGCCAGCTGATGG + Intronic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
954405313 3:50342134-50342156 CTGGACACCCTTGCAGCTTCGGG - Exonic
954687303 3:52377824-52377846 CCGGACCCCTCTCCTGCTGCAGG + Intronic
956311729 3:67888368-67888390 CTGGACACCCACCCAGCAGCGGG + Intergenic
956990086 3:74752270-74752292 CTGGGCCCCTGTGCAGCTGCAGG - Intergenic
957737710 3:84224520-84224542 CTGGGCCCCAAGCCTGCTGCTGG + Intergenic
960697058 3:120406552-120406574 CTGGACCTTCCCCCAGCTGCAGG - Intronic
960998814 3:123358633-123358655 CTCGGACCCCATCCATCTGCAGG - Intronic
961191984 3:124969677-124969699 CTCTAACCACATCCAGCTGCAGG + Exonic
961426266 3:126850986-126851008 CTGGATCCCCAGGCAGCTGCAGG - Intronic
961781306 3:129322010-129322032 CTGGCCACCGAGCCAGCTGCAGG + Intergenic
966890065 3:184400772-184400794 CCTGAGCCCCATCCAGCTGATGG + Intronic
967887450 3:194342657-194342679 CTGGACCTCCCTCCTGCTCCTGG - Exonic
968481215 4:833866-833888 CGGGGGCCCCATCCAGCTCCTGG - Intergenic
969499014 4:7541957-7541979 CTGGCCCCCCAGCCATGTGCAGG + Intronic
972184441 4:36511777-36511799 CTGGCCCCCCACCCCGCTACAGG - Intergenic
983285237 4:165731085-165731107 CTGGCCCCCCATCCACCAACAGG - Intergenic
985680455 5:1253239-1253261 AGGGACCCCCATCCAGGTGCAGG + Exonic
986568215 5:9136603-9136625 CTGGGCCCCAATGCAGGTGCTGG + Exonic
986946764 5:13030194-13030216 ATGGTCCCCCATTGAGCTGCAGG - Intergenic
987369449 5:17179892-17179914 GTTTACCCTCATCCAGCTGCGGG + Intronic
988281909 5:29159991-29160013 CTTGCCCCTCATCCAGATGCAGG + Intergenic
990585537 5:57207703-57207725 CTGGCTTCCCATCCATCTGCTGG - Intronic
990736963 5:58875128-58875150 CCTGACCCCCAACCAGCAGCAGG + Intergenic
990926882 5:61036183-61036205 CTTGACCCCCACCTAACTGCAGG + Intronic
994036052 5:95202134-95202156 CTGAGCCCCGAGCCAGCTGCAGG - Intronic
997606977 5:135182292-135182314 GTGGTCCCACAGCCAGCTGCTGG + Intronic
999270588 5:150294464-150294486 CTGGCCCTCCATCCAGGTGTGGG + Intergenic
1000045920 5:157521887-157521909 CTTGACCACCAACCAGCTGATGG + Intronic
1000470197 5:161631068-161631090 CTGGCCCCCCATCCATCTCACGG - Intronic
1002618203 5:180468432-180468454 CTGCACTTCCATCCAGCTCCGGG + Intergenic
1007304401 6:40892787-40892809 CTGGACCCCCATCCTGAGGATGG - Intergenic
1011193661 6:84762440-84762462 CAGAACCCCCACCGAGCTGCAGG + Intronic
1012433336 6:99189031-99189053 CTGAACCCCCATCAAGCTCAAGG - Intergenic
1013899802 6:115141443-115141465 CTGATACCCCATCCACCTGCCGG - Intergenic
1015182625 6:130377455-130377477 CAGGAGACCCATCTAGCTGCAGG + Intronic
1016891745 6:149014419-149014441 CTGGAACCTCATCCATCAGCTGG - Intronic
1016936533 6:149452319-149452341 CTGGACACAAACCCAGCTGCGGG - Intronic
1018542216 6:164894527-164894549 CTAGACCCCCACCCTGCTACAGG - Intergenic
1018732218 6:166659786-166659808 CTGGTCCCCCATCCCGCAGTCGG - Intronic
1018929545 6:168231748-168231770 CTGCACCACCACCCACCTGCAGG - Intergenic
1019172338 6:170139739-170139761 CTGCACCCTCTTCCAGCTCCAGG + Intergenic
1019518086 7:1448362-1448384 CGGGGCCCTCATCCTGCTGCAGG - Intronic
1019572707 7:1720374-1720396 CAGGAGGCCCATACAGCTGCGGG + Intronic
1019998014 7:4737657-4737679 CTGGACCCTCAGCCAGATGCTGG + Intronic
1020556353 7:9674706-9674728 CTATACCCCCTTCCAGCTGGTGG + Intergenic
1024570598 7:50719960-50719982 CTGCCCCCCACTCCAGCTGCTGG + Intronic
1025208889 7:57009530-57009552 CCGGGCCCCCATGCAGCAGCAGG - Intergenic
1025663062 7:63567326-63567348 CCGGGCCCCCATGCAGCAGCAGG + Intergenic
1031457259 7:121997194-121997216 CTGGACCTACATCCAGATGAAGG - Intronic
1032187944 7:129743802-129743824 CTGCCCCCCGACCCAGCTGCTGG + Intronic
1033214397 7:139483267-139483289 CTGGGCGCCCATGGAGCTGCAGG - Exonic
1034461474 7:151200082-151200104 CTGCAGCCCCTTCCAGCTGGGGG + Intronic
1038381179 8:27095846-27095868 CAGGACCCCCATCTCTCTGCAGG + Intergenic
1039884150 8:41645953-41645975 TTGGGCCCCAAGCCAGCTGCTGG - Exonic
1043155528 8:76774067-76774089 CTGGACCCCCATCCAAGTTCTGG + Intronic
1043833903 8:85022935-85022957 CTGCAGCCCGATCCAGCTGAAGG - Intergenic
1047232436 8:123008936-123008958 CTGGTCCCCCATCCATGTGAGGG + Intergenic
1053869761 9:42478829-42478851 CTGGCCCGCCATGCAGCAGCTGG - Intergenic
1056457942 9:86781436-86781458 CTGAGGCCCCATCCACCTGCAGG - Intergenic
1056810088 9:89757392-89757414 CTGGTCACCAATCCAGCTTCAGG + Intergenic
1060550975 9:124485315-124485337 CTGGACGCCCCCGCAGCTGCAGG - Intronic
1060812738 9:126619178-126619200 CTGGAGCCACAGCCAGCTGGGGG - Intronic
1061014498 9:127974068-127974090 CTGTGCCCCCATCCATCTCCCGG + Intronic
1061140732 9:128764664-128764686 CCTGAGACCCATCCAGCTGCGGG + Intronic
1061195034 9:129102888-129102910 CTGGGCCCTGCTCCAGCTGCTGG - Intronic
1062138320 9:134941569-134941591 GTGGACCCCACCCCAGCTGCAGG + Intergenic
1062445187 9:136590724-136590746 CTGGCCGCCCCTCCAGTTGCGGG - Intergenic
1062556293 9:137114677-137114699 CTGGGCCCCGGTCCTGCTGCTGG - Exonic
1062592112 9:137278821-137278843 CGGGCCCCCCACCCGGCTGCAGG - Exonic
1062595762 9:137298478-137298500 CTGGGACCCCACCCACCTGCAGG + Intergenic
1203745509 Un_GL000218v1:38858-38880 CTACACCCCCATCCTGCAGCTGG - Intergenic
1190950614 X:55139685-55139707 CTGGACTTCCATGCACCTGCAGG - Intronic
1191845061 X:65540968-65540990 CTGGACCCCCACCTACCAGCTGG + Intergenic
1196718042 X:118828409-118828431 CTGGAGCCACGTACAGCTGCTGG + Intergenic
1199934773 X:152562031-152562053 CTAGCCCCCCATCCCGCTACAGG - Intergenic
1199988325 X:152968588-152968610 GTGGCCCACCATCCTGCTGCTGG - Intronic
1200124571 X:153807237-153807259 CAGGGCCCGCAGCCAGCTGCGGG - Intronic
1200253186 X:154564583-154564605 CTGGAGCCCCACCCAGGAGCTGG + Exonic
1200264581 X:154639832-154639854 CTGGAGCCCCACCCAGGAGCTGG - Intergenic
1201060932 Y:10046255-10046277 CTGGGTCCCCATCTATCTGCTGG - Intergenic
1201226866 Y:11826998-11827020 CAGGACCCACCTCCAGATGCAGG - Intergenic