ID: 1163688106

View in Genome Browser
Species Human (GRCh38)
Location 19:18723771-18723793
Sequence CAGTTGCCCTGCAGGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163688096_1163688106 25 Left 1163688096 19:18723723-18723745 CCTTAGCTATGTGTTTCGATGTG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG 0: 1
1: 0
2: 1
3: 15
4: 261
1163688103_1163688106 -7 Left 1163688103 19:18723755-18723777 CCTGTGGGCAACAGGGCAGTTGC 0: 1
1: 1
2: 0
3: 17
4: 132
Right 1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG 0: 1
1: 0
2: 1
3: 15
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163688106 Original CRISPR CAGTTGCCCTGCAGGGACAC TGG Intronic
900396316 1:2454596-2454618 CAGAGGCCCTGCAGGGTCCCAGG - Intronic
900505243 1:3027126-3027148 GACTGGCCCTGCAGTGACACTGG + Intergenic
900725057 1:4210861-4210883 AAGCTGACCTCCAGGGACACAGG + Intergenic
900861050 1:5231663-5231685 CAGTGGCACTGCAGAGACAGTGG + Intergenic
902455221 1:16529013-16529035 CTGTTTCCCTGCAAGGAAACAGG - Intergenic
902473913 1:16670331-16670353 CTGTTTCCCTGCAAGGAAACAGG - Intergenic
902484890 1:16737111-16737133 CTGTTTCCCTGCAAGGAAACAGG + Intergenic
902496950 1:16878874-16878896 CTGTTTCCCTGCAAGGAAACAGG + Intronic
903267153 1:22164432-22164454 CAGAGGCGCTGCAGGGAGACTGG - Intergenic
903365031 1:22801040-22801062 CAGCAGCCCTGCAGGGGTACAGG + Intronic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
905936507 1:41828226-41828248 CTGCTGTCCAGCAGGGACACTGG - Intronic
906071629 1:43021139-43021161 CTGTTGCCCTGGAGGAGCACAGG - Intergenic
906515847 1:46438426-46438448 CAGTTTCCCTCCTGGGACTCAGG - Intergenic
910354735 1:86341709-86341731 CAGGGGCCCTGCAGGCCCACAGG + Intergenic
911288941 1:96031522-96031544 TAGTTGCCTTGCAAGGTCACAGG + Intergenic
915030115 1:152871880-152871902 CAGTTCACCTGGTGGGACACAGG + Intergenic
919145151 1:193625004-193625026 CAGGTGCCCTGCAGGATTACAGG + Intergenic
920527153 1:206675470-206675492 AAGCTGCCCTGAAGGGGCACTGG + Intronic
924227245 1:241932258-241932280 AAGTTTACCTGCAGGGACAGGGG + Intergenic
924578206 1:245299984-245300006 CAGTTTCCCTGCTGGAACAATGG - Intronic
924795295 1:247288443-247288465 CAGGGGCCCTGCAGGCTCACGGG + Intergenic
1063064202 10:2591903-2591925 AAGGTGCACTGCAGGGACAGAGG + Intergenic
1063412148 10:5844760-5844782 CATTTGCCCTACGGCGACACAGG + Intergenic
1067107628 10:43376436-43376458 CAGTTGGGCGGCAGGGACTCAGG - Intergenic
1068542178 10:58307247-58307269 AAGTTGTCATGGAGGGACACTGG + Intergenic
1068627440 10:59264465-59264487 CAGTTTGACTGCAGGGGCACTGG - Intronic
1069889979 10:71646625-71646647 CAGTGGCCCTGCAGTGAAGCGGG - Intronic
1071485562 10:86099865-86099887 CAGTTGCAATGCAGGGCCTCTGG - Intronic
1071988370 10:91075304-91075326 ATGTGGTCCTGCAGGGACACAGG - Intergenic
1073027671 10:100500008-100500030 CAGATTCCTTGCAGGGACTCCGG + Intronic
1073430233 10:103481053-103481075 CTGTTGCCCTGCAGGGCTCCAGG - Intergenic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1075997965 10:126893465-126893487 CAGATGCGCTGCAGGGAAAAGGG - Intergenic
1076243835 10:128931013-128931035 CTGGAGCCCTGCAGGGACACAGG - Intergenic
1076701893 10:132277565-132277587 CCGATTCCCTGCAGGGCCACGGG - Intronic
1076786438 10:132752137-132752159 CAGGTGCCCAGGAGGGAGACAGG + Intronic
1076873005 10:133202724-133202746 CACCTGCCCTGAAGGGACACCGG - Intronic
1076885202 10:133258952-133258974 CCTATGCACTGCAGGGACACTGG + Intergenic
1077197595 11:1289065-1289087 CAGTTCCACTTCAGGGACACTGG + Intronic
1077406152 11:2383392-2383414 GGGTTGGCCTGCAGGGACCCAGG + Intronic
1077501233 11:2910607-2910629 GAGCTCCCCTGCAGGGAGACCGG + Intronic
1078003893 11:7518065-7518087 CAGGGGCCCTGCAGGCCCACGGG - Intronic
1078547411 11:12256332-12256354 CTGTTCCCCTGCAGTGGCACAGG - Intronic
1084063084 11:66688207-66688229 CAGGTCCCCTGGAGGCACACTGG + Exonic
1084676718 11:70639750-70639772 AAGGTGCCCTGCAGGCCCACAGG + Intronic
1084944106 11:72629634-72629656 CAGGTTCCCTGCTGGGACACAGG - Intronic
1085755844 11:79200580-79200602 CTGGTGCCCTTAAGGGACACGGG + Intronic
1086888086 11:92226083-92226105 CACTTGCCCTGCACACACACTGG - Intergenic
1088013658 11:105034220-105034242 CAGTTACCTGGCAGGGACGCTGG - Exonic
1088598275 11:111455742-111455764 GAACTGCCCTGCAGGGGCACAGG - Exonic
1088988142 11:114928093-114928115 CAGTTGCCCTGGAGGTTCCCAGG + Intergenic
1089069608 11:115689241-115689263 CTGTTGACCTGCTGGGGCACAGG - Intergenic
1089287703 11:117418276-117418298 CAGTGGCCCTACAGGGGGACGGG - Intergenic
1089310659 11:117556202-117556224 CAGTGACCCTGCAGGGAGATGGG + Intronic
1091620519 12:2084603-2084625 CTGTTCCCCAGAAGGGACACAGG + Intronic
1093267111 12:17016493-17016515 CCGTTGTTCTGCAGGCACACGGG - Intergenic
1094573403 12:31662049-31662071 CAGCTCCTCTCCAGGGACACTGG - Exonic
1095396530 12:41768517-41768539 GTGTTCCCCTGGAGGGACACAGG - Intergenic
1096192111 12:49626436-49626458 CATTTATCCTGAAGGGACACAGG + Intronic
1097578843 12:61428659-61428681 CAGTTGCCCTGCAAGTACCTTGG - Intergenic
1098569483 12:71972757-71972779 CAATTGCCTTCCAAGGACACAGG + Intronic
1099861480 12:88229657-88229679 CAGGGGCCCTGCAGGCCCACGGG + Intergenic
1099948761 12:89276326-89276348 CAGTTCACTTGCAGGGTCACAGG - Intergenic
1100662983 12:96720532-96720554 CAGTTGCTCTGCAGAGGCACCGG + Exonic
1101566051 12:105906568-105906590 CAGTTGGCCTACAGGCACACAGG - Intergenic
1104393222 12:128408870-128408892 CCTTTTCCCGGCAGGGACACTGG - Intronic
1105889641 13:24673396-24673418 CGCCTGCCCTGGAGGGACACTGG + Intergenic
1105951852 13:25236089-25236111 CAGTAACCCTGCAAGGACAGTGG - Intergenic
1110913597 13:80994226-80994248 CAGATCCCATGCAGAGACACTGG - Intergenic
1112088433 13:96054908-96054930 CCTTTGCCCTGCAGGGAAGCTGG + Intergenic
1114237321 14:20834368-20834390 CAGGGGCCCTGCAGGCCCACGGG - Intergenic
1114278711 14:21170286-21170308 CAGTTCCACTGCAGAGGCACTGG - Intergenic
1115722624 14:36179739-36179761 CAGTGGCCCCGCAGGTTCACAGG + Intergenic
1117375690 14:55116559-55116581 CAGTTGACTGGCAAGGACACAGG + Intergenic
1118941866 14:70346325-70346347 CAGGGGCCCTGCAGGCCCACGGG + Intronic
1119399006 14:74349274-74349296 CAGCTGGCCTCCAGGGCCACCGG + Intronic
1119853710 14:77884092-77884114 CAGTGCCCCTGCAATGACACTGG + Intronic
1122265183 14:100543401-100543423 CAGTTGCCCTCCACAGACCCTGG - Intronic
1122651839 14:103230684-103230706 CAGTTGTCCTCCTGGGACAGGGG - Intergenic
1122774346 14:104110652-104110674 CAGCAGCCCTGCAGTGGCACTGG - Intronic
1123072673 14:105649338-105649360 CAGTGGCACTCCAGGGCCACTGG + Intergenic
1123106949 14:105846130-105846152 CAGCTGCCCTGCAGGGGCCATGG + Intergenic
1124641809 15:31400600-31400622 GAGGTGCCCTGCAGGGAAATGGG + Intronic
1125140142 15:36396354-36396376 CTGTTGCCCTGAAAGAACACAGG - Intergenic
1126325109 15:47468381-47468403 CACTAGCTCTGCAGGGAAACAGG + Intronic
1127812015 15:62573021-62573043 GGGTTGGCCTGCAGGGGCACTGG - Intronic
1128090172 15:64913843-64913865 CACTTGCCCTGCAGTGACTATGG + Intronic
1128146788 15:65336457-65336479 TTGTTGCCCAGCAGGGACACTGG + Intronic
1129205364 15:74034348-74034370 CGGATGCCCTGCAGGGGGACGGG - Intronic
1129690321 15:77709688-77709710 CAGTGGGCCTGCAGCGCCACTGG - Intronic
1130988442 15:88860170-88860192 CAGGTGCCCAGGAGGGACAGAGG + Intronic
1131336455 15:91553751-91553773 CAGGTGCCCTGTGGGGACAGGGG + Intergenic
1131487239 15:92831595-92831617 GAGTTGGTCTGCAGGGACAGAGG - Intergenic
1131515788 15:93075720-93075742 CCGTCTCCCGGCAGGGACACTGG - Intronic
1131515790 15:93075721-93075743 CAGTGTCCCTGCCGGGAGACGGG + Intronic
1133815639 16:9195332-9195354 CTGCTGCCCGGCAGGGACCCAGG + Intergenic
1135073334 16:19371470-19371492 AATTTGCCCTGCAGTCACACAGG + Intergenic
1136545446 16:30951776-30951798 TAGTTGCCATGCAGGAACGCAGG + Intronic
1137286230 16:47017912-47017934 CAGTTGTCCAGCAGGGAGAGAGG - Intergenic
1138227079 16:55305119-55305141 CAGTTGTCGTGCAGGGATGCTGG + Intergenic
1139339263 16:66257342-66257364 TAGTTGCTCTGCTGGGACGCTGG + Intergenic
1140573467 16:76136197-76136219 CAGTGCCCCTGCAGGGGCACTGG - Intergenic
1141443295 16:84042889-84042911 CAGCTGCCCTGGAGGGTGACAGG + Intergenic
1141627934 16:85271248-85271270 CAGTTGCCCACCAGGGTGACTGG + Intergenic
1141633456 16:85301518-85301540 AAGCTGCCCTGCATGGGCACCGG + Intergenic
1142068173 16:88074563-88074585 CACTTGCCCTCCAAGGACAGTGG - Intronic
1142431974 16:90033883-90033905 CAGTTGACCGGCTGGGAGACGGG + Intronic
1142713786 17:1737259-1737281 CAGTTTCTCTCCAGGGAGACAGG - Intronic
1142967381 17:3590098-3590120 CAGTTCACCTGCATGAACACAGG + Exonic
1144653168 17:17019544-17019566 CAGGTGCCCTGCAGTGAAAATGG - Intergenic
1144695372 17:17300869-17300891 CAGTTGCCCTGCTGCGGCTCTGG + Intergenic
1148158470 17:45436724-45436746 AACTTGCCCAGCCGGGACACTGG - Exonic
1149772076 17:59330653-59330675 CAGTTTCCCAGCAGGAAAACAGG - Intergenic
1150535637 17:66036665-66036687 CAGTTGCCCTACTGGTAAACTGG + Intronic
1152427111 17:80224067-80224089 AAGATGACCTGCAGTGACACAGG - Intronic
1152475070 17:80512580-80512602 CCGTTGCCCTGCATAGAGACAGG + Intergenic
1154029982 18:10745155-10745177 GTCTTGCCCTGCAGGGACAGTGG + Intronic
1154052063 18:10970389-10970411 CCATTGCCCTGCATGCACACGGG + Intronic
1155077852 18:22377831-22377853 CAGTTGCCCTGAATGTTCACCGG - Intergenic
1155493555 18:26422112-26422134 CAGGGCCCCTGCAGGGACACGGG - Intergenic
1156269146 18:35515110-35515132 AAGTTCCCATGCAGGGTCACAGG + Intergenic
1157818497 18:50748530-50748552 CACTTGCACAGCAGGGACCCTGG - Intergenic
1157919231 18:51698359-51698381 CAGGGGCCCTGCAGGCCCACGGG + Intergenic
1161063552 19:2226953-2226975 AGGTTGGCCTGCAGGGACATGGG - Exonic
1162336983 19:10067848-10067870 CAGTTGTCCTCCCGGGACTCTGG - Intergenic
1163128582 19:15257942-15257964 CAGCAGCCATGCATGGACACTGG + Intronic
1163321014 19:16574793-16574815 CAGCTGCAATGCAGGGAGACAGG - Intronic
1163476706 19:17530740-17530762 CACCTGACCTGCAGGGACAAGGG - Exonic
1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG + Intronic
1164448130 19:28334982-28335004 CACCTGGCCTGCAGGGACAGAGG - Intergenic
1164481923 19:28618272-28618294 CATTTGGACTGCAGTGACACAGG + Intergenic
1165200059 19:34136223-34136245 CAGTTGACCAGCAAGGAGACAGG + Intergenic
1166020792 19:40027339-40027361 CAGTTACCCTGCTGTGACAATGG + Intergenic
1202706107 1_KI270713v1_random:25406-25428 CCGTTTCCCTGCAAGGAAACAGG - Intergenic
925905286 2:8536402-8536424 CAAGTGCCCTGCAGGGCCAGAGG - Intergenic
926370033 2:12170296-12170318 CAGTCCCACTGCAGGGACTCAGG + Intergenic
926951943 2:18252637-18252659 CATTTACCATTCAGGGACACAGG + Intronic
928130980 2:28649783-28649805 AAGTTGCCCTGCAGGCATCCTGG - Intergenic
930656072 2:54008380-54008402 CTCTTGTCCTGCAGGGACAGAGG + Intronic
931250504 2:60527095-60527117 CACTTGGCCTGAAGGGTCACCGG + Intronic
935065188 2:99641206-99641228 CAGTGTCACTGGAGGGACACAGG - Intronic
935280002 2:101508731-101508753 CAGGTGCCCTGAAGGGTCCCAGG - Intergenic
937975978 2:127582289-127582311 TAGATGCCCTGGAGAGACACGGG - Exonic
938937004 2:136136006-136136028 CAGATGGCCTGCAAGGCCACAGG - Intergenic
942932135 2:181507537-181507559 CATTTGCCCTGCAGTAACCCTGG + Intronic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
946549797 2:220788856-220788878 CAGTTGCCCTGGAGTCACAGGGG + Intergenic
947816573 2:233041415-233041437 CAGCTGCCCCACAGGGACATGGG + Intergenic
948807276 2:240458510-240458532 CAGTGGCCCTGCAGGACCCCAGG - Intronic
948899706 2:240950076-240950098 CAGGTGCACTGCAGAGACTCAGG + Intronic
1171882496 20:30628753-30628775 CAGTTCCACTGCAGAGACAGTGG + Intergenic
1172766189 20:37352322-37352344 CAGTTGGCCTGCAGAGGCCCAGG - Intronic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1176091998 20:63322303-63322325 CAGGCGCCCTGCAGGCACATGGG - Intronic
1178692460 21:34761116-34761138 CAGTGGCCTTGCAGGGACTATGG - Intergenic
1179787281 21:43737162-43737184 CAGACTCCCGGCAGGGACACGGG + Intronic
1180131572 21:45830162-45830184 CATTTGCCCTGCCTGGAGACTGG - Intronic
1182492272 22:30681144-30681166 CACTTGCTCTTCAGGGACAGTGG + Intergenic
1183065282 22:35358412-35358434 AAGTTGCCCTGCCTGGGCACTGG + Intergenic
1183265703 22:36823942-36823964 CATTTCCCCAGCAAGGACACTGG - Intergenic
1184333701 22:43841178-43841200 CAGGGGCCCTGGAGGGCCACAGG + Intronic
1184410047 22:44321157-44321179 CAGTTGCCATCCAGGTCCACAGG + Intergenic
1185189980 22:49429203-49429225 CAGCTCCCCTGCTGGGACACAGG + Intronic
1185246618 22:49776337-49776359 CAGGTGGGCTGCAGGGACAGTGG - Intronic
953743142 3:45554148-45554170 CAGATGCCCTGCAGGAAACCTGG + Intergenic
954288680 3:49637420-49637442 CATCTTCCCTGCAGGAACACTGG - Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
954809025 3:53236555-53236577 CAGAGACCCTGCAGGGACTCTGG + Intronic
955764882 3:62332473-62332495 CAGTTGCCCTCCTATGACACAGG + Intronic
957913970 3:86662115-86662137 CAGTCTCCCTGCAGGTACGCTGG + Intergenic
958097874 3:88971051-88971073 CAGTTGCTTTTCAGGAACACGGG - Intergenic
961064395 3:123862244-123862266 CAGATGAACTACAGGGACACAGG - Intronic
966868508 3:184275893-184275915 CAGCTGCCCTCCAGCAACACCGG - Intronic
967906384 3:194504407-194504429 ATTTTGCCCTGCAGGGACATCGG - Intergenic
967916566 3:194582813-194582835 CAGTAGCACGGCAGGGCCACTGG - Intergenic
968122092 3:196132856-196132878 CAGCTGCCCAGTAGAGACACAGG - Intergenic
968546421 4:1201141-1201163 CATTTGGCCTGCAGGGAATCTGG - Intronic
969227534 4:5808499-5808521 CACTTGCCCTCCAGGGGCTCAGG - Intronic
969238087 4:5880907-5880929 CAGGAGCCCTTCAGGAACACTGG - Intronic
969325921 4:6443783-6443805 CAGATGCTCTGCAAGGACTCCGG - Intronic
970564184 4:17315394-17315416 CAGATGCCATGCTGGGACACAGG + Intergenic
970635501 4:18005473-18005495 CAGTGTCCCAGCAGGGACTCTGG + Intronic
972944347 4:44236098-44236120 AGGTTGCCCAGCAGGGGCACCGG + Intronic
973052049 4:45609326-45609348 CAGGGGCCCTGCAGGCCCACAGG + Intergenic
973366165 4:49211196-49211218 CAGTTCCACTGCAGAGACAGTGG + Intergenic
973394432 4:49581240-49581262 CAGTTCCACTGCAGAGACAGTGG - Intergenic
977819855 4:101458742-101458764 CAGTTCCTCTGCAGAGGCACTGG - Intronic
978208245 4:106105071-106105093 CAGTTCCACTGCAGAGACAGTGG - Intronic
981133166 4:141181196-141181218 CACTTGCCCTTCAGGGGCACTGG - Intronic
982199348 4:152945023-152945045 CAGGTGCTCTGCTGAGACACAGG - Intronic
982352484 4:154430837-154430859 AAGTGGCTCTGCAGGGCCACAGG - Intronic
982629961 4:157819632-157819654 CTGTTGCCCTGCCAGCACACAGG + Intergenic
982646213 4:158027430-158027452 CAGTTCCACTGCAGAGACAGTGG - Intergenic
984868963 4:184310415-184310437 CAGCTGCCCTGCAGCCACCCTGG + Intergenic
985262830 4:188130546-188130568 CAGTTGCCCAGCTTGGACACTGG - Intergenic
985640226 5:1060162-1060184 CAGAGGCCCTGCAGGAGCACAGG - Intronic
985646323 5:1086297-1086319 CTGAAGCCCTGCAGGGACAGCGG + Intronic
986738145 5:10682596-10682618 CGCCTGCCCTGCAGGGACGCTGG - Intronic
991970964 5:72141239-72141261 CCTTTGCTCTGCAGAGACACTGG + Intronic
993731865 5:91432129-91432151 AAGATGTTCTGCAGGGACACTGG + Intergenic
998098765 5:139414462-139414484 CTGTTGGACTGCAGGGTCACAGG - Intronic
998936665 5:147236276-147236298 AATTTGTCTTGCAGGGACACAGG - Intronic
1000070547 5:157736602-157736624 CAGGTGCCCAGCAGGGAAAATGG - Intronic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1002168393 5:177361977-177361999 CAGGGGCCCTGCAGGGGCTCTGG - Intronic
1002924489 6:1597149-1597171 CATTTGCCCTGGAGGCTCACAGG + Intergenic
1003841960 6:10129825-10129847 CAGTTACCCTGCACTGACAGTGG - Intronic
1007479314 6:42139865-42139887 CAGTTACCCTGCAGGCAGCCTGG + Intronic
1013231134 6:108163446-108163468 CAGATGCCCTGAGGGGCCACTGG - Intronic
1013587433 6:111591842-111591864 CAGGTGACCTGCCGGGATACAGG + Exonic
1016292286 6:142538807-142538829 CAGGGGCCCTGCAGGCCCACAGG + Intergenic
1018248023 6:161840759-161840781 CATTTCCCTTGCAGGGACATGGG - Intronic
1018875118 6:167815674-167815696 CAGCTGCCCTGGAGGGGCGCTGG - Intergenic
1019482868 7:1274472-1274494 CAGATGCCCTGCTGGGGCAACGG - Intergenic
1022003214 7:26245288-26245310 CAGGAGCCCTGCAGGCCCACGGG + Intergenic
1022465683 7:30652171-30652193 CGGCTCCGCTGCAGGGACACAGG + Intronic
1022511660 7:30938654-30938676 CAGCAGTCCTGCAGAGACACAGG - Intronic
1022565037 7:31391124-31391146 CAGAGACCCTGCAGGGACTCAGG + Intergenic
1022567427 7:31417197-31417219 GGGTTGCCCATCAGGGACACTGG - Intergenic
1023852359 7:44157567-44157589 CAGATGCCCTGCAGGGAGTGTGG - Intronic
1025003885 7:55340717-55340739 CTGTGGCCCTGCTGGGACCCTGG - Intergenic
1026120476 7:67532499-67532521 CTGTGGCCCTGAAGGGACGCAGG + Intergenic
1026204452 7:68244534-68244556 GAGTTGGCCTGCAGTGACAAAGG - Intergenic
1027433358 7:78136921-78136943 GAGTTTCACTTCAGGGACACAGG - Intronic
1032069427 7:128794679-128794701 CAGGAGCCCTGCAGGGAGAGGGG - Exonic
1032841930 7:135721344-135721366 CAGGGGCCCTGCAGGGACCCAGG + Intronic
1033266735 7:139893457-139893479 CGATGGCCCTGCAGGGACAAAGG - Intronic
1034352746 7:150428018-150428040 CATTAGCCCTACAGGGACATGGG - Intergenic
1034893610 7:154860765-154860787 CAGTTGGCCTGCAGGGTGAGAGG - Intronic
1035306804 7:157938403-157938425 CTGCTGCTCAGCAGGGACACAGG + Intronic
1035387654 7:158485027-158485049 CAGGTGCCCTCCCGGGACGCTGG - Intronic
1035460808 7:159037358-159037380 CAGGGGCCCTGCAGGGGCCCAGG + Intronic
1038617257 8:29106228-29106250 CTGGAGCCCTGCATGGACACGGG - Intronic
1042157997 8:65865494-65865516 CAGGGGCCCTGCAGGCTCACAGG + Intergenic
1045894609 8:107199699-107199721 AAGTAGTCATGCAGGGACACAGG - Intergenic
1047210199 8:122834507-122834529 CAGGGGCCCTGCAGGCCCACGGG - Intronic
1049190748 8:141286056-141286078 CAGTTGCATTGCAGGGACCAAGG + Intronic
1049414025 8:142487312-142487334 CAGGTGGCCTGCAGGGGCAAGGG - Intronic
1049705789 8:144041381-144041403 CAGGGGTCCTGCAGGGACAGGGG + Intronic
1053215216 9:36265142-36265164 CACTTGCCGTGCAGGAACAACGG - Intronic
1056838119 9:89974427-89974449 CAGGTGCCCTGCAGGGACAGTGG + Intergenic
1057342096 9:94212052-94212074 AAGATGTCCTGCAGGGGCACAGG - Intergenic
1057436482 9:95045258-95045280 GAGCTGCACTGCCGGGACACGGG - Intronic
1057583895 9:96312651-96312673 CTGTCTCCCTGCAGTGACACTGG + Intergenic
1058283743 9:103150531-103150553 CAGTTCCCCAGTAGGGACTCTGG - Intergenic
1060180441 9:121529970-121529992 GAGTTGCCATCCAGGCACACAGG + Intergenic
1061959985 9:133983034-133983056 CAGTGGCCGGGCTGGGACACCGG + Intronic
1062038692 9:134394395-134394417 CAGTGGCCCTTCATGGAGACAGG - Intronic
1062227012 9:135457931-135457953 CAGTTTCCCTACAGGCACAGTGG - Intergenic
1062547224 9:137069278-137069300 CAGATGCCATGGAGGGACATAGG - Intronic
1186174791 X:6914580-6914602 CAATGGCCCTGCAGGAACAATGG + Intergenic
1187430198 X:19216071-19216093 CACATGCCCTGGAGGGAAACTGG + Intergenic
1189014493 X:37082496-37082518 CAGTTGTCATGCAGGCAAACAGG - Intergenic
1189496432 X:41513088-41513110 CACTTGCCCTGCAGAGAATCTGG - Intergenic
1191150942 X:57220641-57220663 CAGGGGCCCTGCAGGCCCACGGG + Intergenic
1192146947 X:68688580-68688602 CTGCAGCCCTGGAGGGACACTGG + Intronic
1192946258 X:75967750-75967772 CAGAGGCCCTGCAGGCCCACAGG - Intergenic
1194405647 X:93493436-93493458 CAGATTCCAGGCAGGGACACAGG + Intergenic
1194917530 X:99723416-99723438 CAGTTCCACTGCAGAGACAGTGG - Intergenic
1195285199 X:103376820-103376842 CTGTTTTCCTGCAGGGACTCGGG - Intronic
1196337229 X:114551482-114551504 CATTTGCCCTCCAGGCAAACTGG + Intergenic
1199691318 X:150311009-150311031 CAGTTCCCCTGCAAGGATTCTGG + Intergenic
1200011536 X:153124283-153124305 CAGGTGCCCTGCATGGTGACAGG - Intergenic
1200011676 X:153125057-153125079 CAGGTGCCCTGCATGGTAACAGG - Intergenic
1200012097 X:153127055-153127077 CAGGTGCCCTGCGTGGAGACAGG - Intergenic
1200012109 X:153127109-153127131 CAGGGACCCTGCAGGGAAACAGG - Intergenic
1200012110 X:153127110-153127132 CTGTTTCCCTGCAGGGTCCCTGG + Intergenic
1200012131 X:153127217-153127239 CAGGTGCCCTGCGCGGAGACAGG - Intergenic
1200027469 X:153272702-153272724 CAGGTGCCCTGCGCGGAGACAGG + Intergenic
1200027490 X:153272809-153272831 CTGTTTCCCTGCAGGGTCCCTGG - Intergenic
1200027491 X:153272810-153272832 CAGGGACCCTGCAGGGAAACAGG + Intergenic
1200027503 X:153272864-153272886 CAGGTGCCCTGCGTGGAGACAGG + Intergenic
1200027925 X:153274862-153274884 CAGGTGCCCTGCATGGTAACAGG + Intergenic
1200028065 X:153275636-153275658 CAGGTGCCCTGCATGGTGACAGG + Intergenic
1200091829 X:153639626-153639648 CAGGTTCCATGCAGGGACACAGG + Intergenic
1200247504 X:154533965-154533987 GAGTAGCCCTGCAGGGTGACTGG + Intronic
1201735370 Y:17254691-17254713 CAGTTTTCCTGCACTGACACTGG - Intergenic