ID: 1163695294

View in Genome Browser
Species Human (GRCh38)
Location 19:18760727-18760749
Sequence TCGCCCGTCCCAATAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163695284_1163695294 21 Left 1163695284 19:18760683-18760705 CCTTTCTTCCTCAGCCACATCCA 0: 1
1: 0
2: 5
3: 49
4: 543
Right 1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1163695283_1163695294 28 Left 1163695283 19:18760676-18760698 CCACACTCCTTTCTTCCTCAGCC 0: 1
1: 0
2: 3
3: 98
4: 894
Right 1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1163695287_1163695294 13 Left 1163695287 19:18760691-18760713 CCTCAGCCACATCCACAGGGACG 0: 1
1: 0
2: 2
3: 24
4: 287
Right 1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1163695288_1163695294 7 Left 1163695288 19:18760697-18760719 CCACATCCACAGGGACGTCGCAC 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1163695290_1163695294 1 Left 1163695290 19:18760703-18760725 CCACAGGGACGTCGCACAGGCCC 0: 1
1: 0
2: 2
3: 11
4: 150
Right 1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163695294 Original CRISPR TCGCCCGTCCCAATAGCTCC TGG Intronic
902179446 1:14676783-14676805 TCTCCCCTCCCCATAGCTCCTGG - Intronic
905014127 1:34765431-34765453 TCACCTGGCCCAAGAGCTCCTGG - Intronic
912916831 1:113823918-113823940 TCTCCCTACCCAAAAGCTCCAGG - Intronic
916378966 1:164187730-164187752 TCTCCTGTCCCAATTCCTCCAGG - Intergenic
921320433 1:213933263-213933285 TCCCCCATCTCAATAGCTCAGGG + Intergenic
924537139 1:244945342-244945364 TTTCCCTTCCCCATAGCTCCAGG - Intergenic
1063796371 10:9517706-9517728 TCGCCCTTCCCAGTGGCCCCTGG - Intergenic
1073125654 10:101147172-101147194 TCGCCCCGCCCCATAACTCCTGG - Intergenic
1074448180 10:113537700-113537722 TCACCCCTCCCAAAGGCTCCAGG + Intergenic
1075919485 10:126198427-126198449 TGGCCCCTCCCAATGGCTCCAGG - Intronic
1077210685 11:1369774-1369796 TCTCCCATCCCAATAGCTTTGGG - Intergenic
1081326124 11:41747225-41747247 TTCCCTGTCCCAACAGCTCCTGG - Intergenic
1089679504 11:120111384-120111406 TCTCCCGTCTCAACAGCCCCAGG - Exonic
1091281793 11:134385763-134385785 TCGCCCTTCCCATTGGCTTCAGG + Intronic
1091640519 12:2233601-2233623 TTCCCTGTCCCAGTAGCTCCTGG + Intronic
1092697562 12:11190690-11190712 TCCCACCTCCCAATACCTCCAGG + Intergenic
1094172544 12:27508907-27508929 CTGCCTGTCCCAATAGCTTCTGG + Intergenic
1094442338 12:30492422-30492444 TTGAAAGTCCCAATAGCTCCAGG - Intergenic
1110482597 13:75997758-75997780 TCTCCCCTCCCTCTAGCTCCTGG + Intergenic
1114536668 14:23427292-23427314 TTGCCCTTCTCAATAGCTGCAGG + Exonic
1129593288 15:76936941-76936963 TCCCTCCTCCCACTAGCTCCTGG + Intronic
1136112870 16:28075805-28075827 TCGGCCATCCCACTAGCCCCAGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG + Intronic
1168252048 19:55146944-55146966 CCTCCCCTCCCAAGAGCTCCTGG + Intronic
927405725 2:22764235-22764257 TTCCCCTTCCCAATAGTTCCTGG + Intergenic
927890227 2:26743508-26743530 TCACCTGTCCCGATCGCTCCCGG - Intergenic
930144289 2:47985538-47985560 TCTCCCCTCCCACCAGCTCCTGG + Intergenic
936980060 2:118255816-118255838 TCTCCCTTCCCAATTGGTCCAGG - Intergenic
937025524 2:118694078-118694100 TCTCCCGTCCCCGCAGCTCCTGG + Intergenic
938145979 2:128835262-128835284 TCATCCATCCCAACAGCTCCAGG + Intergenic
946065810 2:216986200-216986222 TCCCCTGCCCCAGTAGCTCCTGG + Intergenic
1175148736 20:56916356-56916378 TCACCTGTCCAAATGGCTCCTGG + Intergenic
1181082621 22:20424909-20424931 TTGGCCGTCCCAATAGAGCCCGG - Exonic
1182308546 22:29388424-29388446 CCGCAGGTCCCAATAGCTCCCGG + Exonic
963061565 3:141231159-141231181 TCGCCCTTCCCACCTGCTCCCGG - Intronic
965325754 3:167301663-167301685 GCGCCCGTCCAAATATGTCCAGG - Intronic
1012411799 6:98966992-98967014 TACCCCATCCCAATAGCTCTGGG + Intergenic
1014169869 6:118266979-118267001 TCATCCCTCCCAATAGCTCCTGG + Exonic
1019598412 7:1869136-1869158 TCGCCCGCCCCCATGGCTGCCGG + Intronic
1021912713 7:25402334-25402356 TTGACCCTCCCAATAACTCCAGG + Intergenic
1040292475 8:46132480-46132502 TCTCCCATCCCAGAAGCTCCAGG - Intergenic
1040304460 8:46204923-46204945 TCTCCCATCCCAGAAGCTCCCGG + Intergenic
1040342583 8:46448400-46448422 TCTCCCTTCCCAGAAGCTCCTGG - Intergenic
1058298781 9:103343349-103343371 TGGCCACTCCCAAAAGCTCCAGG - Intergenic
1060208788 9:121698415-121698437 TCCCCCATCCCAAGAGCTCCTGG - Intronic
1060473535 9:123968515-123968537 TCCCCCCTCCCTCTAGCTCCTGG + Intergenic
1060972214 9:127744789-127744811 TAGCCTCTCCCCATAGCTCCTGG + Exonic
1061089943 9:128420827-128420849 TCGGCCGGCCCGAGAGCTCCGGG + Exonic
1187492570 X:19765717-19765739 TCTCCCCTCCCACCAGCTCCTGG + Intronic
1191776450 X:64819762-64819784 TCACCCTTCCCAATAGGCCCTGG - Intergenic