ID: 1163698262

View in Genome Browser
Species Human (GRCh38)
Location 19:18774791-18774813
Sequence GGCCCCTGGAACCTCCCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163698262_1163698268 1 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698268 19:18774815-18774837 CTTGTCTTCCAGCCGGGCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 113
1163698262_1163698264 -6 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698264 19:18774808-18774830 GGGGCCTCTTGTCTTCCAGCCGG 0: 1
1: 0
2: 2
3: 23
4: 182
1163698262_1163698265 -5 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698265 19:18774809-18774831 GGGCCTCTTGTCTTCCAGCCGGG 0: 1
1: 0
2: 1
3: 23
4: 302
1163698262_1163698272 22 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698272 19:18774836-18774858 GGAGGTGCCGACTTCCCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 94
1163698262_1163698267 0 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698267 19:18774814-18774836 TCTTGTCTTCCAGCCGGGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 166
1163698262_1163698274 29 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698274 19:18774843-18774865 CCGACTTCCCACCTGGCCTCAGG 0: 1
1: 0
2: 1
3: 31
4: 185
1163698262_1163698269 4 Left 1163698262 19:18774791-18774813 CCGTCTGGGAGGTTCCAGGGGCC 0: 1
1: 1
2: 1
3: 22
4: 263
Right 1163698269 19:18774818-18774840 GTCTTCCAGCCGGGCTTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163698262 Original CRISPR GGCCCCTGGAACCTCCCAGA CGG (reversed) Intronic
900569327 1:3350655-3350677 GGGCCCTGGGAGCACCCAGAAGG + Intronic
900635252 1:3661185-3661207 GGCCCCTGGAATATCTCAAAAGG - Intronic
900955968 1:5886714-5886736 AGCCCCTGGAACGTCCCAGGTGG + Intronic
901694038 1:10993277-10993299 GGCCACTATAAGCTCCCAGAGGG + Intergenic
901798448 1:11693526-11693548 GGAGCCTGGAACCTGCCAGCTGG - Intronic
901851580 1:12019489-12019511 GGCCCCTGGAACGGCTCAGGCGG + Exonic
902380280 1:16049381-16049403 GCCCCCTCCATCCTCCCAGAAGG - Intronic
903832526 1:26183584-26183606 GGCCCATGGAAGCCCCCAGGAGG + Intronic
905358693 1:37403298-37403320 GGTCCTTGGCACCTTCCAGAGGG - Intergenic
906097068 1:43231256-43231278 GCCTCCTGGCACCCCCCAGAAGG + Intronic
906379713 1:45324786-45324808 TGCCAGTGGTACCTCCCAGAAGG - Intergenic
907160830 1:52367538-52367560 AGCCCTTGGAACTTCTCAGAAGG + Intergenic
909549213 1:76879129-76879151 GTCTTCTGGAACCTCCCAGCTGG + Intronic
912330214 1:108813381-108813403 GGCCGCTGGAAGCTGCCAGCAGG - Intergenic
912710224 1:111944577-111944599 GGACCCTGGGGCCTCCCAGCAGG + Intronic
915144232 1:153785369-153785391 AGCCCCTGGAACCTCTAAGAAGG - Intergenic
915349241 1:155214190-155214212 AGCCCCTGGCACCACCTAGAGGG + Intergenic
915352428 1:155234817-155234839 AGCCCCTGGCACCACCTAGAGGG + Exonic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
916617009 1:166452261-166452283 GCCCTCTGGAAAATCCCAGATGG - Intergenic
920856418 1:209666189-209666211 GGGCCTTGGAACCAGCCAGAGGG + Intergenic
920989310 1:210921605-210921627 GACCTCAGGAACCACCCAGATGG - Intronic
924511073 1:244729749-244729771 GACTCCTGGAGGCTCCCAGATGG - Intergenic
1063099166 10:2934764-2934786 GGCCCCGGGAACTTCCCGGTTGG + Intergenic
1065323202 10:24527859-24527881 GGACACTGGGACCTCTCAGAGGG - Intronic
1066255009 10:33670249-33670271 GGCCCCTGGATCCTCTCAGTGGG - Intergenic
1067052006 10:43026948-43026970 GGCCCCTGCTTCCTCCCCGAGGG + Intergenic
1067535603 10:47107586-47107608 TGCCCCAGGAACCTCCCAGGTGG - Intergenic
1068617475 10:59135511-59135533 GGCCCCTGGATCCTGCCATATGG - Intergenic
1070543310 10:77432956-77432978 GGAGCCTTGAACCTCCCTGAAGG + Intronic
1070808786 10:79286857-79286879 GGCCCCTGGGGCCTCCCATGGGG + Intronic
1070957718 10:80475095-80475117 GGCCCTTGGCTCCTCCCACAGGG - Intronic
1072286351 10:93919703-93919725 GGACACTGGAGCCTTCCAGAGGG + Intronic
1072694960 10:97596312-97596334 GGCCCCTGGAACTGACCAGCAGG + Intronic
1072975480 10:100053810-100053832 GCTACCTGGAACCTCCTAGAAGG - Intronic
1073478846 10:103772768-103772790 GGCTCCTCGCCCCTCCCAGAGGG + Intronic
1073572948 10:104596361-104596383 GGCACCTGGAAGATCCCAGAAGG + Intergenic
1074141748 10:110679672-110679694 AGCCCCTGGATCCTCTCTGAAGG + Intronic
1076412529 10:130262210-130262232 GGGCCCAGGAACTCCCCAGAAGG - Intergenic
1076554940 10:131315141-131315163 GGCCCATGGTGCATCCCAGAGGG - Intergenic
1076771968 10:132670659-132670681 CCCCACTGGGACCTCCCAGAAGG - Intronic
1079354195 11:19716107-19716129 GGGACCTGGAAACTACCAGATGG - Intronic
1084724151 11:70929502-70929524 GGCCTCTAGAACCTGGCAGAGGG - Intronic
1087018683 11:93580027-93580049 GGCCCCAAGAACCTTCCAGCAGG - Intergenic
1087541948 11:99532086-99532108 AGCCCCTGAAACCAGCCAGAAGG + Intronic
1089295140 11:117462934-117462956 GGCCCCTGGAATTTCCAACAGGG - Intronic
1090183706 11:124722294-124722316 GGCCCCTCCAACTTCCAAGAGGG - Intergenic
1090859842 11:130643152-130643174 GGGCCCTGGGACCCCTCAGAAGG + Intergenic
1091049364 11:132353497-132353519 GGGCCCTGGCACATCACAGAAGG + Intergenic
1091850610 12:3693960-3693982 GGCCCCTGGAACCCAGCAGGAGG - Intronic
1094629316 12:32157612-32157634 GGCCCCTGCAACCACCCAACAGG - Intronic
1097138557 12:56879585-56879607 CGCCCCCCCAACCTCCCAGACGG - Intergenic
1097242118 12:57582700-57582722 GGCTCCAGGAACCTCCAAGTGGG - Intronic
1097993171 12:65858050-65858072 GGCCACTGGTTCCTCCCAGCTGG - Exonic
1100559917 12:95737865-95737887 GGCCCCAGGAACATTCCACATGG - Exonic
1102967860 12:117141815-117141837 GGCTCATGGAAGCTCCCAGATGG + Intergenic
1103723927 12:122988695-122988717 GGGGCCTGGGACCTCCCAGGAGG - Intronic
1103926829 12:124427845-124427867 GACCACAGGAAGCTCCCAGAAGG + Intronic
1104589730 12:130074731-130074753 GGCCCCTGACTTCTCCCAGAGGG + Intergenic
1107042849 13:35967236-35967258 GGCGCCCCCAACCTCCCAGACGG - Intronic
1108644613 13:52414526-52414548 GGTCCCTGGCACTTCCCAGAGGG + Exonic
1111439977 13:88268785-88268807 AGACACTGGAGCCTCCCAGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113994371 14:16053945-16053967 GGCACCTGGAAGCCCGCAGAGGG - Intergenic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1115509744 14:34127889-34127911 TCCCCCTGGGACCTCACAGAAGG + Intronic
1117088144 14:52222590-52222612 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
1117088699 14:52227647-52227669 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
1117438495 14:55740000-55740022 AGCCCCTGGGGCCTCCCACAAGG + Intergenic
1121650402 14:95553840-95553862 AGCCCCTGGAACTTCTAAGAAGG + Intergenic
1122769692 14:104092468-104092490 TGCCCCTGGGACCCCTCAGAGGG - Intronic
1122786349 14:104166008-104166030 GCCCCCAGGGAACTCCCAGAAGG - Intronic
1122836617 14:104433861-104433883 GGCCCCTGCTACCTCCCTGGAGG + Intergenic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1123869580 15:24557134-24557156 TGCCCCAGGGGCCTCCCAGAGGG + Intergenic
1125674101 15:41493613-41493635 GGCCCCTCCCACCTCCCCGAGGG + Intronic
1126007082 15:44268214-44268236 TCCCCCTGGTACCTCCAAGAAGG + Intergenic
1127865190 15:63026857-63026879 GGCACCTGGACCCTCCTAGCTGG + Intergenic
1129117981 15:73375852-73375874 TGCCCCTGGAAGCTCACAGTGGG + Intergenic
1129323914 15:74789617-74789639 GGCCCAGGGAACCTCCGAGCAGG - Intronic
1129459508 15:75693498-75693520 GGCTCCAGGAACCTCCAAGGAGG - Intronic
1129615298 15:77094512-77094534 GGCCCCCGGAAACTGCAAGAGGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130094020 15:80842889-80842911 GACCCCTGGGACCTCCTGGAAGG - Intronic
1130272479 15:82459185-82459207 GGCTCCAGGAACCTCCAAGGAGG + Intergenic
1130464832 15:84186538-84186560 GGCTCCAGGAACCTCCAAGGAGG + Intergenic
1130487857 15:84408266-84408288 GGCTCCAGGAACCTCCAAGGAGG - Intergenic
1130499434 15:84486999-84487021 GGCTCCAGGAACCTCCAAGGAGG - Intergenic
1130587122 15:85191152-85191174 GGCTCCAGGAACCTCCAAGGAGG + Intergenic
1131334300 15:91532846-91532868 GGCCACTGGAATGTCTCAGAAGG + Intergenic
1132011073 15:98277157-98277179 TGCCTCTGCAGCCTCCCAGATGG + Intergenic
1132421045 15:101669092-101669114 TGCCCCTGGAACCTTCCACTGGG + Intronic
1132652659 16:1028652-1028674 GGCACCTGGGACCTGCCGGAAGG + Intergenic
1133031968 16:3015444-3015466 GGGCCCTGGGACCCCCCCGAGGG + Exonic
1133477712 16:6139397-6139419 GTCTCCTGGAACATCCCACATGG - Intronic
1133755623 16:8760489-8760511 GTCCCCTGGCCCCTCCCAGGCGG - Intronic
1135112713 16:19703197-19703219 CTCCCCTAGAGCCTCCCAGAAGG - Exonic
1136526377 16:30834131-30834153 GGGCCTTGGAACCACCCAAAAGG + Exonic
1136686400 16:31997188-31997210 GAGCCCCGGAACCTCCCAGGAGG + Intergenic
1136787012 16:32940717-32940739 GAGCCCCGGAACCTCCCAGGAGG + Intergenic
1136882761 16:33913072-33913094 GAGCCCCGGAACCTCCCAGGAGG - Intergenic
1139257942 16:65561199-65561221 GTCCCCTGGAGCCACCCAGTAGG + Intergenic
1139947913 16:70654286-70654308 GGCCACTGGAGCCCCCCAGGAGG - Intronic
1141133026 16:81447763-81447785 GCCCCCTGGAGCCCACCAGAGGG - Intronic
1141552732 16:84816927-84816949 GACCCCTGGGAAGTCCCAGATGG - Intergenic
1141881901 16:86865847-86865869 GGGCACTGGCACCTCTCAGATGG + Intergenic
1203089250 16_KI270728v1_random:1202387-1202409 GAGCCCCGGAACCTCCCAGGAGG + Intergenic
1143118314 17:4592858-4592880 GGGGCCTGGGACCTCCCAGGAGG - Intronic
1143653346 17:8278045-8278067 CGCCCTTGGAACCTCTTAGAAGG - Intergenic
1145062008 17:19739464-19739486 GGCCCCAGGACCCTGGCAGAGGG + Intronic
1146594638 17:34157732-34157754 TGCCCCTGGAGCCTCAGAGAAGG + Intronic
1146678075 17:34787108-34787130 GGCCCCAGGCAACTCCCACATGG + Intergenic
1146726243 17:35158647-35158669 GCCCTCTGGAGCCTCACAGAAGG + Intronic
1148975946 17:51528334-51528356 GGCCCCCGTGGCCTCCCAGAAGG + Intergenic
1151763681 17:76121641-76121663 CGCAGCTGGAACCTCCGAGAAGG + Intergenic
1152573293 17:81129756-81129778 GGTCCCTGGCAGCTCCCAGCAGG + Intronic
1152739512 17:82012793-82012815 GGTCCCTGCCACCTCCCTGAGGG + Intronic
1152922773 17:83074029-83074051 TGCCCCTGGCACCACCCCGAAGG - Intergenic
1160523643 18:79522918-79522940 TGCCCCCAGATCCTCCCAGATGG - Intronic
1160738630 19:676110-676132 GGCCCCTCGATCCACCCAAAAGG + Intergenic
1161068753 19:2250354-2250376 GGCTCCTGGAACCTCAGCGAGGG - Exonic
1162094416 19:8302200-8302222 GGCCCCAGGCAGCTCCCAGGGGG - Exonic
1162440307 19:10688371-10688393 GGCCCCTGGTACTTACCTGATGG + Intronic
1162473868 19:10888297-10888319 GGCCCCCAGTACCTCCCAGCTGG + Intronic
1163602398 19:18257024-18257046 GGAATCTGGAACATCCCAGAGGG - Intergenic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1164599258 19:29549801-29549823 GGCCCCAGGAAGCTCGGAGACGG + Intronic
1165258182 19:34592544-34592566 GGCTCCTTGGACCTCCCAGGCGG - Intergenic
1165365446 19:35362417-35362439 GGCCACTTGAGCCTCCCAGGAGG - Intergenic
1165403547 19:35616970-35616992 GGCCACTGTCACCTCCCAGCTGG - Intronic
1166558839 19:43718881-43718903 GGCTCCTGGCAGGTCCCAGAGGG - Exonic
1168485687 19:56760140-56760162 GAGTCCTGGCACCTCCCAGAGGG - Intergenic
925183395 2:1831205-1831227 GACCCCTGGCTCCCCCCAGATGG + Intronic
926138495 2:10354341-10354363 GGCCCTGGGAAGCTTCCAGAAGG - Intronic
932465932 2:71924113-71924135 TGCACCTGGAACCTACCAGCAGG + Intergenic
932813407 2:74843141-74843163 GACCCCTGGAATTTCACAGAAGG + Intronic
933773679 2:85759107-85759129 TGCCCCTGGAGCTTCCCAGGGGG + Intronic
933837982 2:86261166-86261188 GGCCCCTAGCACCACACAGAAGG + Intronic
934670544 2:96209561-96209583 GGATCCTGGCACCACCCAGATGG + Intergenic
934714702 2:96536873-96536895 GGCACCTTGAACCTCCCTGCAGG - Intronic
936950674 2:117974600-117974622 GGCCCTGTGAACCTCCCAGCAGG + Intronic
937303089 2:120855224-120855246 GGTCCCTGGGAGGTCCCAGAGGG + Intronic
945268271 2:207912973-207912995 AGCCCTTGGAATCACCCAGATGG - Intronic
945440983 2:209879284-209879306 GGCCCCTGGAAGTTCCAGGATGG - Intronic
945959389 2:216116544-216116566 GGCCCCAGGGACCTGCCATAGGG + Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
947034641 2:225838236-225838258 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
947094321 2:226548897-226548919 CTCCCCTAGAGCCTCCCAGAAGG - Intergenic
947753188 2:232543351-232543373 GGTGCCTGAAACCTCCCAGGCGG + Exonic
1170627740 20:18042375-18042397 TGCCCCTGTAACCTCCCACGAGG - Intronic
1171861304 20:30405165-30405187 GGCGCCTCTCACCTCCCAGACGG - Intergenic
1172106862 20:32522191-32522213 GGCCCCTGGACTCTGCCAGTGGG - Intronic
1172549654 20:35789069-35789091 AGCCATTGGAACCTCCCTGAAGG - Intronic
1175883969 20:62277906-62277928 GGCCCCTGAAATTTCCGAGATGG - Intronic
1175981158 20:62739373-62739395 AGCCCCTGGAATCACACAGAAGG + Intronic
1176302639 21:5105847-5105869 GGGCCCTGGAAGGTTCCAGAAGG + Intergenic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1177363477 21:20103870-20103892 GTCTCCTGGACCCTCCCAGCTGG - Intergenic
1178680256 21:34668571-34668593 GGCCTCTGGAACCTCTCCGGGGG + Intergenic
1178749099 21:35283743-35283765 GGTCCCAGGACACTCCCAGAAGG + Intronic
1179646756 21:42780790-42780812 AGCCCCTGGAACGTCTAAGAAGG + Intergenic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1179854386 21:44156076-44156098 GGGCCCTGGAAGGTTCCAGAAGG - Intergenic
1179990660 21:44946824-44946846 GGACCATGGGACCTCACAGAGGG + Intronic
1180081894 21:45490906-45490928 GGGCGCTGGGACATCCCAGAAGG + Intronic
1180104991 21:45612703-45612725 GACCCCTGGGCTCTCCCAGAAGG + Intergenic
1180180155 21:46115164-46115186 GGCCACTGGAAGCTGCCACAGGG + Intronic
1180285433 22:10741476-10741498 GGTCCCTCGAACCCCCCTGACGG - Intergenic
1180312898 22:11253570-11253592 GGCACCTGGAAGCCCGCAGAGGG + Intergenic
1181058477 22:20270801-20270823 GGTCCCTGGCTCCTCCCACAAGG - Intronic
1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG + Intergenic
1182499930 22:30739365-30739387 GGCCCCAGGTGCCTCCCAGCAGG + Intronic
1182759003 22:32706897-32706919 GGCCCCTGGAATTCCCTAGAGGG + Intronic
1184291938 22:43502057-43502079 GCCTCCTGGAGCCGCCCAGATGG - Intronic
1184465672 22:44668109-44668131 GAACTCTGGAACCACCCAGAAGG + Intergenic
1184586075 22:45448941-45448963 GGCCCCTGGAACCTCCTGAGGGG + Intergenic
1184679211 22:46061431-46061453 GGCCCGCGGGACCTCCCAGCCGG - Intronic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185063358 22:48618644-48618666 TGCCTCCGGGACCTCCCAGACGG - Intronic
1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG + Intronic
1185333463 22:50261668-50261690 GGCACCTGGGACATCCCTGAGGG - Exonic
1185417876 22:50720105-50720127 GTCCCCAGGAACCTCTCCGAAGG + Intergenic
950707589 3:14792697-14792719 GGCTGCTGGAACCTCTGAGATGG + Intergenic
952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG + Intergenic
953658842 3:44875643-44875665 GCCCTCTGTAACCTCCCAGCAGG + Intronic
955618675 3:60837123-60837145 AGCCCCTGGAACTTCTAAGAAGG + Intronic
956952013 3:74293782-74293804 GGCCCATGGAACCTGCAAGAGGG - Intronic
959281614 3:104348503-104348525 GCCCCCTGGACCCTCCCATGAGG - Intergenic
961210185 3:125119547-125119569 TCCTCCTGGAACCTCCCAGCTGG + Intronic
961604177 3:128081593-128081615 GGCTCCTGGACCCTCTCTGATGG - Intronic
961629088 3:128283160-128283182 GGCACCTGGAAACACACAGAGGG + Intronic
962008344 3:131370141-131370163 GGCCAGTGGCACCTGCCAGAGGG + Intergenic
962010381 3:131385474-131385496 GGCCAGTGGCACCTGCCAGAGGG + Intronic
962404883 3:135092316-135092338 GGCCCCTGGCACCCAACAGAAGG - Intronic
966861247 3:184231901-184231923 GGCCCCAGGAATGTTCCAGAAGG + Intronic
968072545 3:195794953-195794975 GGGCCCAGGGACCTCCCAGAGGG - Intronic
968605858 4:1534995-1535017 GGCCCCTAGAACCTCCTCCAGGG + Intergenic
968688421 4:1976903-1976925 AGCCCCTGGAACCTCCAGGAGGG + Intronic
968932241 4:3587273-3587295 GGCCCTTGGATCCTCCCGGCTGG + Intronic
969119041 4:4893503-4893525 GACCCCTGGAGCCTCCAAAAAGG + Intergenic
969381804 4:6804954-6804976 TGCACCCGGAACCTCCAAGAAGG - Intronic
969720870 4:8892582-8892604 GGCCCCGGGCGCCTCCGAGAGGG - Intergenic
971273452 4:25172825-25172847 AGCCCCTGGAACTTCTAAGAAGG + Intronic
973850291 4:54955150-54955172 GCCCCCTAGAGCCACCCAGAAGG + Intergenic
975908883 4:79245712-79245734 GGCGCCCCCAACCTCCCAGAGGG - Intronic
979013533 4:115401338-115401360 AGCCCCTGGAACTTCTAAGAAGG + Intergenic
981334817 4:143558524-143558546 GCCCCTTGCCACCTCCCAGAAGG - Intergenic
982403438 4:154994510-154994532 GACCCCTGGACCCAGCCAGAAGG + Intergenic
982968593 4:161949056-161949078 CTCCCCTAGAACCTCCCAGAAGG - Intronic
983262192 4:165469398-165469420 GGCCCCTGGAAGCTGCCGGCTGG + Intronic
985767153 5:1786141-1786163 GACCCCTGGAAGCACCCATAGGG + Intergenic
986236278 5:5913888-5913910 GGTCCCTGGGGCCTCCCAGTGGG + Intergenic
986525052 5:8664675-8664697 GTCTTCTGGACCCTCCCAGATGG - Intergenic
987475678 5:18389519-18389541 CACCCCTGGAACCTTCCTGATGG - Intergenic
989089873 5:37719149-37719171 GACCACTGGAAATTCCCAGATGG - Intronic
995397373 5:111701732-111701754 AGCACCTGGAACCACCCATAAGG - Intronic
996480417 5:123969581-123969603 GGGCTCTGGAACATCCCACAAGG - Intergenic
997106368 5:131023721-131023743 GGCCCCTGGAACCAGCCCCAGGG + Intergenic
998132776 5:139659666-139659688 GCCCCCCGGAACCTCCCAGGAGG - Intronic
999410202 5:151343866-151343888 GGCCCCTGAAACATCCCCAAGGG + Intronic
1002067731 5:176660603-176660625 GGCCCAGGGACCCTCCTAGAGGG - Intergenic
1002077561 5:176717980-176718002 TGCACCTGGAACCTCCCCAAAGG + Intergenic
1003933851 6:10955447-10955469 GGGCCCTGAAAATTCCCAGAAGG - Intronic
1006499860 6:34451212-34451234 GGACCAGGGAGCCTCCCAGAAGG - Intergenic
1006822347 6:36907426-36907448 GGCACCAGGAAGCTCCCTGATGG + Intronic
1007182717 6:39941972-39941994 GGCCGCTGGCTTCTCCCAGAGGG - Intergenic
1008003347 6:46384089-46384111 GGGCCCTGGAACCTCATAGGAGG - Intronic
1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG + Intronic
1008909916 6:56721147-56721169 GGCCCCCCCCACCTCCCAGATGG + Intronic
1012202683 6:96425270-96425292 CACCCCTGGAACCTCCCACCAGG + Intergenic
1012518640 6:100093367-100093389 GGCCACTGGAACCTGCAACATGG - Intergenic
1013173649 6:107659603-107659625 GGCACCTGGACCCCTCCAGAGGG - Exonic
1013901309 6:115160148-115160170 GGCCTCTGGAAGCTTCAAGAAGG + Intergenic
1017290518 6:152730242-152730264 GGCCCTTGGAACTTCTAAGATGG - Intergenic
1017820298 6:158044225-158044247 ACCCCCTGGAACCTGGCAGATGG - Intronic
1018535258 6:164812463-164812485 GTCTTCTGGAACCTCCCAGCTGG + Intergenic
1019432943 7:1007773-1007795 GGCCACGGGAAGGTCCCAGAGGG + Intronic
1019463423 7:1173387-1173409 GGCCCCGGCAACCTGGCAGAGGG - Intergenic
1019920954 7:4163112-4163134 GGCCTCAGGAACCTCCCTGTGGG - Intronic
1020100251 7:5390425-5390447 GGCCCCAGAAGCCTCTCAGAAGG + Intronic
1020142447 7:5619999-5620021 GGCCCCTGTAACTTGCCGGATGG + Intergenic
1023073350 7:36459337-36459359 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1026397177 7:69967304-69967326 GTCCCCTGGTACCTCCCAGAAGG - Intronic
1026827159 7:73591611-73591633 ATCCACTGGAACCACCCAGAAGG - Intergenic
1028127452 7:87130078-87130100 TGCCCCTAGAACCGTCCAGAGGG - Intergenic
1033613137 7:142984816-142984838 GGCCTCTGGAACCTGGCAGGAGG - Intergenic
1034397764 7:150840168-150840190 GGCAACTGGAACCCACCAGAGGG + Intronic
1034529891 7:151689228-151689250 GGCCACTGGAGCCCCCCAGGAGG - Intronic
1034956619 7:155339112-155339134 GGCCCCAGGAAAATCCCAAAGGG - Intergenic
1036641275 8:10585566-10585588 GGGGCATGGAACCACCCAGAAGG - Intergenic
1039153197 8:34528919-34528941 GGCCCCCCTCACCTCCCAGACGG + Intergenic
1043419468 8:80084124-80084146 GGGGCCTGGTCCCTCCCAGAAGG - Intronic
1047411750 8:124629801-124629823 GGCCCCTGGTTCTTCCCAGATGG - Intronic
1048924057 8:139254833-139254855 TGCTCTTGGAACATCCCAGAAGG + Intergenic
1049282830 8:141759264-141759286 TGCCCCAGGAATTTCCCAGAGGG - Intergenic
1049354943 8:142182884-142182906 GGCCTCTGAAGCCTCCCAGCTGG - Intergenic
1049575229 8:143386719-143386741 GGCCCCTGCCACCTCTCAGGTGG - Intergenic
1049658402 8:143808931-143808953 GCCCCCTGGACCCTGCCAGGCGG - Exonic
1053362762 9:37501044-37501066 GGCCCCAGGAGCCTTCCAAATGG - Intronic
1056565985 9:87772573-87772595 GGCACCTGAAACCATCCAGAGGG + Intergenic
1057286947 9:93764417-93764439 GGTCCCTGGAAGCTGCCAGAAGG - Intergenic
1058440772 9:105004595-105004617 GACTCTTGGAACTTCCCAGAAGG + Intergenic
1059333061 9:113548641-113548663 GGCTCCAGGACTCTCCCAGATGG - Intronic
1060004915 9:119991561-119991583 CTCCCCTAGAACCTTCCAGAGGG + Intergenic
1060868877 9:127023168-127023190 GTCCACTGGCAGCTCCCAGAAGG + Intronic
1061488930 9:130934516-130934538 GGGGCTTGGAACCTCCCGGAGGG - Intronic
1061806985 9:133142179-133142201 TGCCCCTGGATCCTTCCTGAGGG - Intronic
1062097283 9:134709933-134709955 AGCCACTGGACCCTCCCACAGGG - Intronic
1062262447 9:135669756-135669778 GGCTCCTGGGGGCTCCCAGAAGG + Intergenic
1062323748 9:136003048-136003070 GGCTGCTGGAGCCTCCCAGCTGG + Intergenic
1062359099 9:136178999-136179021 GGACTCTGGAACCTCCCGGGGGG - Intergenic
1062501694 9:136854574-136854596 GGCCCATGGAACCGCTCGGAAGG + Exonic
1203784600 EBV:120430-120452 GGGCCCTGGCACCTCCGGGAGGG + Intergenic
1203793390 EBV:163368-163390 GGCCTCTGGACCCTCACAGTCGG + Intergenic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1185832029 X:3311358-3311380 ATCTCCTGGAGCCTCCCAGACGG - Exonic
1190096150 X:47482769-47482791 GGCCACTGGAAAATCCCACAGGG - Exonic
1191778528 X:64843977-64843999 AGCCCCTGCAACCTCCTGGAGGG - Intergenic
1192281732 X:69694922-69694944 GGCCCTTGGAACATCTCAAAAGG - Intronic
1192301462 X:69908151-69908173 GGCCACTGGGACCTCCAAGTTGG + Intronic
1193149337 X:78108307-78108329 CCCCCATGCAACCTCCCAGAAGG - Intronic
1193485652 X:82082991-82083013 GGCCCCTGGAACATCCAAAATGG - Intergenic
1195064988 X:101232476-101232498 GTCTCCTGGAGCCTCACAGATGG + Intronic
1195520611 X:105823822-105823844 GGCCCCTGGATTCTCCGAAAGGG + Intronic
1199524837 X:148781188-148781210 GGTCCCTGACACCTCCCAGCAGG - Intronic
1202370395 Y:24192135-24192157 GGCTCCAGGAACCTCCAAGAAGG - Intergenic
1202500389 Y:25477982-25478004 GGCTCCAGGAACCTCCAAGAAGG + Intergenic