ID: 1163695054

View in Genome Browser
Species Human (GRCh38)
Location 19:18759867-18759889
Sequence TGTGCTTGGGAAACCACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163695054_1163695062 -6 Left 1163695054 19:18759867-18759889 CCAACAGTGGTTTCCCAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1163695062 19:18759884-18759906 AGCACACGGCACCTGATGGGGGG 0: 1
1: 0
2: 1
3: 3
4: 93
1163695054_1163695060 -8 Left 1163695054 19:18759867-18759889 CCAACAGTGGTTTCCCAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1163695060 19:18759882-18759904 CAAGCACACGGCACCTGATGGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1163695054_1163695057 -10 Left 1163695054 19:18759867-18759889 CCAACAGTGGTTTCCCAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1163695057 19:18759880-18759902 CCCAAGCACACGGCACCTGATGG 0: 1
1: 0
2: 0
3: 8
4: 119
1163695054_1163695059 -9 Left 1163695054 19:18759867-18759889 CCAACAGTGGTTTCCCAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1163695059 19:18759881-18759903 CCAAGCACACGGCACCTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1163695054_1163695061 -7 Left 1163695054 19:18759867-18759889 CCAACAGTGGTTTCCCAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1163695061 19:18759883-18759905 AAGCACACGGCACCTGATGGGGG 0: 1
1: 0
2: 0
3: 11
4: 100
1163695054_1163695063 -3 Left 1163695054 19:18759867-18759889 CCAACAGTGGTTTCCCAAGCACA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1163695063 19:18759887-18759909 ACACGGCACCTGATGGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163695054 Original CRISPR TGTGCTTGGGAAACCACTGT TGG (reversed) Intronic