ID: 1163690380

View in Genome Browser
Species Human (GRCh38)
Location 19:18735406-18735428
Sequence CAGGATCCCCCGCTCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163690380_1163690387 -3 Left 1163690380 19:18735406-18735428 CCCCCGGGGAGCGGGGGATCCTG No data
Right 1163690387 19:18735426-18735448 CTGAGCATGGCACTGGATCGAGG No data
1163690380_1163690388 17 Left 1163690380 19:18735406-18735428 CCCCCGGGGAGCGGGGGATCCTG No data
Right 1163690388 19:18735446-18735468 AGGCGCACGCCAGCTCCTGCAGG No data
1163690380_1163690385 -10 Left 1163690380 19:18735406-18735428 CCCCCGGGGAGCGGGGGATCCTG No data
Right 1163690385 19:18735419-18735441 GGGGATCCTGAGCATGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163690380 Original CRISPR CAGGATCCCCCGCTCCCCGG GGG (reversed) Intronic