ID: 1163692503

View in Genome Browser
Species Human (GRCh38)
Location 19:18745291-18745313
Sequence GAGCAGCCCTGGGCTCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163692493_1163692503 26 Left 1163692493 19:18745242-18745264 CCTGGAGGAGGCTGCGGGGGAGG 0: 1
1: 0
2: 9
3: 108
4: 858
Right 1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG 0: 1
1: 0
2: 5
3: 61
4: 321
1163692500_1163692503 -8 Left 1163692500 19:18745276-18745298 CCGCGTCTCAATCAAGAGCAGCC 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG 0: 1
1: 0
2: 5
3: 61
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163692503 Original CRISPR GAGCAGCCCTGGGCTCCACA AGG Intronic
900012834 1:131463-131485 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900042899 1:487450-487472 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900064336 1:722447-722469 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900080669 1:854931-854953 CAGCTCCCCTGGGCTTCACATGG + Intergenic
900315910 1:2056232-2056254 CTGCAGCCCTGGGCACCACTTGG - Intronic
900361271 1:2290173-2290195 GGGCAGCCCTGGGCTGCCCCCGG + Intronic
900652438 1:3736459-3736481 CAGAAGGCCTGGGCCCCACAGGG - Intergenic
900981319 1:6047786-6047808 CAGCGGCCATGGGCTCCTCATGG + Intronic
902814550 1:18908699-18908721 GAGCAGCCCTGGGCCTCTGAAGG + Intronic
903745210 1:25582026-25582048 GCGCAGGCCTGGGCTTCCCAGGG + Intergenic
905230511 1:36512310-36512332 GAGCAGCCCGGGGCTGGAGAGGG + Intergenic
905231483 1:36517221-36517243 GAGCAACCCTGGGAACCACATGG + Intergenic
905519523 1:38587206-38587228 GAGCAGCCCTGGGGTGGAGAGGG - Intergenic
906830262 1:49023670-49023692 GAGAAGCCCTGGAATCCAAAAGG + Intronic
907619336 1:55960349-55960371 AAGCACCACTGGGGTCCACATGG + Intergenic
907899038 1:58720741-58720763 GAAGAGCCCTGGCCTTCACAGGG + Intergenic
908398338 1:63746692-63746714 CAGCAGCCCTGGGAGGCACAGGG + Intergenic
912457524 1:109807758-109807780 GAGCAGGTCCGGGCTCCTCAGGG + Intergenic
912681973 1:111734520-111734542 GAGCAGCCCTGGGATCCAGAAGG - Intronic
914874101 1:151499698-151499720 CTGCAGCTCTGGGCTCCGCATGG - Intergenic
916019069 1:160776899-160776921 GAGCAGCTCTGGGGTTGACAGGG - Intergenic
916075206 1:161196655-161196677 GGGCAGCACTGGGCCCCACTTGG + Exonic
916379685 1:164195829-164195851 GAGCTGCAGTGGGCTCCACCTGG - Intergenic
918125582 1:181580624-181580646 GGGCAGCCCTGCACACCACATGG - Exonic
918343588 1:183587062-183587084 CAGCAGAGCTGGGCACCACAGGG - Intronic
919780807 1:201219687-201219709 GAGCATCTCTGTGCCCCACAGGG + Intronic
920268414 1:204744290-204744312 CAGCAGCCCTGGTCCCCTCAGGG - Intergenic
921203418 1:212827899-212827921 GAGCTGCCCTCTGCTCCAGAGGG - Intergenic
921854090 1:219962706-219962728 GCGCAGCCCTGGAATCCACAAGG + Intergenic
922099235 1:222468459-222468481 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
922261273 1:223947953-223947975 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
922504706 1:226119753-226119775 CAGCAGCCCTGGCCTCCCCTAGG - Intergenic
922808076 1:228400927-228400949 GAGCAGCCATGGTGGCCACACGG - Intronic
923676794 1:236087450-236087472 GAGCAATCCTGGGCTCCCAATGG + Intergenic
924744855 1:246822395-246822417 GAGGAGCCCTGAGCACCACCGGG - Intergenic
924777288 1:247119124-247119146 CAGCAGCCCTGGACACCAGAAGG + Intergenic
1062980334 10:1717315-1717337 CAGCTGCCCTGGGGTCCCCAGGG - Intronic
1063218666 10:3946182-3946204 GAGCAGCTCTGGACTGCAAAAGG + Intergenic
1064727638 10:18297652-18297674 GAGCAGCCCTGGGCTCAGGTTGG - Intronic
1065158299 10:22893637-22893659 GTGCAGTGCTGGGCTCAACAGGG - Intergenic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1066734037 10:38455422-38455444 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1066785134 10:38995240-38995262 GAGCTGCGGTGGGCTCCACCTGG + Intergenic
1067249712 10:44576169-44576191 GTGCTGCCCTGGGCGCCACGGGG - Intergenic
1067727220 10:48779348-48779370 GAACAACGCTGGGCTCCAAAGGG - Intronic
1069786622 10:70992462-70992484 GTGCTCCTCTGGGCTCCACAGGG + Intergenic
1070552147 10:77498323-77498345 GAGAAGCCCTGGGAATCACATGG + Intronic
1070824249 10:79381599-79381621 GAGCAGCACTGGACTTCAGATGG - Intergenic
1071571511 10:86699844-86699866 GGGCTGCCCTGAGCTCCAGAGGG - Intronic
1072388767 10:94960255-94960277 GAGCTGCGGTGGGCTCCACCTGG + Intronic
1073510692 10:104040776-104040798 TATCAGACCTGGGCTCCCCAAGG + Intronic
1075717085 10:124562107-124562129 GACCAGACCTGGGCAACACAGGG + Intronic
1076404008 10:130200666-130200688 GGCCAGCGCTGGGCTCCCCAGGG - Intergenic
1076841562 10:133048495-133048517 GAGAGGCCCCGGCCTCCACAGGG + Intergenic
1076854765 10:133110522-133110544 GAGCAACACTGAGCTGCACAGGG + Intronic
1076904622 10:133355864-133355886 GGCCAGCCCTGGACTCCCCAGGG + Intronic
1076908948 10:133378034-133378056 GATCCGCCCTGGGTTCCCCATGG + Intergenic
1076969172 11:123667-123689 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1078540068 11:12206235-12206257 AACCAGCCCAGGGCCCCACAAGG - Intronic
1078551087 11:12281074-12281096 GCACAGCTCTGGGCTCCTCAGGG - Intronic
1079290722 11:19185547-19185569 GAGAAGCCCTGGGCTGTACCTGG - Intronic
1080596609 11:33778778-33778800 GAATATTCCTGGGCTCCACAGGG - Intergenic
1081693227 11:45092356-45092378 GAGCAGCCCTGGGGTCCTGGAGG - Intergenic
1081872478 11:46389737-46389759 GAGCTGCCCTCGGCTCCGCGCGG + Intergenic
1083627368 11:64078562-64078584 GCGCGGCCCTGTGCCCCACAGGG + Intronic
1083880150 11:65544364-65544386 GATAAGCCCTGGGCTCCAGCTGG - Intronic
1083994024 11:66263406-66263428 TAGCATTCCTGGGCGCCACATGG - Intronic
1084106809 11:66985838-66985860 GACCTGCCCTGGGTTGCACAGGG - Intergenic
1084113937 11:67030993-67031015 GATCAGCCCTGGGCTCCCCAGGG - Intronic
1084888145 11:72223905-72223927 CAGCGGCCCTGGGCTCCAGGCGG - Intronic
1085058325 11:73421511-73421533 GAAAGGCCCTGGGCTCTACATGG - Intronic
1085279484 11:75320602-75320624 AAGAGGCCATGGGCTCCACATGG + Intronic
1085692427 11:78674563-78674585 GAGCTGCTCAAGGCTCCACATGG + Intronic
1090639395 11:128717453-128717475 CAGCATCCCTGGGCTCCAGAAGG - Intronic
1091275374 11:134346124-134346146 AAGAAGCCCAGGGCTCCCCAGGG - Intronic
1091304529 11:134529159-134529181 GAACTGCCCTGGGATCCCCAAGG - Intergenic
1096182779 12:49559704-49559726 GAGGAGGCCTGGGCACCAGAAGG - Intronic
1096239057 12:49949766-49949788 GAGCGGCCCTGAGCTCCTCAGGG + Intergenic
1102216944 12:111168365-111168387 GAGCAGCCCTGGAATCTGCAGGG - Intronic
1102857810 12:116309720-116309742 GATCAGGCCTTGACTCCACAGGG + Intergenic
1103726362 12:122999241-122999263 GAGAAGCCCTTGGCTCCTCCTGG - Intronic
1104721137 12:131045791-131045813 GAGCTGCCCTGCGGTCCTCAGGG + Intronic
1104953929 12:132454677-132454699 GTGCTGCACTGGGCTGCACAGGG + Intergenic
1104987617 12:132605875-132605897 GAGCAGCCCTGGGGCCACCACGG - Intronic
1106571900 13:30934881-30934903 CTGCAGCCGTGGGTTCCACAGGG - Intronic
1108599531 13:51980171-51980193 GAGCAGGCCAAGGTTCCACATGG + Intronic
1113437957 13:110307587-110307609 GTGCAGCCCTAGCCTGCACAAGG - Intronic
1113481657 13:110626079-110626101 GTGCAGGGCTGGGCCCCACAGGG + Intronic
1113659370 13:112095170-112095192 GATCTTCCCTGGGCTCAACAAGG + Intergenic
1114581267 14:23762338-23762360 GAGCTGCAGTGGGCTCCACTTGG + Intergenic
1114596210 14:23914310-23914332 AAGCAGCCCTGTGCATCACAAGG - Intergenic
1115350668 14:32391552-32391574 GAGCAGCTCTGTGGTCCACCTGG + Intronic
1119185810 14:72641634-72641656 GAGCAGCACTGGGAGCCAAACGG + Intronic
1119679514 14:76581705-76581727 GTGCAGGACTGGGCTTCACAGGG + Intergenic
1120869464 14:89323988-89324010 GAGTTGCCCAGGGCACCACAAGG - Intronic
1122277997 14:100605098-100605120 GAGAGGTCCTGGTCTCCACAGGG + Intergenic
1122533958 14:102449062-102449084 GACCAGCCCTGGGCAACACAGGG + Intronic
1122871792 14:104642130-104642152 CAGCAGCCCTGGGCTGAGCATGG - Intergenic
1122892013 14:104736356-104736378 GCCCAGCCCTGGGCCCCACATGG + Intronic
1124055548 15:26238095-26238117 GAGCAGCTCTGGGAACCACTGGG + Intergenic
1124695598 15:31861978-31862000 GAGCAGCTCTAGGCTCTGCAAGG + Intronic
1125523367 15:40360269-40360291 AAGCACCCCAGGGCTACACAGGG - Intronic
1127402713 15:58606140-58606162 AAGGAGCTCTGGGCCCCACATGG - Intronic
1127499310 15:59541825-59541847 CAGCCGCCTTGGGCTCCAAAAGG + Intergenic
1128229408 15:66024307-66024329 GCGCAGCCCCGGGCGCCCCAGGG - Intronic
1129778401 15:78252345-78252367 GAGCCACCCTGGACTCTACATGG - Intergenic
1132246549 15:100300568-100300590 AAGGAGCCTTGGGCTCCACCAGG + Intronic
1132286325 15:100665705-100665727 GAGCCGCCCTGTGTTCCAGAGGG - Intergenic
1132497159 16:269301-269323 AAGCCGCTGTGGGCTCCACAGGG + Exonic
1132541930 16:514197-514219 GAGCAGCCCTGAGAACCACAAGG - Intronic
1132558366 16:582558-582580 GGGCTGCCCTGGGCCCCACAGGG + Intronic
1133698033 16:8283475-8283497 GAGCAGCCTTGGCCTCAACATGG + Intergenic
1136029167 16:27490196-27490218 CAGCAGGCCTGGGCCCCACCTGG + Intronic
1136249079 16:28991876-28991898 GAGCAGCCCTGGGATCCAGGTGG + Intergenic
1137594016 16:49711909-49711931 GAGCAGCCCTGGGCAACACACGG + Intronic
1138657834 16:58501037-58501059 GAGGTGCCCTGGGCTCCACCTGG - Intronic
1139356732 16:66371290-66371312 GAGCTGCCCAGGGCCACACACGG + Intronic
1139505642 16:67396824-67396846 GGGGGGCCCTGGGCTCCAGAGGG + Intronic
1139910547 16:70394953-70394975 GCCCACCCTTGGGCTCCACAGGG + Intronic
1141026800 16:80556461-80556483 GGGTAGCCGTGTGCTCCACATGG + Intergenic
1141517756 16:84557697-84557719 CTGCAGCCCTGGGCTCTACTAGG + Intergenic
1141894103 16:86947467-86947489 GAGGAGCTCTGGGGTCCACCAGG + Intergenic
1142451503 16:90175455-90175477 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1142567704 17:851339-851361 GGGCAGCCTTGGGCTGCAGACGG + Intronic
1143265451 17:5633616-5633638 GAGCAGAACTGGGCTTCTCAGGG + Intergenic
1143615519 17:8047089-8047111 GACCAGCCCTCGGCTCTCCAGGG - Intronic
1144624796 17:16839164-16839186 GAACAGCCCTGGGCTGCAGATGG - Intergenic
1144719634 17:17459685-17459707 GAGCATCCCAGGCCTCCAGAGGG - Intergenic
1144799370 17:17914431-17914453 GAGCAGACCTGGGCCTAACAGGG - Intronic
1144881634 17:18433557-18433579 GAACAGCCCTGGGCTGCAGATGG + Intergenic
1145019094 17:19416033-19416055 GAGCTGCCGTGGGGGCCACAGGG + Exonic
1145150599 17:20510829-20510851 GAACAGCCCTGGGCTGCAGATGG - Intergenic
1146689518 17:34863596-34863618 AGGCAGACCTGGGCTCCACTTGG + Intergenic
1147578943 17:41617858-41617880 AACCAGCCCTGGGCTGCAGATGG - Intergenic
1147624759 17:41892874-41892896 GACCAGCCCTGGGCAACATAGGG - Intronic
1148216346 17:45835832-45835854 GTGAAGGCCTGGACTCCACAGGG + Intergenic
1148340248 17:46869112-46869134 GAGCAGCCCTGGGCAGACCAGGG + Intronic
1149543761 17:57488077-57488099 CTGCTGCCCTGGGCTCCAAATGG - Intronic
1150217429 17:63478184-63478206 GAGGAACCCTGGGATCCACATGG + Intergenic
1150926859 17:69541330-69541352 AAATAGCCCTGGGCCCCACAAGG - Intronic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1151976573 17:77487042-77487064 GAGGAGCCCAGGGCTGCCCAGGG - Intronic
1152307999 17:79532316-79532338 GTGCCACCCTAGGCTCCACATGG - Intergenic
1152586495 17:81191734-81191756 GTCCAGCCCTGGGCCCCACAGGG + Intronic
1152611448 17:81316727-81316749 GGGCAGGCCTGGGCTCCCCAGGG + Intronic
1152807434 17:82362818-82362840 GTGCTGCCCTGGGGTCCTCAGGG - Exonic
1152883024 17:82831216-82831238 GTGCAGCCACGGGCTCCCCAGGG - Exonic
1153000692 18:452846-452868 TAGCTGCCCTGTGCTCCACTTGG - Intronic
1153540690 18:6150993-6151015 CAGCAGCGCCAGGCTCCACAAGG + Intronic
1154019515 18:10650494-10650516 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
1156528965 18:37796705-37796727 AAGCAGCCCTGGCCTACAGATGG - Intergenic
1157439574 18:47700325-47700347 GAGCAGCTGTGGCCTCCACGTGG - Intergenic
1160157644 18:76445772-76445794 GACCAGGCCTGGGCTCCTCCTGG - Intronic
1160645977 19:193593-193615 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1162555702 19:11384221-11384243 CAGGAGCCCTGGGCTCCCCGTGG - Exonic
1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG + Intronic
1164683020 19:30148511-30148533 GAGCAGCCCTGGTGGCCACAGGG - Intergenic
1165404462 19:35621261-35621283 GAGCAGCCCCAGACCCCACACGG + Intronic
1165840546 19:38787042-38787064 GCCAGGCCCTGGGCTCCACAGGG - Intergenic
1166475445 19:43120613-43120635 GAGATCCCCTTGGCTCCACAAGG + Intronic
1167264750 19:48478028-48478050 GAGGGGGCCTGGGCTCAACAGGG - Intronic
1167431828 19:49459603-49459625 GAGCAGCCCAGGACTCTGCAAGG + Intronic
1167760105 19:51441121-51441143 GTGCAGTCCTGGGCTCCAGCAGG + Intergenic
1167786922 19:51644725-51644747 GAACAGCCCTGGGATCAACAGGG + Intronic
1167975747 19:53224731-53224753 GGAGAGCCCTGGGCTCTACACGG - Intergenic
1168268423 19:55236351-55236373 GACCAGCCCTGGGCAACATAGGG - Intronic
925147033 2:1588484-1588506 AAGCCACCCTGGGCTCCACTTGG + Intergenic
926098291 2:10096939-10096961 GAGCAGAGAGGGGCTCCACAGGG + Intergenic
929830632 2:45343913-45343935 AAGCAGCGCTGTACTCCACAGGG + Intergenic
929947455 2:46381762-46381784 CAGCAGCCCTGGGTTCCCTAAGG - Intronic
929947474 2:46381823-46381845 CAGCAGCCCTGGGTTCCCTAAGG - Intronic
932461644 2:71885624-71885646 GAGGAGCACTGGGTTCCTCAGGG + Intergenic
935146942 2:100402077-100402099 CAGCAGCCTTGGGCTCCGCCAGG + Intronic
936096463 2:109533978-109534000 GCGCTGCCCTGGGCTCCTCCCGG - Intergenic
936912070 2:117603596-117603618 GAGAAGGCCAGGGCTACACATGG + Intergenic
937261719 2:120590930-120590952 GAGCAGTCCTGGGCCCAGCAAGG - Intergenic
937761396 2:125607816-125607838 GGGCTGCACTGTGCTCCACAAGG + Intergenic
938087255 2:128409600-128409622 GAGCAGCCCAGGTGGCCACAGGG + Intergenic
940276587 2:151946668-151946690 GAGCACCCCAGGGCTCCAGCAGG + Intronic
940344345 2:152613962-152613984 GAACAGCTCAGGGCTCCCCAAGG - Intronic
941866950 2:170344905-170344927 GATCAGCCCTGGGGTTCAGAGGG - Intronic
943295136 2:186128814-186128836 CAGCAGCCCTGTGCCCCACAGGG - Intergenic
943383224 2:187175023-187175045 GACCAGCCCTGGTGTCCAGAAGG + Intergenic
946097770 2:217290592-217290614 GGGCAGCTCTGAGCTCCACAAGG - Intronic
947104600 2:226655416-226655438 AAGCAGGCCTGGGGTCCATAGGG - Intergenic
948111658 2:235461231-235461253 GAGCAGCCCTTGGCTACTGACGG - Intergenic
948132593 2:235611544-235611566 CTGCAGGCCTGGGCACCACAGGG - Intronic
948371230 2:237490194-237490216 GAGCAGCCCTGCACTCCTCATGG + Intronic
948723430 2:239918006-239918028 CAGCAGCCCTGGACTCCAGGTGG + Intronic
948798959 2:240421531-240421553 GAGCAGGCCCTGGCTCCCCAGGG + Intergenic
1169130449 20:3164094-3164116 TAGCAGCCCAGGCCTCCAGAAGG + Exonic
1171293116 20:23993940-23993962 GAGCTGCCCTGGGCTGGAGATGG - Intergenic
1172213477 20:33217304-33217326 GAGGAGGCCAGGGCTCCAGAGGG - Intronic
1172600178 20:36177873-36177895 GAGATACCCTGGGCTCCACCAGG - Intronic
1172602750 20:36195195-36195217 CAGCTGCCCTGGCCTCCACTTGG + Intronic
1175608567 20:60331331-60331353 GAGAAACCCTGGCCTCCCCAGGG - Intergenic
1176254714 20:64145953-64145975 GAGCAGGCCTGGGCAGGACATGG - Intergenic
1176266710 20:64213091-64213113 GGGCAGCCCAGGGCCCCACTTGG - Intronic
1176279529 20:64292623-64292645 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1176377745 21:6094834-6094856 GGGCAGCCCTGGGCTCCAAGAGG + Intergenic
1179225806 21:39451967-39451989 CAGCAGCCCAGGGGTCCACTGGG - Exonic
1179441777 21:41399923-41399945 GAGCAGCCCAGGGTACCTCAGGG + Intronic
1179600174 21:42472143-42472165 CAGTGGGCCTGGGCTCCACATGG + Intergenic
1179712067 21:43269093-43269115 GTGCATCCCTGGGCTCCCCCGGG + Intergenic
1179745729 21:43443410-43443432 GGGCAGCCCTGGGCTCCAAGAGG - Intergenic
1179907821 21:44433409-44433431 GAGCTGCACTGAGCTCCAGAAGG - Intronic
1180253447 21:46605594-46605616 GGTCAGCCCTGGGCTCAACGGGG + Intergenic
1180824177 22:18851656-18851678 GAGCTGCCCTGGGCTGGAGATGG - Exonic
1181124604 22:20694810-20694832 GAGCTGCCCTGGGCTGGAGATGG - Intergenic
1181188560 22:21122892-21122914 GAGCTGCCCTGGGCTGGAGATGG + Intergenic
1181210640 22:21287601-21287623 GAGCTGCCCTGGGCTGGAGATGG - Intergenic
1181398872 22:22639290-22639312 GAGCTGCCCTGGGCTGGAGATGG + Intergenic
1181501604 22:23318639-23318661 GAGCTGCCCTGGGCTGGAGATGG + Intergenic
1181650550 22:24256769-24256791 GAGCTGCCCTGGGCTGGAGATGG - Intergenic
1181706831 22:24653969-24653991 GAGCTGCCCTGGGCTGGAGATGG + Intergenic
1181756571 22:25028689-25028711 GGCGAGGCCTGGGCTCCACAAGG - Exonic
1182264473 22:29102930-29102952 GGGGAGCCCTGGTCCCCACAGGG - Intronic
1182900127 22:33890993-33891015 AAGCTACCCTGGGCTCCATATGG + Intronic
1183072103 22:35403350-35403372 GAGCAGCCCTGGGAAGCTCAGGG - Intronic
1183187288 22:36299453-36299475 GAGCAGCCCGGGGCACCGCGGGG - Intronic
1183568380 22:38633045-38633067 CAGCAACCCTGAGCTCCACAAGG - Intronic
1183700016 22:39445932-39445954 GAGCGGCCCTGGACCACACAGGG - Intergenic
1184354366 22:43969163-43969185 GTGAAGCCCTGGACTCCACGGGG + Intronic
1184919446 22:47595343-47595365 CAGCACCCCTGGTCTCCACCTGG - Intergenic
1185018432 22:48359083-48359105 GTGCAGCCCTGGCCTCCGCCCGG - Intergenic
1185043961 22:48519688-48519710 TTGGAGCCCTGGGCTCCTCACGG + Intronic
1203216307 22_KI270731v1_random:7829-7851 GAGCTGCCCTGGGCTGGAGATGG + Intergenic
950147012 3:10657328-10657350 GAGCTTCCCTGAGCTACACAGGG + Intronic
950176784 3:10880636-10880658 GAGCAGCCCTGGGGACCAACGGG - Intronic
950576664 3:13836322-13836344 GCTCAGCCCTGGCCTCCAGATGG + Intronic
952053008 3:29409229-29409251 GAGCAGGCCTCTGCTCCACGTGG + Intronic
954403530 3:50332185-50332207 GAGAAGCCCTGGGTTCCTCAAGG - Intronic
954446230 3:50548212-50548234 GAGCAGCCCTGAGGTCCACAGGG - Intergenic
959996662 3:112687920-112687942 GACCAGCCCTAGGCTCCAAATGG + Intergenic
960832348 3:121863324-121863346 GAGCTGCGGTGGGCTCCACCTGG + Intronic
961606373 3:128098548-128098570 GAGCTGCCCTGTGCTCTACTAGG + Intronic
961739966 3:129027187-129027209 GTGCAGCCCTGGGCCACTCACGG + Intronic
961960963 3:130854697-130854719 CAGCACCCCTGGGCTACATATGG + Intronic
962661292 3:137602894-137602916 CAGCAGGCCAAGGCTCCACAGGG - Intergenic
963047823 3:141116249-141116271 GAGCTGACATGGACTCCACAAGG - Intronic
964526090 3:157616443-157616465 CAGGAAGCCTGGGCTCCACATGG - Intronic
965686966 3:171314413-171314435 GATCAGCCATAGGCTCTACATGG - Intronic
967796683 3:193605920-193605942 GAGTAGCCCTGGTATCCATAAGG + Intronic
968371704 3:198225933-198225955 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
968757723 4:2425653-2425675 GTGCAGGCCTGGGCTCCAGCTGG - Intronic
968984253 4:3866613-3866635 GCCCAGCCCTGGGCTCCCCATGG - Intergenic
969689177 4:8694831-8694853 GAGCAGACCTGGGCTGCCCGTGG + Intergenic
970354475 4:15238332-15238354 GAGCTGCCATTGGCTCCAAATGG - Intergenic
971059649 4:22953330-22953352 GAGCAGCTCAGAGCCCCACATGG + Intergenic
973701238 4:53539226-53539248 GAGCATCCCTCAGCTCCACTTGG - Intronic
975997146 4:80328998-80329020 AAGCCGTCCTGGGCTGCACATGG - Intronic
979260392 4:118638411-118638433 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
983370946 4:166857245-166857267 GAGCTGCACTGAGCTCCTCAGGG + Intronic
983668321 4:170207583-170207605 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
985509500 5:304887-304909 GACCAGGCCTGGGCAGCACAGGG - Intronic
985517644 5:355141-355163 CAGCAGCCCTGGGCACCAGGAGG - Intronic
985550755 5:532394-532416 GAGCAGCTCTGAGCTCGACCAGG + Intergenic
985738774 5:1602003-1602025 GACCAGGCCTGGGCAACACAGGG + Intergenic
985823724 5:2178261-2178283 GAGCAGCACAGGGCTCTACGGGG - Intergenic
985912858 5:2896885-2896907 CAGCAGAGCTGGGGTCCACAAGG - Intergenic
986653888 5:9991231-9991253 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
987074602 5:14369228-14369250 AAGGAGCCATGGGCTCCACCTGG - Intronic
988583481 5:32489185-32489207 CTGCAGCCCTGGGTTCCACGTGG - Intergenic
989750192 5:44883988-44884010 GCGCAGCCCTAGCCTCCCCAAGG - Intergenic
991052948 5:62292035-62292057 GAGCTGCGGTGGGCTCCACCCGG - Intergenic
992738192 5:79744877-79744899 GAGCATCCCTGGCCTTCAGATGG - Intronic
992752220 5:79872091-79872113 AAGCTGCCCTGGTCTCCAAATGG - Intergenic
994093496 5:95828420-95828442 GACCAGTCCTGGCTTCCACAAGG + Intergenic
994350290 5:98737692-98737714 GAGCTGCCATGGGCTCCACCCGG - Intergenic
997646393 5:135484882-135484904 GGCCAGGCCTGGGCTCCACAAGG - Intergenic
998096024 5:139395900-139395922 GAACAGCCCTGTGCTCCCCCAGG + Intergenic
999239679 5:150120277-150120299 GACCAGCCCTGGGATGGACATGG - Intronic
999729395 5:154464752-154464774 GTTCTGCCCTGGGCACCACAAGG + Intergenic
1001552820 5:172616976-172616998 GAGCAGCCCTGGGTCTCTCAGGG - Intergenic
1002431741 5:179208058-179208080 TGCCAGCCCTGGGCTCCATAAGG - Intronic
1002432411 5:179211176-179211198 CAGCAGGGCTGGGCTACACAGGG - Intronic
1002465691 5:179407350-179407372 GCAGAGCCCTGGGCTCCAGATGG + Intergenic
1002495206 5:179607022-179607044 GACCAGCCCTGGGGAGCACATGG - Intronic
1002586017 5:180248644-180248666 CAGCAGCTCTGGCCTCCCCATGG - Intronic
1002730944 5:181331479-181331501 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1002753589 6:142625-142647 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1002772161 6:299279-299301 GAGGAGACCTGGGAACCACAAGG - Intronic
1003533093 6:6954092-6954114 GAGTGGCCCTGGGCCCCACCAGG + Intergenic
1005682253 6:28218672-28218694 GCACAGCCTTGGGCTCCAGAAGG + Intergenic
1005716463 6:28553966-28553988 GAGCAGCCCTCAGCTTCACAGGG - Intergenic
1006798576 6:36745602-36745624 CAGCAGGCCTGGGCTCCCCCAGG + Intronic
1007144094 6:39609851-39609873 GCACATTCCTGGGCTCCACATGG + Intronic
1007930911 6:45689872-45689894 GACCAGGCCAGTGCTCCACAGGG + Intergenic
1008339189 6:50344225-50344247 GAGCTGCGATGGGCTCCACAGGG - Intergenic
1008677537 6:53836116-53836138 GAGCTCCTCTGTGCTCCACAAGG - Intronic
1008789410 6:55211962-55211984 GAGAAGCCCTGTGCTAAACAGGG - Intronic
1010136169 6:72555659-72555681 TAGCTGCCCTGGGCTCCGCAGGG - Intergenic
1011545995 6:88481925-88481947 GAGCACCCCTTGGCTCCACCAGG - Intergenic
1011739140 6:90342094-90342116 GAGCTCCCCTGGGGTTCACAGGG + Intergenic
1013532189 6:111030175-111030197 GTGCAGCCCTGGGTTCCAGCTGG - Intergenic
1017419723 6:154261222-154261244 GACCAGCCCTGGGCAACATAGGG - Intronic
1018426487 6:163687694-163687716 CAGCAGCCCTGTCCTCCCCATGG + Intergenic
1018784544 6:167098032-167098054 CAGCCGCCCTGAGCTCCAAAAGG - Intergenic
1019143082 6:169960637-169960659 GAACAGCGCAGGGCTCCTCACGG - Intergenic
1019174128 6:170151417-170151439 GGGAAGCCCTGGGCTCATCATGG + Intergenic
1019185145 6:170216450-170216472 GGGGAGCACTGGACTCCACACGG + Intergenic
1019185469 6:170217958-170217980 GGGGAGCACTGGACTCCACACGG + Intergenic
1019186012 6:170220676-170220698 GGGGAGCACTGGACTCCACACGG + Intergenic
1019410464 7:904529-904551 GGGCAGCCCCGGGCCCCACACGG + Intronic
1019968936 7:4524624-4524646 GACCAGCCCTGGGCAACATAGGG + Intergenic
1020233511 7:6338482-6338504 GTGTAGCCCTGGGTTCCAGAGGG + Intronic
1020619590 7:10501451-10501473 GAGCTGTGCTGGGCTCCACCCGG - Intergenic
1021248970 7:18300108-18300130 AAGCCACCCTGGGCTGCACATGG - Intronic
1021970828 7:25964395-25964417 GAGCAGCTCTGGGATTCAAAGGG + Intergenic
1022531207 7:31068033-31068055 GAGCAGATCTGGGCTTCAGAGGG + Intronic
1022551474 7:31243764-31243786 GACCAGCCCTGGGCAACATAAGG - Intergenic
1023068315 7:36402051-36402073 GAGTAGCCCTGCTCTGCACAGGG + Intronic
1023402108 7:39798011-39798033 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1023455997 7:40339375-40339397 GAGCTGCGGTGGGCTCCACCTGG + Intronic
1024076087 7:45818641-45818663 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1024632759 7:51262922-51262944 CAGCAGCCCTGGGCTGCATCTGG + Intronic
1025051349 7:55737144-55737166 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1025060117 7:55798399-55798421 GAGGAGCCCTGGGCCCCTCAGGG + Intronic
1025128316 7:56362811-56362833 GAGGAGCCCTGGGCCCCTAAGGG + Intergenic
1025176699 7:56805692-56805714 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1027866622 7:83656154-83656176 TACCAGTCCTGGCCTCCACATGG - Intergenic
1028416881 7:90590054-90590076 GACCAGCCCTGGGCAACATAGGG - Intronic
1028963768 7:96778718-96778740 GAGCTGCCCTGTGCTCTGCAAGG - Intergenic
1031495706 7:122445617-122445639 GAGTAGCCCTGGGCAACATAGGG + Intronic
1032052622 7:128658404-128658426 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1034048922 7:147960726-147960748 GAGAGTCCCTGGGCACCACAGGG - Intronic
1035308208 7:157946994-157947016 GAGCAGCCCTGGCCTGCCCTGGG + Intronic
1035388161 7:158488500-158488522 GACCAGCCCTGGGTTCCGGATGG - Intronic
1035524599 8:302548-302570 CAGCTCCCCTGGGCTTCACATGG - Intergenic
1036149805 8:6286740-6286762 GAGCTGCCAGGGGCTCTACATGG + Intergenic
1037252635 8:16914789-16914811 GACCAACCCTGAGGTCCACAAGG + Intergenic
1037799558 8:22025014-22025036 GCGCAGCCCGGGGCTCGACCGGG - Exonic
1040612385 8:48998107-48998129 GAGCTGCAGTGGGCTCCACCCGG - Intergenic
1040803603 8:51370257-51370279 ACGCAGCCCTGGCCTCTACACGG + Intronic
1041463211 8:58133809-58133831 CAGCAGACGTGGGCTCCACTGGG - Intronic
1043497944 8:80823432-80823454 GAGCTGCAGTGGGCTCCACCAGG - Intronic
1046769947 8:118108937-118108959 GAGCAGCCTTGTGCTACCCAGGG - Intronic
1047089589 8:121558831-121558853 GAACAGCATTGAGCTCCACAGGG + Intergenic
1047429592 8:124779576-124779598 GACCAGCCCTGGGCAACATAGGG - Intergenic
1048289756 8:133171711-133171733 GACCAGCCCAGGGACCCACAGGG + Intergenic
1048292220 8:133189898-133189920 GTCCAGCCCTGTGCTCCCCATGG - Intergenic
1048999236 8:139814155-139814177 CAGCAGCCCTGTGCTCCGCGAGG + Intronic
1049044954 8:140142431-140142453 CAGCAGCCCCGGTGTCCACATGG + Intronic
1049249907 8:141582756-141582778 GAGCAGCAGCGGGCTCCGCAGGG + Intergenic
1049633672 8:143673944-143673966 GAGCGGCTTTGGCCTCCACAAGG - Intergenic
1049647642 8:143742804-143742826 CAGCAGCCCTGGGCCACACTGGG + Intergenic
1049714869 8:144085084-144085106 GGGCACCCCCGGGCTCCTCAAGG - Exonic
1049720057 8:144111546-144111568 GGGCAGGCCTGGGATCCCCATGG + Intronic
1049805145 8:144535423-144535445 GAGGGGCCCTTGGTTCCACATGG - Intronic
1052082999 9:24230157-24230179 GAGCAGTGGTGGGCTCCACCCGG + Intergenic
1052915432 9:33921631-33921653 CAGAAGCCCTGGACTTCACAGGG - Intergenic
1053321315 9:37101360-37101382 GAACAGGCCAGAGCTCCACAAGG - Intergenic
1055484039 9:76739599-76739621 GAGCTGCCCTAGGCTTCACTTGG - Intronic
1055502674 9:76917103-76917125 CAGCAGCCTTGCCCTCCACATGG - Intergenic
1057230462 9:93318604-93318626 GAGCTGCACTTGTCTCCACAGGG - Intronic
1057870422 9:98712540-98712562 GAGCAGCCCTGGGTGGCACAGGG - Intergenic
1057966446 9:99508543-99508565 GAGTAGGCCTGGACTGCACAAGG - Intergenic
1058446900 9:105062745-105062767 GAGCAGCTCTGAGTTCCTCACGG - Intergenic
1058941955 9:109821734-109821756 GAGCTGCCCTGTGCTGCCCAAGG + Intronic
1059331178 9:113536703-113536725 GCCCATCCCTGGGCTCCAGAGGG - Intronic
1060824031 9:126677298-126677320 GAGCTCCCCTGGGCTCAGCATGG + Intronic
1061305411 9:129729902-129729924 GAGCCTCCCTTGGCTCCCCAGGG + Intergenic
1061973492 9:134056842-134056864 GACCAGCCCTCGGCCCCAGAGGG - Intronic
1062043192 9:134413580-134413602 GCCCAGCCCTGGGCTGCACAAGG + Intronic
1062047155 9:134429698-134429720 GTGCAGCCCTTTGCTCCACTGGG - Intronic
1062370169 9:136234730-136234752 GAGCAAGGCTGGTCTCCACAAGG + Intronic
1062539771 9:137036373-137036395 GAGCTGCCCTGGGGCCCCCAGGG - Exonic
1062711263 9:137976355-137976377 GAGCCCCCCTGAGCTCCACTGGG - Intronic
1062755350 9:138283986-138284008 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1203774078 EBV:63116-63138 CAGCAGCCCTGCGCGCCAGACGG - Intergenic
1203579263 Un_KI270745v1:28158-28180 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1186185031 X:7012422-7012444 GAGATCCCCTTGGCTCCACAAGG + Intergenic
1186618608 X:11214925-11214947 GGGCAGCCCGGTGCTTCACACGG - Intronic
1190534983 X:51417147-51417169 GACCACCTCTGGGATCCACATGG - Intergenic
1195200607 X:102546999-102547021 GAGCATCCCTGGGCTCCTTCTGG + Intergenic
1195469847 X:105219494-105219516 AGGCAGCCCTGGCCTCCACGTGG + Exonic
1195469863 X:105219536-105219558 GGGCAGCCCCAGCCTCCACAGGG + Exonic
1195469873 X:105219557-105219579 GGGGAGCCATGGCCTCCACAGGG + Exonic
1195750157 X:108156399-108156421 GAGCAAGACTGGGCCCCACATGG - Exonic
1195833712 X:109089005-109089027 GAGCTGCAGTGGGCTCCACCTGG + Intergenic
1197766267 X:130061019-130061041 AAGCAGCCCTGGGCTCCTCATGG + Intergenic
1197992355 X:132331865-132331887 GGGCAGCCCTGGGCTCTAGCAGG + Intergenic
1198560936 X:137849343-137849365 GACCAGCCCTCCACTCCACATGG + Intergenic
1201752213 Y:17445369-17445391 GAGCTGCAGTGGGCTCCACCTGG + Intergenic
1202342914 Y:23888287-23888309 AAGCAGCCCATGGCTCCCCATGG - Intergenic
1202381871 Y:24280780-24280802 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1202488913 Y:25389345-25389367 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1202527854 Y:25781798-25781820 AAGCAGCCCATGGCTCCCCATGG + Intergenic