ID: 1163692687

View in Genome Browser
Species Human (GRCh38)
Location 19:18745921-18745943
Sequence ACACCGCCGGCCCCTGTCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163692681_1163692687 4 Left 1163692681 19:18745894-18745916 CCGGGAGCGTGGCCGGCTCGGCT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 78
1163692682_1163692687 -8 Left 1163692682 19:18745906-18745928 CCGGCTCGGCTCCCCACACCGCC 0: 1
1: 0
2: 3
3: 26
4: 350
Right 1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 78
1163692675_1163692687 28 Left 1163692675 19:18745870-18745892 CCATGGGCTGGTGGACAGGGTGT 0: 1
1: 1
2: 2
3: 30
4: 257
Right 1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163692687 Original CRISPR ACACCGCCGGCCCCTGTCAG TGG Exonic
900350392 1:2231718-2231740 ACACAGCCTGGCCCTGGCAGTGG + Intronic
900466413 1:2827689-2827711 ACCCTGCAGGACCCTGTCAGTGG - Intergenic
901758074 1:11453508-11453530 ACACCACCAGCCACTGTCAATGG + Intergenic
903813426 1:26047049-26047071 ACACAGAGGGCACCTGTCAGAGG - Intergenic
915066320 1:153227950-153227972 ACACCTCCTGTCCCTGTCTGGGG - Intergenic
915105532 1:153533230-153533252 CCACGGCGGGCCCCTGCCAGAGG + Intergenic
916428110 1:164700862-164700884 ACACAGCAGGCAACTGTCAGAGG - Intronic
922775595 1:228213034-228213056 ACACCTCTCGCCCCTGTCTGTGG - Intronic
924017424 1:239742605-239742627 ACACCGCCAGCCCCACTCAAGGG + Intronic
1063035368 10:2281559-2281581 AGACCCCTGGCTCCTGTCAGAGG + Intergenic
1069708361 10:70473418-70473440 AGACAGCTGGCCCCTGTCTGAGG - Intergenic
1073132120 10:101196332-101196354 ACAGCCCCAGCCCCTGACAGGGG + Intergenic
1073556659 10:104459614-104459636 ACACCACTGGGGCCTGTCAGGGG - Intergenic
1075085813 10:119413788-119413810 ACAACGCCTGCCTCTCTCAGGGG + Intronic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1076884412 10:133255218-133255240 AGACCCCCAGCCCCTGGCAGCGG - Intergenic
1085622866 11:78050433-78050455 CCACGGCCAGGCCCTGTCAGAGG - Intronic
1089732322 11:120527075-120527097 ACACAGCCAGCCCGTGGCAGAGG + Intronic
1090211002 11:124921102-124921124 AGACCGCGGGCGCCTCTCAGGGG + Exonic
1099954796 12:89343302-89343324 CCAGCCCCGGCCCCTGGCAGAGG + Intergenic
1108696404 13:52906272-52906294 ACACAGCTGGCTCCTGCCAGGGG + Intergenic
1112659531 13:101491785-101491807 ACACACCGGGGCCCTGTCAGGGG - Intronic
1113491517 13:110695937-110695959 ACACACCCGGCGCCTGTCAGGGG - Intronic
1113521747 13:110946539-110946561 CCACAGCCGGCCGCTGTGAGGGG - Intergenic
1117718166 14:58602094-58602116 ACACCCCCGACCCCTGCCAATGG + Intergenic
1119422453 14:74515707-74515729 ACACAGGAGGCACCTGTCAGTGG + Intronic
1121110988 14:91313049-91313071 ACACAGGCGGCGCCTGTAAGGGG - Intronic
1121358118 14:93231891-93231913 ACCCCCCCGACCCCTGTCCGTGG + Intergenic
1124709937 15:31999748-31999770 ACACACCCGGCGCCTGTCAGTGG + Intergenic
1125546633 15:40511213-40511235 ACGCCGCAGGCTCATGTCAGCGG + Intergenic
1127855878 15:62953287-62953309 ACACCGACGGCGCCTGCCGGCGG + Intergenic
1128385729 15:67146989-67147011 ACCCCGCCAGGCCCTGCCAGGGG + Intronic
1132632288 16:924583-924605 ACACCATCGGCCACTGTCAGGGG + Intronic
1132926660 16:2433287-2433309 GCACCACGGGCCCGTGTCAGTGG - Intronic
1134189383 16:12109534-12109556 CCACAGCAGCCCCCTGTCAGTGG + Intronic
1136158760 16:28403805-28403827 ACACCGCAGGGCCCTGACAGCGG + Exonic
1136204328 16:28711478-28711500 ACACCGCAGGGCCCTGACAGCGG - Exonic
1139365554 16:66430238-66430260 ACACTGCAGGCCACTGGCAGAGG - Intronic
1139512546 16:67435826-67435848 ACACCACCAGCACCGGTCAGTGG + Exonic
1140462207 16:75148800-75148822 GCCCCGCCGGCCCCGTTCAGAGG - Intronic
1141317399 16:82975351-82975373 ACACTGCCTGCCACTGTCTGGGG - Intronic
1143512243 17:7403336-7403358 ACACAGCCTGGCCCTGTTAGGGG - Exonic
1146353138 17:32112631-32112653 AGATCGCCGGCCCCAGTGAGCGG - Intergenic
1148031912 17:44627762-44627784 ACACCCCAGGCCCCAGTCAGAGG + Intergenic
1151470840 17:74316810-74316832 ACACCGAAGGCCCCTGTGAGAGG + Intergenic
1157284086 18:46365261-46365283 AAACCCACGCCCCCTGTCAGTGG + Intronic
1159014862 18:63093084-63093106 TCCCCCCCGGCCCCTGTCCGTGG + Intergenic
1160927067 19:1551771-1551793 ACACCCCTGGCCCCTGGCTGGGG + Intergenic
1161396111 19:4045768-4045790 CCAACCCCGGCCCCTGTCCGTGG + Exonic
1161627318 19:5334850-5334872 AACCTGCCGTCCCCTGTCAGCGG - Intronic
1161769019 19:6221478-6221500 ACAAGGCCGGTCCCTGACAGGGG + Intronic
1162339795 19:10085732-10085754 ACACTGCCTGCCCCTATCAAGGG + Intergenic
1163692687 19:18745921-18745943 ACACCGCCGGCCCCTGTCAGTGG + Exonic
1165455556 19:35908459-35908481 TCACCTCCGTCCCCAGTCAGGGG + Intergenic
1168327364 19:55545159-55545181 GCCCCGCCTGCCCCTGTCTGTGG + Intronic
927858232 2:26540636-26540658 CCACCCCCGGCCCTCGTCAGAGG - Intronic
938562751 2:132489282-132489304 ACAGCGCCGGCGCCTGCCAATGG - Intronic
944507675 2:200429564-200429586 CCACCTCCCGCCACTGTCAGTGG - Intronic
1172013118 20:31857928-31857950 GCACCACCGGCCCCTCTCAGAGG - Intronic
1172756865 20:37291602-37291624 ACACAGCCGAACCCTATCAGTGG - Intronic
1180062055 21:45390636-45390658 GAACCGCCGGCCCGTGGCAGCGG + Intergenic
1183455673 22:37921962-37921984 GCACCGCCGACACCTGGCAGGGG - Exonic
1183506189 22:38210243-38210265 ACAGTGGCTGCCCCTGTCAGGGG + Intronic
956258585 3:67311585-67311607 ACATCACCAGCCCTTGTCAGTGG - Intergenic
971258120 4:25031604-25031626 ACCCCACCCGCCCCAGTCAGAGG + Intergenic
978741763 4:112145454-112145476 GCTCCGGCGGCTCCTGTCAGCGG + Exonic
980379480 4:131993178-131993200 ACACAGCGGGCACCTGACAGAGG + Intergenic
985693327 5:1325634-1325656 TCACTGCGGGCCTCTGTCAGGGG - Intronic
985982067 5:3478558-3478580 ACAACGCTGGGGCCTGTCAGGGG - Intergenic
986421289 5:7586602-7586624 GCACGGCGGGCTCCTGTCAGCGG - Intronic
996373286 5:122775344-122775366 CCACCTCCGGTGCCTGTCAGAGG + Intronic
1002067438 5:176658991-176659013 TCACAGCCAGCGCCTGTCAGGGG - Exonic
1003272537 6:4620052-4620074 ACACCGAAGGCCCTGGTCAGTGG - Intergenic
1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG + Intronic
1007416511 6:41694372-41694394 ACCCTGCCAGCCTCTGTCAGGGG - Intronic
1029269234 7:99366855-99366877 ACACAGCCAAGCCCTGTCAGAGG + Intronic
1035313958 7:157986825-157986847 AAACCGGCAGCTCCTGTCAGTGG - Intronic
1044111568 8:88281711-88281733 ACAAGGCTGCCCCCTGTCAGGGG + Intronic
1056828794 9:89897131-89897153 ACACCACCTGCCCCTGCCTGGGG + Intergenic
1056963098 9:91143827-91143849 ACACCCACGGCCCCAGGCAGAGG + Intergenic
1057243162 9:93430684-93430706 TCAGCGCCTGCCCCTCTCAGAGG + Intergenic
1060933257 9:127502136-127502158 ATTCCGCCGGCCCCTGCCGGAGG - Intronic
1061811194 9:133163602-133163624 GCGCCGCCGGCCCCAGTCCGTGG + Intronic
1062022997 9:134327825-134327847 CCACCGCCTGCCCCGGTCACGGG - Intronic
1186389840 X:9148011-9148033 ACAAAGCCGGCTTCTGTCAGTGG - Intronic
1190916473 X:54814822-54814844 ACACAGCCTGCCCCAGCCAGGGG - Intronic
1199559886 X:149151200-149151222 ACACTGCAGGCCCATGCCAGGGG + Intergenic