ID: 1163690380

View in Genome Browser
Species Human (GRCh38)
Location 19:18735406-18735428
Sequence CAGGATCCCCCGCTCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163690380_1163690387 -3 Left 1163690380 19:18735406-18735428 CCCCCGGGGAGCGGGGGATCCTG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 1163690387 19:18735426-18735448 CTGAGCATGGCACTGGATCGAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1163690380_1163690388 17 Left 1163690380 19:18735406-18735428 CCCCCGGGGAGCGGGGGATCCTG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 1163690388 19:18735446-18735468 AGGCGCACGCCAGCTCCTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1163690380_1163690385 -10 Left 1163690380 19:18735406-18735428 CCCCCGGGGAGCGGGGGATCCTG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 1163690385 19:18735419-18735441 GGGGATCCTGAGCATGGCACTGG 0: 1
1: 0
2: 1
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163690380 Original CRISPR CAGGATCCCCCGCTCCCCGG GGG (reversed) Intronic
900591169 1:3460675-3460697 CAGGATCACCCGCTCACAGTAGG - Intronic
901240083 1:7687784-7687806 CTGGAGCCCCTGCTCCCCAGCGG - Intronic
901637679 1:10677911-10677933 CAGGCTCCCCCGTTCTCCAGGGG + Intronic
901841144 1:11954904-11954926 GAGGATCCACCCCTCCCCGTGGG - Intronic
902190390 1:14758786-14758808 CAGCATCCCCATCTCCCCAGAGG - Intronic
902237758 1:15068563-15068585 CACGATCCCACCCTCCCTGGAGG + Intronic
902526061 1:17058311-17058333 AAGGCTCCCCGGCTCCCCCGCGG + Intergenic
903581213 1:24372463-24372485 CAGGATCCCCCCACCCCGGGAGG + Intronic
904369265 1:30038208-30038230 CTGGATCCACTGCTCCCAGGGGG + Intergenic
906719772 1:47996800-47996822 GAGGGTCCCCCGCGCCCCGCGGG - Exonic
911188465 1:94926488-94926510 CAGGAGCGCCCCCTTCCCGGAGG + Intronic
912391730 1:109307494-109307516 CATCCTCCCCCGCTCCCCGGGGG + Intergenic
914917154 1:151825893-151825915 CAGGCTCCCCCGCCCCCAGGTGG + Intronic
916535531 1:165699517-165699539 GAGGATCCCCTGAGCCCCGGGGG + Intergenic
919779542 1:201213214-201213236 CAGGGACCCCTGCTCCCCGAGGG - Exonic
920118393 1:203637353-203637375 CAGGCTCCGCCCCCCCCCGGGGG - Intronic
920379211 1:205526191-205526213 TAGGCTCCCACGCTCCCCTGGGG + Intronic
922776058 1:228214687-228214709 CAGGATCCCCAGCTCTCTTGGGG - Intronic
1068538598 10:58267772-58267794 GAGGAGCGCCCGCGCCCCGGCGG - Exonic
1072617335 10:97058648-97058670 CAGGCTCCTGCACTCCCCGGGGG + Intronic
1075504222 10:123008452-123008474 CAGGAGACCCCGCTCCCTCGGGG + Intronic
1076166568 10:128286937-128286959 GAGGAGCCCCCGCCCGCCGGCGG + Intergenic
1076606118 10:131691103-131691125 CAGGATCCCACGCCCCACTGAGG + Intergenic
1076719460 10:132386917-132386939 CAGGAAGCCCCCCTCCCTGGTGG + Intergenic
1079604116 11:22343755-22343777 CAGGCTCCCAGGCTCCCCGAGGG + Intronic
1083318123 11:61828647-61828669 CAGGATCCCTGGCTCCCCGTGGG + Intronic
1084000338 11:66292372-66292394 CAGCATCCCCCGCTGCGCTGCGG - Intronic
1084421719 11:69063745-69063767 CTGGGTCCCCCTCTCCCCGAGGG - Intronic
1084785506 11:71439626-71439648 CTGAATCCCCCAATCCCCGGAGG + Intronic
1084967361 11:72751706-72751728 CAGATTCCCCCCCTCCCCGCCGG + Intronic
1094564881 12:31590652-31590674 CAGCGTCCCCCGCGCCCCTGAGG + Intronic
1097264529 12:57737870-57737892 CCGGGACCCCCGCTCTCCGGGGG - Exonic
1102246724 12:111361115-111361137 CAAGCTGCCCCTCTCCCCGGGGG + Exonic
1103937634 12:124484957-124484979 GTGGCTGCCCCGCTCCCCGGGGG - Intronic
1104379180 12:128291909-128291931 CAGGAACCCCGGCTGACCGGAGG + Intronic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1107548754 13:41456984-41457006 CAGGCCCCCGCGCTCCGCGGTGG + Intergenic
1115147312 14:30240266-30240288 CAGGTTCCCCCCTTCCCTGGGGG + Intergenic
1117795344 14:59388165-59388187 CAGTTTCCCCTGCTCCCAGGTGG + Intergenic
1122370260 14:101225594-101225616 CAGGGTCCCACGGCCCCCGGGGG - Intergenic
1123034145 14:105465036-105465058 CAGGGTCCCGTGCTCCCCTGGGG + Intronic
1128545620 15:68565850-68565872 CAGTTTCCCCCTCTCCCCTGGGG + Intergenic
1128711931 15:69878596-69878618 CTGAATCCCCCGCTCCCCTCTGG - Intergenic
1131036113 15:89222989-89223011 AAGGATCCCCAGCTCCACAGAGG - Intergenic
1131493563 15:92883069-92883091 GAGGCTCCCCCGGGCCCCGGCGG + Intergenic
1134747462 16:16599339-16599361 CTGGATCCCCAGCTTCCTGGTGG - Intergenic
1136099375 16:27982359-27982381 CAGCATCCCCCGCATCCCAGTGG + Intronic
1136402009 16:30024326-30024348 CAGGATCCCCAGCTGCTCGCTGG - Exonic
1136412735 16:30086419-30086441 CAGGAGCCCCAGCTTCCCGGAGG - Exonic
1139689093 16:68628171-68628193 CAGGATCCCCCCCACCCCACAGG - Intergenic
1141643021 16:85352471-85352493 CAGCATCCCCCACTCCCAGGGGG - Intergenic
1141989928 16:87603690-87603712 CAGGTTGCCCCGCTGCCTGGTGG + Intronic
1142264010 16:89055329-89055351 CAGGCTCCGTCCCTCCCCGGCGG - Intergenic
1143299560 17:5899585-5899607 CAGGCTCTCCCCCTCCCCGAGGG - Intronic
1143483364 17:7239312-7239334 CGGGATCCCCGGCTCCGGGGAGG - Exonic
1144212200 17:13025334-13025356 CAGGATCCTGTGCTCCCTGGAGG + Intergenic
1147325768 17:39668672-39668694 CAGTTTCCCCCGCTCACCGGTGG - Exonic
1151848857 17:76677745-76677767 CAGGCTCCCTCTCTCCCCAGTGG - Intronic
1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG + Intronic
1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG + Intronic
1152663219 17:81552510-81552532 AAGGCTCCCCTGCTCCCCGTGGG - Intronic
1152840986 17:82568078-82568100 CTGAAGACCCCGCTCCCCGGGGG - Exonic
1156447572 18:37248822-37248844 CTGGATTCCCTGCTCCCCTGTGG + Intronic
1160455320 18:78995217-78995239 GAGGGTCCCCCGCTGCCCGCGGG + Exonic
1161101892 19:2425534-2425556 CGGGAACCCGCCCTCCCCGGCGG - Intronic
1161452505 19:4354321-4354343 CAGGAACCCCCACACCCTGGTGG + Exonic
1161459247 19:4386763-4386785 CAGGATCCCCCGATCCTAAGAGG + Intronic
1162979291 19:14228293-14228315 CACCTTCCCCCTCTCCCCGGCGG - Intergenic
1163432963 19:17279130-17279152 CTGGAACCCCCCCACCCCGGAGG - Exonic
1163582986 19:18149342-18149364 CAGCATCCCGCCCTCCCCGCTGG + Exonic
1163606783 19:18280229-18280251 CTGGACCCCCTGCTCCCGGGGGG - Exonic
1163690380 19:18735406-18735428 CAGGATCCCCCGCTCCCCGGGGG - Intronic
1164960887 19:32428516-32428538 CAGGATCCCCCGCATCCCAGTGG - Intronic
1166305695 19:41935862-41935884 CAGGCTCCCCCCCCACCCGGCGG + Intergenic
1167300240 19:48673653-48673675 CTTGGTCCCCCGCACCCCGGGGG - Intergenic
1168257373 19:55174146-55174168 CAGGATGCCCCGCCCCCAAGCGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168710969 19:58499674-58499696 CAGCAGCCCCGGCTCCCCTGGGG + Exonic
925100015 2:1236342-1236364 CAGGATCCATCGCTTCCCGTGGG - Intronic
926571446 2:14534502-14534524 CAGCATCCTCTGCTCCCCAGTGG + Intergenic
928376504 2:30778822-30778844 CAGGGTCCCCCTCACCCGGGAGG - Intronic
929174056 2:38959672-38959694 CACGAACCCCCGTTCCCAGGCGG - Intronic
929449961 2:42030300-42030322 CCGGATCCCCTGATCCCCGAGGG + Intergenic
931710913 2:64988892-64988914 GAGGATCCCTCTCTCCCGGGTGG - Intronic
931721909 2:65072728-65072750 CAGGATCCCCAGATCCTTGGAGG - Exonic
932345914 2:70994981-70995003 CAGGATCCCCCGCTCCACTGAGG + Exonic
935592773 2:104856375-104856397 CAGGGACCCCCGCACCACGGCGG + Exonic
937900493 2:127015945-127015967 CAGGATCCCCTTGTCCCGGGAGG - Intergenic
944233125 2:197415887-197415909 GAGGATCCCTTGATCCCCGGAGG - Intronic
948119358 2:235517345-235517367 CAGCATCCCTCCCTCCCTGGTGG + Intronic
1169362729 20:4964746-4964768 GAGGATCCCCTGCACCCGGGAGG + Intronic
1171121867 20:22575560-22575582 CAGGGTCCCCAGCTCCCAGCAGG - Intergenic
1171223197 20:23420474-23420496 CCGGACCGCCCCCTCCCCGGCGG + Intronic
1172102681 20:32494975-32494997 AAGGATCCCCCACTCCCATGTGG + Intronic
1172975121 20:38900373-38900395 CAGGATCCCAGGGTCCCAGGTGG - Intronic
1175757957 20:61541812-61541834 CAGGATCCCTCTCTCTCCTGAGG + Intronic
1175972491 20:62693698-62693720 CAGGACCACCCGGTCCCTGGAGG - Intergenic
1176181443 20:63751665-63751687 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181469 20:63751725-63751747 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181482 20:63751754-63751776 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181509 20:63751813-63751835 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176181522 20:63751842-63751864 CATGAAGCCCCGCCCCCCGGTGG + Intronic
1176246167 20:64098187-64098209 CAGGCTCCCTGGCTCCCGGGTGG + Intronic
1176305753 21:5122267-5122289 GAGGGTCCCCCACTCCCCGGGGG + Intronic
1179247956 21:39649652-39649674 CAGAATCCCCCTCGCCCCTGGGG - Intronic
1179851305 21:44139764-44139786 GAGGGTCCCCCACTCCCCGGGGG - Intronic
1181181156 22:21069566-21069588 CAGGATCCCAAGCTGCCCGAAGG - Intergenic
1183607132 22:38872363-38872385 CAGGACCTCCCCCTCCCCCGGGG + Intergenic
949556647 3:5159208-5159230 GAGGATCCCCCGAGCCCGGGAGG + Intronic
950195639 3:11007295-11007317 CATGAGGCCCGGCTCCCCGGAGG + Intronic
953699282 3:45183526-45183548 CAGATTCCCCAGCTCCCCTGGGG - Intergenic
954961186 3:54566351-54566373 CAGGCTCCCCATCTCCCAGGAGG + Intronic
956684885 3:71816929-71816951 CAGAATCCCCTCCTCCGCGGGGG + Intergenic
963259071 3:143176113-143176135 CAGGAGACCCCGGCCCCCGGCGG - Intergenic
963365113 3:144324138-144324160 GAGGGCCCCCAGCTCCCCGGTGG - Intergenic
968504514 4:965674-965696 CAGGACTCCCAGCTCCCTGGAGG + Intronic
969032594 4:4226727-4226749 CGGAATCCCCGGCCCCCCGGCGG - Exonic
972125435 4:35759164-35759186 CATGATCCCCCACTCCCCACAGG - Intergenic
975383000 4:73724249-73724271 GTGGTTCCCCTGCTCCCCGGAGG + Intergenic
986169944 5:5307142-5307164 AAGGAACCCCCGCTCCATGGTGG - Intronic
986370734 5:7077800-7077822 CAGGCTCCCCTGTTCCCTGGTGG + Intergenic
986704176 5:10441756-10441778 CAGCAGCCGCTGCTCCCCGGTGG - Exonic
987300254 5:16590757-16590779 CAGAAACCCCTACTCCCCGGTGG + Intronic
990453421 5:55959638-55959660 CAGGATCAACCGCTTCCCAGGGG + Intronic
992741389 5:79776891-79776913 CAGGCCGCCCCGCTCCCCTGGGG + Intronic
998369243 5:141650626-141650648 CAGGATCCTCCCCACCCCAGAGG + Intronic
1001928868 5:175658619-175658641 CAGCAGCCCCCGCTCTCCGCTGG - Intronic
1002900732 6:1407716-1407738 CAGGGTCCCCAGCTCCTCTGCGG + Intergenic
1003528769 6:6920351-6920373 CAAGATCCACCTCTCCCCAGGGG + Intergenic
1004311639 6:14551342-14551364 CAGGATCCCTCTCTACCCAGTGG + Intergenic
1006187684 6:32190106-32190128 CAGGAGACCCCGGCCCCCGGCGG + Exonic
1006309790 6:33249574-33249596 CAGCAGCCTCCGCTCCGCGGCGG + Intergenic
1006449603 6:34098560-34098582 CAGGGTCCCCTGCTCCCTGGGGG - Intronic
1007430187 6:41771891-41771913 CACGATTCTCAGCTCCCCGGCGG - Exonic
1007614277 6:43171366-43171388 CAGCAGCCCCTGCCCCCCGGGGG + Exonic
1007759756 6:44127182-44127204 CGGGACCCCCCCCTCCCCGTCGG + Intronic
1007902277 6:45422984-45423006 CAGGTTCCGCCGCTCCCGGCCGG - Intronic
1008702724 6:54120518-54120540 CAGGAGCCACCGCTCCCGGCTGG + Intronic
1009540805 6:64955743-64955765 AAAGTTCCCCCGCTCCCCCGGGG - Intronic
1020073161 7:5240632-5240654 CAAGGTCACCCTCTCCCCGGAGG - Intergenic
1020445235 7:8261693-8261715 CAGGACCCCGAGCTCCCTGGTGG - Intronic
1022120447 7:27303073-27303095 CAGGATCCCTGGCTCCCCGGTGG + Intergenic
1023937464 7:44749590-44749612 GAGGATGCCCTGCTCCCCTGAGG + Intronic
1024317558 7:48035617-48035639 CAGGCTCACCAGCTCCCCGCGGG - Exonic
1025237269 7:57243319-57243341 CATGACCCCCTGCTCCCAGGGGG - Intergenic
1027138259 7:75639360-75639382 CGGGATTTCCCGGTCCCCGGGGG - Intronic
1028922376 7:96322166-96322188 CTGGATCACGCGCACCCCGGCGG - Intergenic
1033033188 7:137846685-137846707 CATGAACCCCAGCTCCTCGGCGG - Exonic
1033146127 7:138871276-138871298 CAGGATCTCCCGCCCCCCGGAGG - Exonic
1038807691 8:30810359-30810381 GAGGATCCCTCGAACCCCGGAGG + Intronic
1041693629 8:60714176-60714198 GGGGATGCCCCGCCCCCCGGGGG - Intronic
1049578888 8:143401828-143401850 CAGGATGCCCCGCCCGCTGGGGG - Intergenic
1049696685 8:143987362-143987384 CAGGGTCCTCAGCTCCCTGGAGG - Intronic
1049788384 8:144462197-144462219 CAGGATCCGCGTCTCCTCGGAGG - Intronic
1052341539 9:27368898-27368920 CAGCATCCCCAGCTCCCAGATGG + Intronic
1053198443 9:36136985-36137007 CGCGATCCCCGGCTCTCCGGCGG - Intronic
1056965469 9:91160573-91160595 CAGGAGCCCCCGCACTGCGGGGG + Intergenic
1058711389 9:107682233-107682255 CAGCATCCCCGGCTCCCAGCAGG + Intergenic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1060017289 9:120097788-120097810 CAGGATGCCCCGCTCCCTCTGGG + Intergenic
1060400759 9:123348370-123348392 CAGGATCCCCTCCTCTCTGGTGG + Intergenic
1061985632 9:134128756-134128778 GAGGATCACCTGCACCCCGGGGG + Intergenic
1062069766 9:134549402-134549424 CCGGATCTCCCGCTTCCCGAGGG - Intergenic
1062352042 9:136144013-136144035 CTGGAATCCCTGCTCCCCGGAGG + Intergenic
1062392213 9:136338360-136338382 CAGGACCCCCCGTCCCCCTGGGG + Intronic
1185468636 X:369839-369861 CAGGAGCCCCCGCTCTGCAGCGG + Intronic
1190403976 X:50067798-50067820 CCAGATCCCCTGCTCCCGGGGGG - Intronic
1195278895 X:103310674-103310696 CAGGATCGCCGGCTCCCGCGGGG + Exonic