ID: 1163698867

View in Genome Browser
Species Human (GRCh38)
Location 19:18777345-18777367
Sequence CAGCCACCGAGGACACCTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163698862_1163698867 -2 Left 1163698862 19:18777324-18777346 CCGACATGGTTCTGGCCGACCCA 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 114
1163698860_1163698867 0 Left 1163698860 19:18777322-18777344 CCCCGACATGGTTCTGGCCGACC 0: 1
1: 0
2: 1
3: 3
4: 36
Right 1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 114
1163698856_1163698867 28 Left 1163698856 19:18777294-18777316 CCCTCGACGGACTGCACATGCTC 0: 1
1: 0
2: 1
3: 3
4: 36
Right 1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 114
1163698857_1163698867 27 Left 1163698857 19:18777295-18777317 CCTCGACGGACTGCACATGCTCA 0: 1
1: 0
2: 1
3: 8
4: 59
Right 1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 114
1163698861_1163698867 -1 Left 1163698861 19:18777323-18777345 CCCGACATGGTTCTGGCCGACCC 0: 1
1: 0
2: 1
3: 8
4: 42
Right 1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163698867 Original CRISPR CAGCCACCGAGGACACCTTC CGG Exonic
900884030 1:5402887-5402909 CAGCCACCAAGGGCACTGTCTGG - Intergenic
903035868 1:20492180-20492202 CACACACTGAGGACCCCTTCGGG + Intergenic
907330649 1:53669169-53669191 CAGGCACAGAGGACATGTTCAGG - Intronic
913180178 1:116313218-116313240 AAGCCACTGAGCACATCTTCAGG + Intergenic
915399217 1:155610350-155610372 CTGCCCCCGAGGAGCCCTTCGGG + Intronic
915416332 1:155745930-155745952 CTGCCCCCGAGGAGCCCTTCGGG + Intergenic
919423526 1:197402218-197402240 CAGACACTGAGGACTCCTTGGGG - Intronic
923364152 1:233243323-233243345 CAGCCACTGAAGTCACCTTATGG + Intronic
1065739869 10:28787577-28787599 CAGGCACTGAGGACTCCTACAGG - Intergenic
1073440415 10:103549338-103549360 CAACCCCCGAGGACGCCCTCTGG + Intronic
1074530089 10:114291135-114291157 CAGCCTCTGAGGACCCCTTCAGG - Intronic
1077442985 11:2577403-2577425 CAGTCACCTGGGCCACCTTCCGG + Intronic
1078513731 11:12006515-12006537 CTGCCAGCGAGGACACCTCTGGG + Intronic
1088604216 11:111512806-111512828 CGGCCCCCGAGGACACCCCCGGG - Intergenic
1091554630 12:1563357-1563379 CAGCCACGGAGGACACGGTGGGG - Intronic
1092126093 12:6075873-6075895 CAGCCACCCAGGCCAACTCCAGG - Intronic
1092527088 12:9315899-9315921 AAGCCACCCTGGTCACCTTCTGG + Intergenic
1092540181 12:9415873-9415895 AAGCCACCCTGGTCACCTTCTGG - Intergenic
1094512860 12:31106583-31106605 AAGCCACCCTGGTCACCTTCTGG + Intergenic
1103949186 12:124542031-124542053 GGGCCAGCGAGGACACCTTTGGG + Intronic
1112307744 13:98290495-98290517 CAGCCATGGAGGACACCTTGCGG - Intronic
1113586202 13:111467790-111467812 CAGCCACCTAGGACACCTGCTGG - Intergenic
1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG + Intergenic
1122798703 14:104219114-104219136 CAGGCAGGGAGGACACCTCCTGG + Intergenic
1123059400 14:105587676-105587698 CAGCCACAGAGGTCACGCTCAGG + Intergenic
1123083731 14:105707907-105707929 CAGCCACAGAGGTCACGCTCAGG + Intergenic
1125298709 15:38231434-38231456 TGGCCACAGAGGAAACCTTCTGG - Intergenic
1127489083 15:59445157-59445179 CAGCAAACGCAGACACCTTCAGG - Intronic
1129518659 15:76172007-76172029 CAGGGACCAAGGACACCCTCTGG - Intronic
1132079139 15:98850307-98850329 CAGACACAGAGGAGGCCTTCAGG + Intronic
1132471609 16:106925-106947 CAGCCACCCAGGAGCCCCTCTGG - Intronic
1132796480 16:1726175-1726197 CTGCCACCGTGGTCACCCTCTGG - Intronic
1133171610 16:3985606-3985628 CAGCCCACGTGGAAACCTTCCGG - Intronic
1136025494 16:27465657-27465679 CAGCCACAGGGGTCACCTGCTGG + Intronic
1137546503 16:49408146-49408168 CAGACAGCGTGGACACCGTCAGG - Intergenic
1139434148 16:66926488-66926510 CAGCCACCCAGGGCACATCCAGG + Intergenic
1143889775 17:10093938-10093960 CAGCCATCAAGGTCCCCTTCTGG + Intronic
1145991694 17:29082957-29082979 CATCCACTAAGGAGACCTTCAGG - Intronic
1148158337 17:45436145-45436167 CTGCCTCCGAGGGCACCTTCGGG + Exonic
1148627129 17:49078163-49078185 CAGCCACGGAGGACCCCTGTTGG + Intergenic
1151826824 17:76528434-76528456 CCGCCACAGAGGCCTCCTTCGGG + Exonic
1156165862 18:34420574-34420596 CAGCTACTGGAGACACCTTCAGG - Intergenic
1157494829 18:48149269-48149291 CAGCCACCCAGCCCAGCTTCTGG - Intronic
1157761751 18:50270440-50270462 CAGCCTCCTAGAACACATTCAGG + Intronic
1160782640 19:884601-884623 CAGCCAGCGGGGACACCGTGAGG - Intronic
1161152628 19:2717672-2717694 CCACCATCGAGGACACCTACCGG - Exonic
1161451179 19:4346270-4346292 CAGCCACCCATGACACCAGCAGG - Intronic
1161535736 19:4817638-4817660 CAGCCACCGGGGACAGGCTCGGG + Exonic
1161578627 19:5068401-5068423 CAGGCCCCGAGGCTACCTTCTGG + Intronic
1161683937 19:5693990-5694012 CAGCCACAGAGGACACGCCCAGG + Intronic
1162839018 19:13341898-13341920 CAGCCCCCTAGGACAACATCTGG + Intronic
1163289704 19:16371250-16371272 CAGCCACCGAGGAAGCCCTGAGG - Intronic
1163507959 19:17719496-17719518 CAGCCACCGCCGCCATCTTCGGG - Exonic
1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164507783 19:28873843-28873865 CACCCGCCGATGAGACCTTCTGG + Intergenic
1165308084 19:35014242-35014264 CAGCCACCGGGGTCACTGTCTGG - Exonic
1166072744 19:40396407-40396429 CAGCCATCTCGGGCACCTTCGGG + Exonic
1166744682 19:45135611-45135633 CCGCCACAGAGGACAGCTTAGGG + Intronic
928324561 2:30309279-30309301 AAGGCCCCGAGGACACCTTCTGG - Intronic
929143507 2:38686862-38686884 CATCCAATGAGGACACCTGCAGG - Intronic
931983220 2:67716433-67716455 CAGCCAGCCAGGGCACCTTAGGG + Intergenic
932071529 2:68625606-68625628 TAGCCCCTGAGGACACTTTCAGG - Intronic
932275790 2:70451296-70451318 CAGACACAGAGGATACCCTCAGG - Intronic
933847436 2:86337319-86337341 TAGCCGCCGAGGACGCCTGCGGG - Intronic
937362588 2:121239282-121239304 CAGCCACCCAAGACAGCCTCTGG - Intronic
939158893 2:138561883-138561905 CAGACACTGAGGACTCCTTGAGG - Intronic
939884262 2:147664288-147664310 CAAACACCCAGTACACCTTCTGG - Intergenic
941463218 2:165794613-165794635 CTGCCTCCGAGGACCACTTCGGG + Exonic
946171347 2:217897855-217897877 CAGCCAATGAGGAGAACTTCCGG - Exonic
948593933 2:239067699-239067721 CAGCCACCGAGGGCTGCCTCAGG + Intronic
1170383423 20:15787473-15787495 CAGCCACGGGGGACTCCTACTGG - Intronic
1172273390 20:33667077-33667099 CCGACACCGACGCCACCTTCGGG - Exonic
1173504081 20:43573552-43573574 TAGCCACTGGGGACCCCTTCAGG - Intronic
1174443908 20:50577658-50577680 CAGCCACGGAAGAGACATTCTGG + Intronic
1177493354 21:21856899-21856921 CAGCCACTGAGGCCAACTTGAGG + Intergenic
1178690091 21:34743332-34743354 CAGACACCAAGAACACCTCCAGG - Intergenic
1179585348 21:42370847-42370869 CAGCCACCGCCAACTCCTTCTGG + Intergenic
1184228559 22:43144984-43145006 CACACACAGAGGACACTTTCAGG + Intergenic
950630743 3:14280124-14280146 CTGCCACCGAGAACACATTTGGG - Intergenic
953099297 3:39809581-39809603 CAGCCACCGCCGACACCTGCTGG - Intronic
953910171 3:46888847-46888869 CAGCCAGCGTGGCCGCCTTCGGG - Intronic
961569505 3:127787664-127787686 CCTCCAGCGAGGACACCCTCAGG - Intronic
962937401 3:140093355-140093377 AAGGCAGTGAGGACACCTTCAGG - Intronic
969461103 4:7329377-7329399 CACCCATGGAGGACACCTCCCGG + Intronic
969546939 4:7835882-7835904 CAGCCACCCAGGTAACCTTAAGG - Intronic
969888524 4:10238352-10238374 CAGCACCAGAGGACACCTTGTGG + Intergenic
977292449 4:95178357-95178379 GAGGCACCGAGGAGACCTCCAGG - Intronic
985488022 5:162799-162821 CAGCCACCGAGGTAGCCTCCTGG - Exonic
997591986 5:135079739-135079761 CAGGCTGCAAGGACACCTTCAGG + Intronic
1002082821 5:176747732-176747754 CAGCCATGGAGGACACGCTCAGG + Intergenic
1004131909 6:12928656-12928678 CTGCCACATAGGACAACTTCAGG - Intronic
1004505719 6:16245301-16245323 CATTCACCCAGGACGCCTTCTGG + Intronic
1007498029 6:42274970-42274992 CAGCCACCCAGTACCCCTTCTGG + Intronic
1007777027 6:44229615-44229637 CAGTGACCAAGGACACATTCTGG - Exonic
1008368578 6:50709439-50709461 CAACCACAGAGGGAACCTTCAGG - Intergenic
1010986627 6:82432649-82432671 AAGCCACCAAGGACACCATGAGG + Intergenic
1012240210 6:96862633-96862655 CAGCCACCACGGATGCCTTCTGG - Intergenic
1012474202 6:99603355-99603377 CGGCCAGCGCGGACACCCTCGGG + Intergenic
1015479351 6:133690819-133690841 CATCCACCGTGGATACCTTTAGG + Intergenic
1016637064 6:146304794-146304816 CCGCCTTCCAGGACACCTTCTGG + Exonic
1018364118 6:163100419-163100441 CAGCCCCTGGGGACACCTTCAGG + Intronic
1019295614 7:272470-272492 CAGACACCGAAGTCACCTCCTGG + Intergenic
1019478805 7:1256716-1256738 CTGTCACCGAGGACAGCTTGAGG + Intergenic
1019549062 7:1593291-1593313 CAGCCACCGTCGTCACCGTCCGG - Intergenic
1019615328 7:1956844-1956866 CGGCCACTGAGGACACCTTGGGG + Intronic
1029444496 7:100604695-100604717 CAGCCCCCGAGGACCCCTTTAGG - Intronic
1032800217 7:135311826-135311848 CAGCCTCAGAGAACAACTTCCGG + Intergenic
1032997670 7:137465941-137465963 CAGCCGGCGGGGACACCTCCGGG - Exonic
1034157636 7:148968608-148968630 CAGCCACCTAGTACAACTCCAGG + Intergenic
1035597374 8:869215-869237 CAGCCACCGAGGAACCGTTTAGG - Intergenic
1035779431 8:2216268-2216290 CAGCCACCCAGGCCACCTCCTGG + Intergenic
1038376279 8:27043100-27043122 CAGCCTCTGTGGATACCTTCTGG - Intergenic
1047712199 8:127563796-127563818 CAGCAACAGAGGAGACCATCCGG + Intergenic
1048152049 8:131903960-131903982 CAGCCACGTAGAACAACTTCGGG - Intergenic
1049320040 8:141991431-141991453 CAGCCTCCCAGGTCACCTGCAGG + Intergenic
1049370516 8:142262086-142262108 CAGACACCGAAGTCCCCTTCAGG + Intronic
1053313576 9:37034800-37034822 CAGGCACCGAGGCGACGTTCCGG + Intergenic
1056466101 9:86856671-86856693 CAGCCACAGAGAATACCTGCTGG + Intergenic
1057499294 9:95584216-95584238 CACCCAGCGTGGACTCCTTCTGG - Intergenic
1060470211 9:123942422-123942444 CAGCCACGGAGGCCTCCTTGAGG + Intergenic
1060784116 9:126435703-126435725 CACCCACCGAGCACATCATCTGG + Intronic
1061932399 9:133839991-133840013 CCGCCCCCGAGGCCATCTTCAGG + Intronic
1188930291 X:36100981-36101003 CAGCCACCCAGATCACCCTCTGG + Intronic
1195812749 X:108852012-108852034 CATCCACAGATGACACCTCCAGG + Intergenic
1195860328 X:109376141-109376163 AAGGCACAGAGGAAACCTTCTGG - Exonic