ID: 1163690116

View in Genome Browser
Species Human (GRCh38)
Location 19:18734016-18734038
Sequence CACTTGACCCCGGCAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123738
Summary {0: 1, 1: 62, 2: 4800, 3: 31760, 4: 87115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163690109_1163690116 10 Left 1163690109 19:18733983-18734005 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163690116 19:18734016-18734038 CACTTGACCCCGGCAGGTGGAGG 0: 1
1: 62
2: 4800
3: 31760
4: 87115
1163690106_1163690116 29 Left 1163690106 19:18733964-18733986 CCGGGCATGGTGGCGCGTGCCTG 0: 470
1: 9936
2: 52239
3: 122767
4: 200979
Right 1163690116 19:18734016-18734038 CACTTGACCCCGGCAGGTGGAGG 0: 1
1: 62
2: 4800
3: 31760
4: 87115
1163690112_1163690116 1 Left 1163690112 19:18733992-18734014 CCAGCTACTTGGGAGGCTGAGAA 0: 212
1: 8454
2: 112888
3: 222477
4: 258911
Right 1163690116 19:18734016-18734038 CACTTGACCCCGGCAGGTGGAGG 0: 1
1: 62
2: 4800
3: 31760
4: 87115
1163690111_1163690116 2 Left 1163690111 19:18733991-18734013 CCCAGCTACTTGGGAGGCTGAGA 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
Right 1163690116 19:18734016-18734038 CACTTGACCCCGGCAGGTGGAGG 0: 1
1: 62
2: 4800
3: 31760
4: 87115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163690116 Original CRISPR CACTTGACCCCGGCAGGTGG AGG Intronic
Too many off-targets to display for this crispr