ID: 1163699344

View in Genome Browser
Species Human (GRCh38)
Location 19:18779433-18779455
Sequence GAGGCTGGGGGCAGACAGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 592}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163699334_1163699344 -3 Left 1163699334 19:18779413-18779435 CCCTTTCTCTTACCATGACAGAG 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG 0: 1
1: 0
2: 6
3: 69
4: 592
1163699335_1163699344 -4 Left 1163699335 19:18779414-18779436 CCTTTCTCTTACCATGACAGAGG 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG 0: 1
1: 0
2: 6
3: 69
4: 592
1163699333_1163699344 9 Left 1163699333 19:18779401-18779423 CCAGGTCAAGGTCCCTTTCTCTT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG 0: 1
1: 0
2: 6
3: 69
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163699344 Original CRISPR GAGGCTGGGGGCAGACAGCG GGG Exonic
900001507 1:17289-17311 GATGCTGGGGGCAGAGACAGAGG - Intergenic
900021226 1:187811-187833 GATGCTGGGGGCAGAGACAGAGG - Intergenic
900180747 1:1309939-1309961 GAGGCGGGAGGCAGGCAGCCGGG + Intronic
900188010 1:1342012-1342034 GAGGCTGGGGGTCCACAGCTGGG + Intronic
900237992 1:1601500-1601522 GAGGTTGGGGGCAGAGACCTTGG + Intergenic
900266644 1:1760480-1760502 GAGGCTGGGGGCGCACAGCAGGG - Intronic
900300470 1:1974367-1974389 GAGGTTGGAGGCAGGCAGGGCGG - Intronic
900342050 1:2194129-2194151 AAGGCCTGGGGCAGACAGAGAGG + Exonic
900376619 1:2357646-2357668 TAGGGTGCAGGCAGACAGCGTGG + Intronic
900530227 1:3149391-3149413 CCGGGTGGGGGCAGACAGCCTGG + Intronic
900532032 1:3159169-3159191 GAGGCTGGAGGTACACAGGGCGG + Intronic
900602587 1:3509468-3509490 GAGGCTGGGGGCAGAGGGGCCGG - Intronic
900622267 1:3592934-3592956 GAGGCTGGGGGCAGGGAGCAGGG - Intronic
900971229 1:5993301-5993323 GGGGCTGGGGGCAGAATGGGAGG - Intronic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
901225430 1:7610567-7610589 GTGACTGGGGGCAGACTCCGTGG + Intronic
901258269 1:7850830-7850852 GATGCTGGGTGCAGAAAGAGGGG - Exonic
901791962 1:11658514-11658536 GGTGCTGGGGGCAGGCAGAGGGG - Exonic
902077859 1:13801947-13801969 CAGGGTGGGGCCAGACAGCCAGG + Intronic
902193465 1:14780279-14780301 GAGGCTGGGAAGAGACAGGGAGG - Intronic
902633581 1:17720259-17720281 CAGGCTGTGAGCACACAGCGGGG - Intergenic
902709805 1:18230919-18230941 GAGGAGGGGGGCAGGCTGCGGGG - Intronic
902717338 1:18281779-18281801 GAGGCAGGGAGGAGGCAGCGAGG + Intronic
903008595 1:20314669-20314691 CAGGGTGGGGGGAGACAGGGAGG + Intronic
903061323 1:20670727-20670749 GAGGGTGGGGACAGACAGGAAGG + Intronic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
903772153 1:25770732-25770754 GAAGAAGGGGGCAGACAGAGAGG - Intronic
904013097 1:27401324-27401346 GAGGCTGGGGAGAGACAGGTTGG - Intergenic
904106352 1:28088288-28088310 GAGGCTGAGGAAAAACAGCGAGG + Intronic
904290864 1:29485231-29485253 GAGGTTGGGAGCAGAGAGCAGGG - Intergenic
904456213 1:30649759-30649781 GAGGAAGTGGGCAGACAGGGAGG - Intergenic
905473611 1:38210555-38210577 TAGGCTGGGAGCAGAGAGGGAGG - Intergenic
905869707 1:41396173-41396195 GAGGGTGAGGGCAGGCAGCCAGG - Intergenic
905945126 1:41895335-41895357 AAGGCTGGGGCCAGACCACGTGG - Intronic
906072185 1:43025082-43025104 GAGGCTGTGGGCAGCTGGCGAGG + Intergenic
906072611 1:43028077-43028099 GGGGCACGGGGAAGACAGCGTGG - Intergenic
906201638 1:43964168-43964190 GAGCCTGCAGGGAGACAGCGTGG - Intronic
906288325 1:44602933-44602955 GAGGCAGGGAGCAGGCAGCCGGG - Intronic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
907310923 1:53538626-53538648 AGGGCTGGGGGCACACAGTGAGG + Intronic
907459377 1:54596259-54596281 CAGGGTGGGGGCAGACAGGAGGG - Intronic
907668065 1:56450532-56450554 GAGTCTTGGGGCACACAGCAGGG + Intergenic
907848794 1:58234520-58234542 AAGGCAGGGGGCTGGCAGCGTGG + Intronic
909696538 1:78473914-78473936 GAGGATGGGGGAAGACACAGGGG + Intronic
909817824 1:80018625-80018647 GAGAATGGGGGGAGACAGTGGGG - Intergenic
910570723 1:88699567-88699589 GAGGGTGGGGGATGACAGCAGGG - Intronic
912454397 1:109788070-109788092 GAGGCTGGGGGCTGACTGGCCGG + Intergenic
913531942 1:119739771-119739793 GGGGCAGGGGGCAGCCAGCCAGG + Intronic
915564954 1:156707980-156708002 GAGGCTGGAGCCAGGCAGTGGGG + Intergenic
915930438 1:160057582-160057604 GAGGCTGGGGGCAGACAAGAGGG - Intronic
916689210 1:167174373-167174395 GAGGCAGGGGCTAGACAGTGGGG + Intergenic
916794088 1:168149785-168149807 GAGGCTGGGCACAGGCCGCGGGG + Intergenic
916824001 1:168426952-168426974 GTGGCTGGTGGCAGAGAGGGTGG + Intergenic
916919768 1:169452068-169452090 GGGGCAGGGGGAAGACAGAGAGG + Intronic
917721104 1:177787354-177787376 GGGGCTGGGGGCACTCAGTGTGG + Intergenic
917846677 1:179025980-179026002 GCGGCTGGGGGCGGTGAGCGCGG + Exonic
918236944 1:182590100-182590122 GAGGCTGGGGTTAGAGAGCGAGG - Intergenic
918240442 1:182615770-182615792 GAGGCTGGGGCCAGACTGCCTGG - Intergenic
919812108 1:201415188-201415210 GAGGCTGGGGGCTGGCTGTGGGG - Intronic
919981417 1:202644563-202644585 GAGGCTGAGGGGAGAGGGCGAGG - Intronic
920035251 1:203061102-203061124 AAGGCTGTGGGCAGTCAGAGTGG + Intronic
920389287 1:205588959-205588981 GAGGCAGGGGCCACACTGCGTGG + Intronic
920658329 1:207893075-207893097 GAGGCTGTGGGCAAACATCACGG + Intronic
920775830 1:208936221-208936243 CAGGCAGGGGGTAGACAGCGGGG + Intergenic
921958855 1:221013031-221013053 GAGCCTGTGGGGAGACAGAGTGG - Intergenic
923404467 1:233646351-233646373 GAGGCTAGGGGCAGCCAGGGTGG + Intronic
923558460 1:235020550-235020572 GAGGCTGGGGGGTGACAGATGGG + Intergenic
923765960 1:236892665-236892687 GAGCCTGGGCGCATACAGTGAGG - Intronic
923952917 1:238980248-238980270 GAGGCTGGAGTCTGACAGCAAGG - Intergenic
924552185 1:245089229-245089251 GAGGTTGGGTGCAGACACCTTGG + Intronic
1062959968 10:1565506-1565528 GAGGCTGAGGGGAGGCAGCAGGG + Intronic
1064709795 10:18111617-18111639 GAGGATGGGGGCAGCAAGGGGGG + Intergenic
1065241678 10:23711475-23711497 GAGTCTCTTGGCAGACAGCGTGG + Intronic
1065366695 10:24944137-24944159 GAGGCCGGGGGCAGTCAGCAAGG - Intronic
1066383272 10:34919662-34919684 CAGGCTGGGGCCAGACATGGTGG + Intergenic
1067229677 10:44397546-44397568 GAGGCTGGGGCCAGGCTGCAGGG - Intergenic
1067539127 10:47138881-47138903 GAGGCTGTGAGCAGGCAGCTTGG - Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1067742809 10:48908911-48908933 GATGGTGGGGGAAGACAGGGAGG - Intronic
1068053763 10:51983894-51983916 TTGGCTGGGGGCAGAAAGCTGGG - Intronic
1069010191 10:63363785-63363807 GAGGCTGGGGCCAGAGGGGGAGG - Intronic
1069566717 10:69468267-69468289 CAGGCTGTGGGCAGCCAGCTGGG - Intronic
1069634872 10:69918962-69918984 GGGGTTGGGGGCAGTCAGGGTGG - Intronic
1070467261 10:76736134-76736156 GAGGCTGGGGGTAGAAGGAGGGG + Intergenic
1070638563 10:78148918-78148940 GAGACTGGGGACAGATAGCAGGG + Intergenic
1070642728 10:78180979-78181001 GAGCATGGGGGCAGCCAGCAAGG - Intergenic
1070652256 10:78245847-78245869 GAAGCTGGGAGCAGAGAGAGAGG + Intergenic
1070757661 10:79003483-79003505 CAGGATGGCAGCAGACAGCGGGG - Intergenic
1071463693 10:85921170-85921192 GAGGCTGGGTGCAGTCAGCCAGG + Intronic
1072781157 10:98252735-98252757 GAGGCTGGTGCCTGACAGCAAGG + Intronic
1073263443 10:102207918-102207940 AAGGCAGGGGGTAGACAGCACGG + Intergenic
1073561336 10:104499348-104499370 GAGGCTGGGAGCATACTGCATGG - Intergenic
1074881996 10:117666800-117666822 GAGGCTGAGGCCAGACTGCCTGG + Intergenic
1075210942 10:120490544-120490566 GAGGCTGAGGGCAGGCATCCAGG - Intronic
1075446931 10:122519589-122519611 GAGGCTGGGGAGGGACAGAGTGG + Intergenic
1075585105 10:123651760-123651782 GAAGCTGGGGGCTGACTGCTGGG + Intergenic
1075884053 10:125881736-125881758 GAGGCAGGGGGAAAACAGCCTGG - Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1076456793 10:130605414-130605436 GATGCTGGGGCCTGGCAGCGGGG + Intergenic
1076871399 10:133196731-133196753 GTGGCCGGGGGCAGGGAGCGTGG + Intronic
1077072617 11:682976-682998 GGAGCTGGGGGCAGAAAGGGAGG + Intronic
1077140898 11:1024436-1024458 GAGGATGGGGGCACCCCGCGGGG - Intronic
1077507811 11:2940260-2940282 CAGCCTGGGGGCCGCCAGCGAGG - Intergenic
1077923532 11:6658761-6658783 GAGGATGTGGCCAGACAGGGAGG + Intergenic
1078051103 11:7965497-7965519 GAGGCTTGGGGCAGATGGGGAGG - Intergenic
1078700036 11:13670811-13670833 GAGGCTGGAGGCAGAGACTGAGG + Intronic
1079078191 11:17396554-17396576 GGACCTGGGGGCAGACAGCGAGG - Intronic
1080873577 11:36257801-36257823 GAGGGTGGAGGCAGATGGCGTGG + Intergenic
1081793686 11:45805481-45805503 GAGGCTGGGGCCTAACAGGGAGG - Exonic
1081867264 11:46366722-46366744 GAGGCTCGGCGCAGGTAGCGGGG - Exonic
1081962816 11:47150800-47150822 GAGGCAGGGGGCAGATGGAGCGG + Intronic
1081990383 11:47334184-47334206 GAGGCTCGGGGAAGCCAGCTGGG - Intronic
1083199447 11:61111265-61111287 GTGGCTGGGAGCAGAGAGCATGG + Intronic
1083408379 11:62474416-62474438 GAGGCTGAGGGCAGATCACGAGG - Intronic
1083594368 11:63911940-63911962 GTGGCGGGGGGCAGCCAGAGCGG + Exonic
1083597872 11:63927817-63927839 GGGGCTGGGGGCAGTTAGGGAGG - Intergenic
1083759202 11:64806562-64806584 GAGGCCTGGGGCAGACTGCAGGG + Intronic
1083764227 11:64834404-64834426 GAGGCTAGGGGCAGGCACTGGGG - Intronic
1083780339 11:64914302-64914324 GAGGCTGGGGGCAGGCAAGTGGG - Intronic
1083871018 11:65488546-65488568 CTGGCTGGGGGCAGACAGGGAGG + Intergenic
1084040886 11:66542055-66542077 GAAGCTGGGGGCAGTCAGCTGGG + Intronic
1084188949 11:67490289-67490311 GAGTATGGGGGCAGGGAGCGGGG - Intronic
1084421830 11:69064207-69064229 GAGGGTGGGAGCGGACAGCCAGG - Intronic
1085411969 11:76296780-76296802 GAGGCCGTGGGCAGAGAGCAGGG - Intergenic
1085442501 11:76577423-76577445 CAGGCTGGGGGCACCCAGAGAGG - Intergenic
1085522039 11:77144643-77144665 GAGTCTGTGGGCAGACAGAGGGG - Intronic
1086479558 11:87219467-87219489 GGGGCTGGGGGGAGAGAGCCAGG + Intronic
1086906369 11:92422612-92422634 GAGGCTGAGGGCAGGAAGCAAGG + Intronic
1088281114 11:108135625-108135647 GAGGCTGGGGGCAGATCACATGG + Intronic
1088857987 11:113773463-113773485 GGGGCTAAGGGCAGACAGAGTGG - Intronic
1089774852 11:120828989-120829011 AAGGCTGGGGGATGACAGCAGGG - Intronic
1090075153 11:123576027-123576049 GGAGCTGGGGGCAGGCAGTGCGG - Intronic
1090327797 11:125904268-125904290 GGGGCGGAGGGCAGAGAGCGGGG - Intronic
1090327803 11:125904287-125904309 GGGGCGGAGGGCAGAGAGCGGGG - Intronic
1090327809 11:125904306-125904328 GGGGCGGGGGGCAGAGAGCGGGG - Intronic
1090327817 11:125904325-125904347 GGGGCGGAGGGCAGAGAGCGGGG - Intronic
1090961979 11:131565220-131565242 GAGGCTGGAGGTGGACAGAGAGG - Intronic
1091071554 11:132569044-132569066 AAGGCATGGGGCAGGCAGCGGGG + Intronic
1091290129 11:134434846-134434868 GGGGCGGGGGGCAGGCACCGTGG + Intergenic
1091374592 12:17404-17426 GATGCTGGGGGCAGAGACAGAGG - Intergenic
1091450379 12:569087-569109 GGTGCTGGGGGCAGCCAGTGAGG + Intronic
1091455930 12:607825-607847 GAGGCTGGGGGCCTGCTGCGGGG + Intronic
1091999581 12:5021242-5021264 GCGGCTTTGGGCAGACAGAGGGG - Intergenic
1092218260 12:6697227-6697249 GAGGCTGGGTGAAGACACCAAGG - Intronic
1092894607 12:13000290-13000312 GAGGCAGGGGCCAGAGGGCGTGG + Intergenic
1094388831 12:29926550-29926572 GAGGCTGGGGGCAGGAAGGGAGG + Intergenic
1096609527 12:52791705-52791727 GAGGCTGCGGGCAGAGATCGAGG - Exonic
1096647787 12:53047819-53047841 GAGGATGGGGGCAGACTGGAGGG - Intronic
1096652446 12:53068525-53068547 GTGTGTGGGGGAAGACAGCGTGG - Intronic
1097190151 12:57215957-57215979 GAGGATGGGGGCAGAGAGCTGGG + Intergenic
1097264670 12:57738324-57738346 GGGGCTGGGGGCAGCGAGCAGGG - Intronic
1097804445 12:63950209-63950231 GAGGCTGGGGGCTGTCAGAAAGG - Intronic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1100802961 12:98252359-98252381 GAGACTGTGGGCAGGCAGCATGG - Intergenic
1101239516 12:102824366-102824388 GAGGCAGCGCTCAGACAGCGGGG - Intergenic
1101618862 12:106364239-106364261 AAAGCTGGGTGCAGAGAGCGTGG + Intronic
1102201333 12:111059788-111059810 GAGGGTGGGGGCAGTGAGGGAGG + Intronic
1102278129 12:111598659-111598681 TGGGCTGGGGGCCGGCAGCGCGG - Intronic
1102300465 12:111767319-111767341 GAGGCTGGGCGAAGACGGAGAGG - Intronic
1102406801 12:112680562-112680584 GATGCTGGGGCCAGACTGCCTGG - Intronic
1102440771 12:112962685-112962707 TAGGCTGGGGGCAGAGAGGCAGG - Exonic
1103119831 12:118371978-118372000 GGGGCTGGGCTGAGACAGCGGGG - Intronic
1103341046 12:120221345-120221367 GAGGCTGGGAGCACCCAGGGAGG + Intronic
1103623332 12:122201607-122201629 GAAGCTGGAGGCAGACACCTCGG - Intronic
1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104986589 12:132600944-132600966 GAGGCCGGGGGCCCACAGCGGGG - Intergenic
1105280995 13:18962525-18962547 GAGCCTGAGGGCAGACGGTGCGG + Intergenic
1105290194 13:19048537-19048559 GAACCTGAGGGCAGACAGCAAGG + Intergenic
1105474931 13:20721219-20721241 TAGGCTGGGGGCAGGTAGGGCGG - Intronic
1105548022 13:21365924-21365946 GAGGGAGGAGGCAGACAGAGGGG - Intergenic
1105913841 13:24894683-24894705 AAGGCTGGGGGCAGAACGCGCGG + Intronic
1107602492 13:42028136-42028158 GAGGCTGATGGCAGACTGGGGGG - Intergenic
1108280136 13:48852911-48852933 CAGGCTGGGGGTAGAGAGGGTGG + Intergenic
1110495572 13:76163813-76163835 GAGGCTGAGGGAAGCCAGAGGGG - Intergenic
1110995303 13:82100330-82100352 GAAACTGGGGGCAGAGAGTGTGG - Intergenic
1112366629 13:98761038-98761060 GAGGTTGGGGGCAGCAAGAGTGG + Intergenic
1113448539 13:110388934-110388956 GAGGGTGAGGGCAGACCGTGAGG - Intronic
1113565341 13:111316375-111316397 CAGCCTCAGGGCAGACAGCGGGG - Intronic
1113568641 13:111337838-111337860 GAGGCTGGAGGAAGGGAGCGAGG - Intronic
1114533828 14:23410948-23410970 GGGGCTGGATGCAGACAGCAGGG - Intergenic
1114563740 14:23612580-23612602 GAGCTTGGGGCCAGACACCGTGG + Intergenic
1114648779 14:24270199-24270221 GGGGCTGGGTGCAGAAAGTGAGG - Intronic
1115399431 14:32939848-32939870 GAGGCCGGGGGCGGGGAGCGCGG + Intronic
1117764037 14:59061358-59061380 GAGGCTGTGGGGAGACAGAGTGG - Intergenic
1117937264 14:60920124-60920146 GAGGCTGGGGGCGGCCATTGGGG + Intronic
1119878143 14:78077844-78077866 AACTCTGGGGCCAGACAGCGGGG - Intergenic
1121176820 14:91896785-91896807 GTGTCAGGAGGCAGACAGCGTGG - Intronic
1121451007 14:94008288-94008310 GAGGCTGGGGACAGTCAGGGTGG + Intergenic
1121585640 14:95061273-95061295 GAGGCTGTGTGAAGACAGAGAGG - Intergenic
1121856874 14:97278232-97278254 GATGCTAGGGGCACACAGAGTGG - Intergenic
1122053113 14:99073625-99073647 GAGGCTGGGGGCGGGCAGCTGGG + Intergenic
1122091358 14:99343032-99343054 GATGCAGGGGGCAGCCAGGGTGG + Intergenic
1122194501 14:100074891-100074913 CAGGCTGAGGGGAGACAGGGTGG + Intronic
1122212131 14:100180278-100180300 GAGACTGTGGGGAGACAGAGAGG - Intergenic
1122326728 14:100885156-100885178 GTGGCTGGGAGCAGCCACCGTGG + Intergenic
1122628560 14:103097122-103097144 GAGGCTGGGGGTAGGGAGGGTGG + Intergenic
1122743918 14:103887158-103887180 GAGGCAGGGGGCAGCCAGGCTGG - Intergenic
1123018259 14:105385741-105385763 CAGCCTGGGGACAGACAGGGTGG - Intronic
1123106651 14:105844952-105844974 GAGGCTGAGGGCAGAGGGCATGG + Intergenic
1124028713 15:25989934-25989956 GAGGCCTGGGGCAGGCAGGGTGG + Intergenic
1124244348 15:28056910-28056932 GAGGCAGGGGGCAGGCAGCTGGG - Intronic
1124497108 15:30193298-30193320 GAGGCTGAGGGGAGAGGGCGAGG - Intergenic
1124746468 15:32345349-32345371 GAGGCTGAGGGGAGAGGGCGAGG + Intergenic
1125492780 15:40160686-40160708 GAGATTTGGGGCAGACAGCAGGG + Intergenic
1127836874 15:62797357-62797379 CAAGCTGGGGGCAGCCAGCCTGG + Exonic
1127921215 15:63495838-63495860 GAGGCTGGGAGAAGAGAGAGAGG - Intergenic
1128920663 15:71607230-71607252 GAGGTTGGGGAAAGACAGCTTGG + Intronic
1129198615 15:73985462-73985484 GGGGCTGGAGGTAGACCGCGTGG - Exonic
1129231639 15:74200313-74200335 GAGGCAGGCGACAGGCAGCGTGG + Intronic
1129240079 15:74245752-74245774 GAGGGTGGGGACAGAGAACGCGG + Intronic
1129740623 15:77987946-77987968 CAGGCTGGGGCCGGCCAGCGGGG - Intronic
1129845122 15:78764611-78764633 CAGGCTGGGGCCGGCCAGCGGGG + Exonic
1129972710 15:79794065-79794087 GAGACTGGGAGCAGAGAGGGAGG - Intergenic
1130064657 15:80593822-80593844 GCGCCTGGGGACACACAGCGGGG - Exonic
1130256715 15:82329250-82329272 CAGGCTGGGGCCGGCCAGCGGGG - Intergenic
1130349543 15:83078951-83078973 GTGGCTGGGCACAGACAGCTGGG - Intergenic
1130598235 15:85260738-85260760 CAGGCTGGGGCCGGCCAGCGGGG + Intergenic
1130997245 15:88910783-88910805 TAGGCTGGGGCCAGACTGGGAGG + Intronic
1131155055 15:90069826-90069848 GAGGCTGGTGGCTGAAGGCGGGG - Intronic
1131254696 15:90854396-90854418 GAGTGGGGGGGCACACAGCGAGG + Intergenic
1131491778 15:92869244-92869266 CAGGCTGGGGTCAGACAGCCAGG + Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1131721109 15:95169939-95169961 GAGGAGGGGGGCAGACAGCTTGG + Intergenic
1132229121 15:100168847-100168869 GAGGGTAGGAGCAGACAGCCTGG - Intronic
1132452003 15:101973649-101973671 GATGCTGGGGGCAGAGACAGAGG + Intergenic
1132454892 16:16972-16994 GATGCTGGGGGCAGAGACAGAGG - Exonic
1132600211 16:769737-769759 GAGGGTGGGGACAGCCAGCGAGG + Intronic
1132700140 16:1218774-1218796 GAGGATGGGGGCAGGCAGGAGGG + Intronic
1132715992 16:1290040-1290062 GAGGCTGAGAGCAGCCAGGGGGG - Intergenic
1132810223 16:1793666-1793688 CAGGCTGCAGGCAGGCAGCGAGG + Exonic
1132882440 16:2168362-2168384 GTGGCAGGGGGCAGCCAGTGAGG + Intronic
1132991870 16:2799572-2799594 GAGGCTGGGGATAGACCGGGTGG + Intergenic
1133206426 16:4236875-4236897 GAGGCTGAGGGCAGATCACGAGG - Intronic
1133275387 16:4635121-4635143 GAGGCTGGGGGCTGGCTGCAGGG + Intronic
1134203827 16:12221238-12221260 GAGGGTGGGGGCAGAAAGCCGGG + Intronic
1135721353 16:24821257-24821279 GAGACTGGCAGCACACAGCGAGG + Intronic
1136403317 16:30030071-30030093 GAGGCCAGGGCCAGACAGCTAGG - Intronic
1136927690 16:34389317-34389339 GAGCCTGGAGGCAGGCTGCGGGG - Intergenic
1136976884 16:35022489-35022511 GAGCCTGGAGGCAGGCTGCGGGG + Exonic
1137251796 16:46746790-46746812 AAGGCACGGTGCAGACAGCGGGG + Intronic
1137353373 16:47734004-47734026 GAGGCAGGGGATAGACAACGAGG + Intergenic
1137555019 16:49465044-49465066 GAGGGTGAGGGCTGCCAGCGAGG + Intergenic
1138178607 16:54928400-54928422 GGGGGTGGGGGGAGAAAGCGCGG + Intergenic
1138528176 16:57620703-57620725 GATGCTGGGTGCAGGCAGCTGGG - Intronic
1138606889 16:58095325-58095347 GGGGGTGGTGGCAGACAGCTGGG + Intergenic
1139599897 16:67980219-67980241 GAGGCTGGGGGAGCCCAGCGTGG + Exonic
1139691161 16:68642936-68642958 GAGGCTGGGGGTGGACCACGCGG - Intronic
1140457550 16:75113936-75113958 GAGGATGGGGGCAGTCAGGGTGG - Intronic
1140566926 16:76054679-76054701 AAGGCGGGGGGCAGAGAGAGAGG - Intergenic
1141158917 16:81616389-81616411 GAGGCTCGGAGCAGGCAGTGGGG - Intronic
1141599841 16:85118959-85118981 GAGACTGGAGGCAGGCAGCGAGG - Intergenic
1141692089 16:85602238-85602260 GAGGCGGGGGCCAGGCAGGGAGG + Intergenic
1141727643 16:85800056-85800078 GAGGCTGCAGGCACAGAGCGCGG - Intronic
1141804628 16:86334652-86334674 GAGGCTGGGTGCACACAGCGGGG + Intergenic
1141968856 16:87466092-87466114 GAGGCGGGGGGTAGTTAGCGGGG - Intronic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142205319 16:88780113-88780135 GAGGACGGGGGCAGGCAGAGGGG - Intronic
1142261215 16:89043310-89043332 GAGGGTGGTGGCAGACAGAGAGG - Intergenic
1143013215 17:3877621-3877643 GAGGCTGCGGGCAGAGAAGGCGG + Intronic
1143119971 17:4600360-4600382 CAGCCTGGGGGCAGGCAGGGTGG + Intronic
1143465122 17:7131380-7131402 GAGGATGGGGCCAGAGAGGGAGG + Intergenic
1143626655 17:8114243-8114265 GAGTCTGGGGGCAGGGAGAGGGG + Intronic
1143635822 17:8163200-8163222 GGGGCTGTGGTCAGACAGGGTGG - Intronic
1143768155 17:9151000-9151022 GAGGCTGGCGGCAAACAGACCGG - Intronic
1144181095 17:12753260-12753282 GAGGATGAGGGCAGAAAGTGAGG - Exonic
1144356461 17:14451421-14451443 GATGCTGGGGATAGACAGAGTGG + Intergenic
1144633335 17:16887383-16887405 GAGGTTTGTGGCAGACAACGTGG + Intergenic
1144670256 17:17128837-17128859 GAGGAAGGGGGCTGTCAGCGAGG - Intronic
1144677104 17:17168624-17168646 AAGGGTGGGGCCAGACAGCTGGG - Intronic
1145391795 17:22460910-22460932 GTGGCTGACTGCAGACAGCGTGG - Intergenic
1145785253 17:27589296-27589318 GACTCTGGGGGCAAACAGCTAGG - Intronic
1146176071 17:30667439-30667461 GAGGGAGGGGGCAGGCAGCAGGG + Intergenic
1146349529 17:32083549-32083571 GAGGGAGGGGGCAGGCAGCAGGG + Intergenic
1146454213 17:32996744-32996766 GAGGCTCGGTGGAGCCAGCGTGG + Intronic
1146481761 17:33210667-33210689 GAATATGGGGGCAGACAACGAGG + Intronic
1146661290 17:34666652-34666674 CAGACTGGGGCCAGACAGGGTGG + Intergenic
1147044637 17:37743771-37743793 GAGGCCGGGGGTGGGCAGCGAGG + Intronic
1147647669 17:42043483-42043505 CAGGCTGGGGGCAGCCCGCCAGG + Intronic
1147675486 17:42202362-42202384 GAGCCTGGGGACACACAGCTGGG + Exonic
1147690075 17:42309440-42309462 GAGCCTGGGGGCACACAGCTGGG - Exonic
1148025683 17:44585999-44586021 GAGGCTGGAGGAAGACAACCTGG + Intergenic
1148135549 17:45289463-45289485 GAAGCTGGGGAGAGACAGTGCGG - Intronic
1148159207 17:45440557-45440579 GAGGATGGGTGCAGACACCTGGG + Intronic
1148214081 17:45825035-45825057 GAGGCTGGGGGCTGGCAGAAGGG - Intronic
1148244894 17:46024250-46024272 GCAGCTGGGGGCAGAGGGCGGGG - Exonic
1148463479 17:47851153-47851175 GAGGATGAAGGCAGAGAGCGCGG - Exonic
1148716857 17:49722176-49722198 GAGACTGGAGGAAGACAGGGAGG - Intronic
1149486484 17:57046485-57046507 GAGGCTGCGGGGAAACCGCGGGG + Intergenic
1149575066 17:57706012-57706034 GAGGCTGGAGGCAGAAACTGGGG + Intergenic
1149972728 17:61235180-61235202 CAGGCGGGGGGCAGACAGCCAGG - Intronic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1151174355 17:72274936-72274958 ATGGCTGGGGTCAGACAGCAAGG + Intergenic
1151203592 17:72488184-72488206 GCGGCTGGGGGAAGAAAGGGTGG - Intergenic
1151328629 17:73393954-73393976 GAGGCTGGGGGCATCCAGCGTGG + Intronic
1151360118 17:73583756-73583778 GATCCTGGGGGCAGGCAGCCTGG - Intronic
1151464644 17:74276641-74276663 GTGTCTGGAGGCAGACAGAGGGG - Intronic
1151555265 17:74843305-74843327 TGGGCTGGGGCCAGACCGCGGGG + Exonic
1151691942 17:75692021-75692043 GAGGCTGGGAGCAGGCAGGGAGG - Intronic
1151766343 17:76135282-76135304 GAGGAAGGGGGCGGACAGTGGGG + Intergenic
1151886367 17:76925340-76925362 GAGGCTGGGGGCAGGAGGCCGGG + Intronic
1152106094 17:78329922-78329944 ATGGCTGGGGGCAGCCAGCAGGG - Intergenic
1152177365 17:78796656-78796678 GAGAGGGGGTGCAGACAGCGAGG + Exonic
1152224502 17:79086398-79086420 CAGGCCAGGGGCAGACAGCCGGG - Exonic
1152287899 17:79423076-79423098 GGGGCTGGAGGCAGAAAGAGGGG - Intronic
1152291897 17:79444514-79444536 GAGGCTGGGGTCAGGCACAGAGG - Intronic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152558336 17:81065665-81065687 GAGGCTGGGCGCACAGAGCTGGG + Intronic
1152812198 17:82387229-82387251 GGGGCTGGGAGCAGACAGGAAGG + Intergenic
1152887102 17:82858970-82858992 GAGGCCGGGGCCAGGCTGCGTGG + Intronic
1152930651 17:83107918-83107940 GAGGTGGGGGGCAGACAGGGAGG + Intergenic
1152930675 17:83107989-83108011 GAGGTGGGGGGCAGACGGGGAGG + Intergenic
1152930697 17:83108060-83108082 GAGGTGGGGGGCAGACGGGGAGG + Intergenic
1153167509 18:2279540-2279562 GGTGCTGGGGGAAGACAGTGAGG + Intergenic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1156892959 18:42210918-42210940 TAGGCTGGATGCAGACAGGGAGG - Intergenic
1157075419 18:44461072-44461094 GAGGCAGGGGGCAGGCAGTCAGG + Intergenic
1157282675 18:46356483-46356505 GAGCCTGAGGGCAGAGAGAGAGG + Intronic
1157750629 18:50174956-50174978 GAGTCTGAGGGCAGCCAGCCAGG + Intronic
1158488844 18:57892196-57892218 GAGGCTGGGAGGAGAGAGGGGGG - Intergenic
1158571224 18:58598383-58598405 GAGCCTGGAGGCAGACGGGGAGG + Intronic
1159045547 18:63366561-63366583 CCGGGCGGGGGCAGACAGCGGGG - Intronic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160758790 19:772125-772147 GAGGAAGGGGGGAGACAGGGAGG - Intergenic
1160826096 19:1081259-1081281 GAGGCAGGGGGCAGACCTGGAGG + Intronic
1160981815 19:1819718-1819740 GAGGAAGGCGGCTGACAGCGAGG + Intronic
1161083893 19:2325119-2325141 GAGGGGTGGGGCAGGCAGCGTGG - Intronic
1161150085 19:2702818-2702840 GGGGCGCGGGGCAGGCAGCGGGG + Intergenic
1161209969 19:3061407-3061429 GAGGCGGGGGGCAGGAAGCGCGG - Intronic
1161401030 19:4066334-4066356 GAGGGTGGGGGGAGCCGGCGTGG - Intronic
1161458283 19:4381039-4381061 GAGGCTGGGGGAACAGAGAGAGG - Intronic
1161849239 19:6730381-6730403 CATTCTGGGGGCAGACAGCGAGG + Exonic
1161959864 19:7517217-7517239 GTGGCTAGGGGCAGACTGGGAGG - Intronic
1162126374 19:8501803-8501825 GAGGATTGGTGCAGACACCGTGG + Intronic
1162310837 19:9906284-9906306 GAGGCTGCGGGCACACAGGGTGG + Intronic
1162320700 19:9969510-9969532 CAAGCTGGGAGCAGACAGAGAGG + Intronic
1162822296 19:13230234-13230256 GAGAATGGGGGCAGAGACCGAGG + Intronic
1162982753 19:14249463-14249485 GAGGGAGGGGGCAGGCAGCAGGG - Intergenic
1163149709 19:15403743-15403765 GATGGTGGGGGCAGGCAGAGGGG + Intronic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1163822272 19:19502734-19502756 GAGCCTGGGTGCAGAGAGTGAGG - Intronic
1165052589 19:33151436-33151458 GAGGCTGGGGACAGGCAGGCAGG + Intronic
1165317632 19:35066230-35066252 GAGTCTGGGGAAAGACAGCTGGG - Exonic
1165357602 19:35313456-35313478 GGAGCTGGGGGCAGCCTGCGTGG + Exonic
1166007616 19:39918030-39918052 GGGGCTGGGAGCATACAGTGAGG - Intronic
1166802202 19:45465259-45465281 CTGGCTGGTGGCAGACAGAGGGG + Intronic
1166863221 19:45821503-45821525 AAGGGTGGGGGAAGACAGTGCGG + Intronic
1167004439 19:46766505-46766527 GAGGGTGGGGGCAGGAAGCAGGG + Intronic
1167040506 19:47020504-47020526 GAGGCAGGGGGCAGAGGGCAGGG - Intronic
1167121694 19:47521124-47521146 GAGGGTGGGGGGAGGCAGAGGGG + Exonic
1167249971 19:48394464-48394486 GGGGCTGAGGGCACAAAGCGGGG + Intergenic
1167264014 19:48474412-48474434 GGGGGTGAGGGCAGACAGCTTGG - Intronic
1167307986 19:48719868-48719890 GATGCTGGGGGGTGAGAGCGGGG + Intergenic
1167399043 19:49252680-49252702 GAGGCTGGGGGCAGAAAGAAAGG + Intergenic
1167665489 19:50820957-50820979 GAGGGTGGGGGCAGGTAGGGAGG + Intronic
1167765538 19:51479805-51479827 GAGGCCTGGGGCATACAGCGTGG + Intronic
1168093443 19:54100697-54100719 GGGGTTGGGGGCAGAGAGAGAGG - Intronic
1168282601 19:55313423-55313445 GAGGCTGGCGGCAGGGAGGGAGG - Intronic
1168287381 19:55341365-55341387 GAGGCAGGGGGCGGAGACCGAGG + Intronic
1168405464 19:56108203-56108225 GGGGCTGGGTGGAGAGAGCGGGG - Intronic
1168710096 19:58494659-58494681 GAGGCCAGGGGCAGACTGGGAGG - Intronic
925008165 2:461531-461553 GAGGCTGCGGACAGACATAGAGG + Intergenic
925203233 2:1985889-1985911 GAGGCTGGGGGCACCCATTGAGG - Intronic
925310700 2:2879464-2879486 GATGCTGGGATCAGACAGTGAGG - Intergenic
926136903 2:10342889-10342911 GGGGCCGGGGGAAGGCAGCGGGG - Intronic
926218896 2:10922352-10922374 GAGACTGGGGGCTAACAGGGAGG - Intergenic
926352535 2:12009740-12009762 GAGACTGGAGGCAGAGAGAGAGG - Intergenic
927467437 2:23347946-23347968 GAGGCTGAGAGCACACAGTGAGG + Intergenic
928083323 2:28328853-28328875 GAGGTTGGGGACTGGCAGCGGGG - Intronic
928378737 2:30800390-30800412 GAGGCTGGGTCCACACAGCAAGG - Intronic
929542843 2:42835465-42835487 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929543220 2:42838270-42838292 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929995980 2:46826455-46826477 GTGGCTTGGGGCAGACAGTGAGG + Intronic
930028025 2:47041311-47041333 GACGCTGGGGGAGGGCAGCGGGG + Intronic
930048185 2:47192451-47192473 AGGGCAGGGGGCAGACAGTGAGG - Intergenic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
931940701 2:67248673-67248695 GAGGCTTAGGGCAGACAGAGGGG + Intergenic
933974482 2:87497292-87497314 GAGCCTGGGGGCAGCCTGGGTGG - Intergenic
934663917 2:96157421-96157443 GAGGGTGGGGGAAGGCAGCATGG - Intergenic
936083208 2:109449245-109449267 GAGGCTGGTGGCAGGCAGGCGGG - Exonic
936319342 2:111453527-111453549 GAGCCTGGGGGCAGCCTGGGTGG + Intergenic
936568218 2:113596125-113596147 GATGCTGGGGGCAGAGACAGAGG + Intergenic
937341708 2:121095564-121095586 GAGGCAGGCTGCAGACAGCAGGG + Intergenic
937446775 2:121965091-121965113 GAGGGTGGGGGGAGGCAGAGGGG + Intergenic
937917690 2:127107002-127107024 GGGGCTGGGGGCTGGGAGCGCGG - Exonic
938373964 2:130792171-130792193 GAGGCTGGGGGAAGAAAGAATGG - Intergenic
938509535 2:131926037-131926059 TCGGCTGGGGGCAGTCAGAGAGG + Intergenic
939829370 2:147053864-147053886 CAGGCTGGGGGCAGTCAGAGAGG + Intergenic
940265145 2:151828409-151828431 GAGGCTCGTCGCAGACAACGCGG - Exonic
940420663 2:153477181-153477203 GAGGGTGGGGCCAGACGGAGAGG - Intergenic
940855269 2:158724435-158724457 GAGGCAGAGGGCAGCTAGCGAGG - Intergenic
942448356 2:176092920-176092942 CGGGCTGCGGGCAGACGGCGGGG + Exonic
942531552 2:176915500-176915522 GAGCCAGGTGGCAGACAGTGGGG - Intergenic
942679042 2:178457517-178457539 GAGGCAGGGGGCTGCCTGCGGGG + Intronic
944547295 2:200811483-200811505 GAGGCTGGGGGCGGGCATGGGGG - Intronic
944688791 2:202140865-202140887 GAGGGAGGGGGCAGCCAGTGGGG - Intronic
945306773 2:208266375-208266397 GGGGCGGGGGGCAGCCGGCGCGG + Exonic
945699527 2:213152211-213152233 GAGGCCGGGGGAAGGGAGCGGGG + Intronic
945817685 2:214625902-214625924 GAGTCAGGGAGCAGACAGCAAGG - Intergenic
947077368 2:226359863-226359885 GAGGAGGGGGGCAGAGAGAGAGG + Intergenic
947667963 2:231918940-231918962 GAGGCAGGGGGCCCACAGGGAGG - Intergenic
947726809 2:232406443-232406465 GAGGCTGGAAGCACACAGCCCGG - Intergenic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
948401326 2:237687817-237687839 AAGGCTGAGGGCAGACGGGGAGG - Intronic
1168760526 20:347199-347221 GAGGATGCGGGCAGAGCGCGGGG - Intronic
1169130333 20:3163524-3163546 GAGGCTGGGGGAATAGAGTGCGG + Exonic
1169927605 20:10799162-10799184 GGGGCTGGGGGATGACAGGGTGG + Intergenic
1171114735 20:22515484-22515506 GAGCCTGGGGGATGACATCGGGG + Intergenic
1171393712 20:24817553-24817575 GAGGCTGAGGGGAGCCAGCAGGG - Intergenic
1172044247 20:32068749-32068771 GAGACAGGGGGCAGAGAGGGGGG - Intronic
1172149458 20:32779957-32779979 GAGGCTGGCGGCAGACGGGCCGG + Intronic
1173361213 20:42346266-42346288 GAGGCTGGGGGCAGAGCCCCAGG - Intronic
1173502075 20:43561284-43561306 GAGGCTGAGGGCAGTCAGGAAGG + Intronic
1173810611 20:45952953-45952975 GAGGTGGGGGGCACACAGTGAGG + Intronic
1174530057 20:51204482-51204504 GATGTTGGGGGCAGGCAGCCAGG + Intergenic
1175187739 20:57190329-57190351 GAGGCTGGAGACAGTGAGCGAGG + Intronic
1175245120 20:57577687-57577709 GAGGGTGGGGACAGAGAGCTTGG + Intergenic
1175697856 20:61115945-61115967 CAGGCTGGAGCCAGACAGCTCGG + Intergenic
1175735839 20:61386437-61386459 AAGGCTGGGGGAAGGCAGAGTGG - Intronic
1175816230 20:61884562-61884584 CAGCCTGGGGGCACCCAGCGAGG + Intronic
1175946227 20:62560117-62560139 CAGGCTGGGGGGAGGCAGGGCGG - Intronic
1175997270 20:62817394-62817416 GAGGCGGGGGACACACTGCGCGG + Intronic
1176127292 20:63481754-63481776 GAGGCGGGTGGCACACAGCGGGG - Intergenic
1176428040 21:6560733-6560755 GAGGCTGGCAGGAGTCAGCGGGG - Intergenic
1176783948 21:13232525-13232547 TCGGCTGGGGGCAGTCAGAGAGG - Intergenic
1177234420 21:18368513-18368535 GACTCTGGGGGCAGAGAGAGTGG + Intronic
1177630045 21:23714825-23714847 TTGGCTGGGGGCAGTCAGAGAGG - Intergenic
1177981996 21:27926358-27926380 TCGGCTGGGGGCAGTCAGAGAGG - Intergenic
1178376676 21:32073303-32073325 AAGTCTGTGGGCAGACAGCAGGG - Intergenic
1178824544 21:36004796-36004818 GAGGCGGGGGGCAGGCGGGGGGG + Intergenic
1178900800 21:36596981-36597003 GAGGGCGGTGGCAGGCAGCGGGG + Intergenic
1179505797 21:41839533-41839555 GGGGCAGGGGGCAGAGGGCGGGG - Intronic
1179703531 21:43169050-43169072 GAGGCTGGCAGGAGTCAGCGGGG - Exonic
1180577381 22:16791700-16791722 GAGGCAGGGGGGAGAGAGAGAGG + Intronic
1181262250 22:21606915-21606937 GAGGCTGCGGGCAGGCAGTGTGG - Intronic
1181603557 22:23966628-23966650 GAGGGTCGGGGGAGACAGGGTGG + Intergenic
1181604956 22:23974679-23974701 GAGGGTCGGGGGAGACAGGGTGG - Intronic
1181960735 22:26619856-26619878 GAGGGTGGGGGCAGAGAAGGGGG + Intergenic
1182239358 22:28902634-28902656 GAGTCTGGAGCCAGACAGCTTGG + Intronic
1182446468 22:30392605-30392627 GAGGCTGGGGGCAGGGAGCTGGG - Intronic
1182496667 22:30713311-30713333 GAGGCTGAGGGCAGATCACGAGG - Intronic
1182557842 22:31138647-31138669 CAGGTTGGTGGCAGGCAGCGAGG - Exonic
1182647525 22:31822424-31822446 GAGGCATAGGGCAGACAGGGCGG + Intronic
1182757528 22:32691756-32691778 GAGGCATGGGGCAGAGAGAGAGG + Intronic
1183011757 22:34952483-34952505 GAGGCTGGGGTCAGAAATCAAGG - Intergenic
1183408781 22:37643018-37643040 GAAGCTGGGGGCTGAAAGCAGGG - Intronic
1183521922 22:38300579-38300601 GAGCTTGGGGGCAGACGGGGTGG + Intronic
1183744795 22:39686152-39686174 GAGGCCGGGGGCTGGCGGCGGGG - Exonic
1183989075 22:41586045-41586067 GAGGCTGGGGGTAGAGGGAGTGG - Intronic
1184164788 22:42720811-42720833 GCGGCGGGCGGCGGACAGCGGGG + Intronic
1184177364 22:42795877-42795899 GGGGCTGGGGGGAGACTGAGGGG + Intergenic
1184189990 22:42888043-42888065 GGGGCTGGGGGCAGAGACCTGGG - Intronic
1184468687 22:44683578-44683600 GGGGCTGGGGGGAGCCAGCCAGG + Intronic
1185226906 22:49658351-49658373 GAGGCAGAGGGCAAACATCGGGG + Intergenic
1185382945 22:50518504-50518526 TGGGCTGGGGGGAGACAGCAGGG - Intronic
1185415376 22:50706383-50706405 GAGGCTGGGGATGGACAGTGGGG + Intergenic
949851066 3:8421031-8421053 GAGGCTGGGAGCAGATTGCTAGG - Intergenic
950275507 3:11656959-11656981 GAGGCTGGGAGTAGGCAGCAAGG + Intronic
950423933 3:12914582-12914604 GAGGGTGAGGGCAGGCAGAGCGG + Intronic
951634090 3:24754088-24754110 GGGGGTGGGGGCAGACACAGTGG - Intergenic
953026215 3:39146704-39146726 GGGTCTGGGGACAGACAGCCTGG + Exonic
953125472 3:40088116-40088138 GATGCTGTGGGAAGACAGCAGGG + Intronic
953694839 3:45149500-45149522 CAGGTTGGGGCCAGACAGCTGGG - Intergenic
953891857 3:46756749-46756771 GAGGCTGGGAGTGGACAGGGCGG - Intronic
953907775 3:46876916-46876938 GAAGATGTGGGCAGACAGGGAGG - Intronic
954639336 3:52088808-52088830 GAGGCTGGGAGCAGGGAGAGAGG - Intronic
955386792 3:58487073-58487095 GAGGCTGGGCCCAGAGAGAGAGG + Intergenic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
956702282 3:71968890-71968912 GAGGCTGGGGGCAGTAGGCAGGG - Intergenic
956836571 3:73100750-73100772 GAGGCTTGAGGCAGAAAGCTGGG - Intergenic
960508983 3:118525687-118525709 GAGGCTGGGGACAGTCAGAGAGG - Intergenic
960584821 3:119311045-119311067 GGAGCTGGAGGCAGACAGAGGGG - Intronic
960625365 3:119677025-119677047 GGGGGGGGGGGCAGACAGGGAGG + Intronic
960812249 3:121636270-121636292 GATGCTGAGGGCAGTCAGTGGGG + Intronic
961012169 3:123443686-123443708 GAAGCTGGGGAAAGACAGGGTGG + Intronic
961382922 3:126507812-126507834 GAGGATGGGGGCAGACAGAGGGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961575760 3:127834937-127834959 GAGGCTGGAGACACACAGGGAGG + Intergenic
961784898 3:129341769-129341791 GAAGGTGGGGGCAGAAAGCATGG + Intergenic
962018243 3:131466991-131467013 GAGGCTGGGGGAAAATAGTGGGG - Intronic
962306849 3:134295191-134295213 GAGGCAGGAGGCATACAGAGAGG - Intergenic
963051265 3:141146079-141146101 GAGGGTGGGGGCAGGTAGGGGGG - Intronic
963762192 3:149295205-149295227 TCGGCTGGGGGCAGTCAGAGAGG + Intergenic
964000915 3:151771129-151771151 GACACTGGGGGCAGCCAGCCAGG - Intergenic
964757482 3:160101653-160101675 GAGGCTGCTGGCAGAGAGAGAGG + Intergenic
964818810 3:160747380-160747402 GGGGCGGGGGGCAGAGAGAGAGG - Intergenic
964969504 3:162542253-162542275 GGGGATGGAGGCAGACAGAGGGG - Intergenic
965845359 3:172954643-172954665 GTGGCTGAGGGCATACAGCATGG - Intronic
966329427 3:178794322-178794344 AAAGCTGGGGGCAGATAGAGGGG - Intronic
966606846 3:181829817-181829839 GAGGCTGTGGGCAGATCACGAGG + Intergenic
966815212 3:183884814-183884836 GAGGCTGGGCGCAGAGAGGCTGG - Exonic
967614614 3:191549523-191549545 GAGTCTGGAGGCAGGCAGAGGGG + Intergenic
968654673 4:1773338-1773360 GAGGGTGGGGGCCGAGAGGGAGG + Intergenic
968755902 4:2416666-2416688 GAGGCTGGGCGCAGACGGCTCGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968905651 4:3449493-3449515 CAGGCAGGGGCCAGGCAGCGTGG - Exonic
969309850 4:6346899-6346921 GGTGCTGGGGACAGACAGTGAGG + Intronic
969312975 4:6364834-6364856 CATGCTGGGGGCAGACAGGCAGG + Intronic
969327310 4:6451495-6451517 GAGGGTGATGGCAGCCAGCGCGG + Intronic
969592343 4:8129089-8129111 GAGGCTGGGGGCAGAGGCCCTGG + Intronic
969637634 4:8378481-8378503 CAGGCTGGAGGCAGGCTGCGGGG + Intronic
969637658 4:8378577-8378599 CAGGCTGGAGGCAGGCTGCGGGG + Intronic
969722083 4:8897715-8897737 GGGGCAGGGAGCAGACAGCCAGG + Intergenic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
971742685 4:30540224-30540246 TCGGCTGGGGGCAGTCAGAGTGG - Intergenic
972259240 4:37391801-37391823 ATAGCTGGGGGAAGACAGCGGGG - Intronic
975673168 4:76802013-76802035 GTGTCTGGGGGAAGCCAGCGTGG - Intergenic
977270721 4:94914648-94914670 GAGGCTGGGAGGAGAAAGGGTGG + Intronic
977528829 4:98175705-98175727 GAGGCTGGGAGCACACACTGAGG - Intergenic
978637109 4:110822760-110822782 GAAGCTTGGGGGAGACAGCTGGG + Intergenic
983846251 4:172523285-172523307 GAGCCTGGGGAAAGACAGAGTGG - Intronic
984424318 4:179563801-179563823 GAGGATGGGGGTACAGAGCGAGG + Intergenic
986000839 5:3629497-3629519 GAGGCTGGCGGCATCCCGCGTGG - Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986285321 5:6354587-6354609 GAGGCTGGGGAGAGACAGGCTGG + Intergenic
986285349 5:6354684-6354706 GAGGCTGGGGAGAGACAGGCTGG + Intergenic
986428013 5:7654085-7654107 GAGGCTGGGCGCAGTCACCACGG + Intronic
986542706 5:8863835-8863857 GAGGCTGGGGGAAGTCAGAGAGG + Intergenic
988066534 5:26232929-26232951 GGGGCAGGGGGCAGAGGGCGGGG - Intergenic
990237599 5:53784442-53784464 GAAGCTGGGAGCAGAAGGCGGGG - Intergenic
990532769 5:56690068-56690090 GAGGCTGGGGGAGGACAGCAAGG - Intergenic
991584204 5:68186160-68186182 GGGGCTGGCGGCAGGGAGCGTGG - Intergenic
995047462 5:107669165-107669187 GAGGCTGGAGGCAGGCGGAGAGG + Intronic
996762923 5:127003988-127004010 GAGGCTGGGGGCAGCCAGTGAGG + Intronic
997463453 5:134071277-134071299 GCGGGAGGGGGCAGCCAGCGCGG + Intergenic
998040268 5:138947058-138947080 GAGGCTGAGGGGTGCCAGCGTGG - Exonic
998424069 5:142012522-142012544 GAGTCTTGGGGTAGACGGCGGGG - Exonic
999112968 5:149138006-149138028 GAGGCAGGGAGCAGAAAGTGAGG + Intergenic
999241367 5:150129741-150129763 GAGGCTGGGGACTCACAGTGTGG + Exonic
999373705 5:151071806-151071828 GAGGCTGAGTGGAGACAGTGGGG - Intronic
1000863083 5:166479660-166479682 GAGGCTGGGGGCACATGGGGAGG + Intergenic
1001558078 5:172649791-172649813 GAGGCTGGGTGGACACAGGGAGG - Intronic
1001751582 5:174135517-174135539 TAGGCTGGGGGAAGGCAGAGAGG - Intronic
1001965689 5:175908516-175908538 ACGGCTGGGGGCAGAGAGAGAGG - Intergenic
1002021849 5:176368669-176368691 GGGGCTGTGGGCAGTGAGCGGGG + Intronic
1002021867 5:176368707-176368729 GGGGCTGTGGGCAGTGAGCGGGG + Intronic
1002021885 5:176368745-176368767 GGGGCTGTGGGCAGTGAGCGGGG + Intronic
1002056321 5:176599714-176599736 GAGCCTGGGGGCTGGCAGCTCGG - Exonic
1002251256 5:177930679-177930701 ACGGCTGGGGGCAGAGAGAGAGG + Intergenic
1002443379 5:179275589-179275611 GAGGCCATGGGCAGACAGGGAGG + Intronic
1002621989 5:180494518-180494540 GAGGCCGGGGGCCGAGAGGGCGG + Intronic
1002934865 6:1662820-1662842 GATGCTGAGGGCAGTCAGCTGGG + Intronic
1003445790 6:6182990-6183012 GAGCTTGGGGGCAGACAGCATGG - Intronic
1003526259 6:6900080-6900102 GGGGCAGGGGGCAGTAAGCGGGG + Intergenic
1005329790 6:24738749-24738771 AAGGCTGGGGGCAGTGAGGGCGG + Intergenic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006750306 6:36372780-36372802 GAGGGGTGGGGCAGGCAGCGTGG + Intronic
1007374501 6:41447048-41447070 GACTCTGGAGCCAGACAGCGTGG + Intergenic
1007504695 6:42326555-42326577 GAGGATGGGGCCAGACACCCTGG + Intronic
1007777814 6:44233559-44233581 GGGGCAGGAGGCAGACAGGGAGG - Exonic
1007930571 6:45687094-45687116 GAGGCAGGGTCCAGACTGCGTGG - Intergenic
1007959232 6:45943419-45943441 GTGGCTGGGGGCACACAGCAGGG + Intronic
1010104799 6:72154931-72154953 GAGGCTGGGAGCAGGAAGAGAGG + Intronic
1010380604 6:75219916-75219938 CAGGCTGTGGGCACACAGTGGGG + Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1012448313 6:99328791-99328813 AAGGCTGGAGGCAGACATCAAGG - Intronic
1012887168 6:104859513-104859535 GGGGCTGGGGGCGGCCAGTGGGG - Intronic
1015671857 6:135699769-135699791 GCGGGTGGAGGCAGACAGCCAGG + Intergenic
1015750119 6:136550524-136550546 GAGGGCGGGGACAGAGAGCGCGG + Intronic
1016329952 6:142945369-142945391 GGGGCTGGGGGCACACGCCGGGG + Intergenic
1016368279 6:143342256-143342278 GAGGCTGGGCGCAGAGAGGCTGG + Intergenic
1016573411 6:145540082-145540104 CAGGCTGGAGGCAGACACGGCGG - Intronic
1017282085 6:152636697-152636719 GAGCCTGGGCGCAGAGAGCCGGG - Exonic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1018063165 6:160106178-160106200 GAGGCTGGGCGGGTACAGCGCGG + Exonic
1018750511 6:166800267-166800289 GGGGCTGAGGGCAGACACAGTGG - Intronic
1018853970 6:167662612-167662634 CAGGCCGCGGGCAGAGAGCGCGG - Intergenic
1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG + Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1019723471 7:2587412-2587434 GAGGCGAGGGGCAGCCAGCGAGG + Intronic
1019792206 7:3023004-3023026 GAGGCCGGGGGAAGAGAGCTTGG + Intronic
1020136791 7:5592344-5592366 GAGGCTGGGAGCTGACAGCGCGG - Intergenic
1020430679 7:8113508-8113530 GAGGCTGGGGGCAGAGAAGGAGG + Exonic
1022122240 7:27320393-27320415 GAGGCTAGGGGAAGACAGTAAGG - Intergenic
1022414036 7:30162889-30162911 GAGGCTGGGGGAAGAGAGGGAGG + Intergenic
1022462087 7:30619153-30619175 GAGTCTGGTGTCAGACAGCCAGG - Intronic
1022572100 7:31464869-31464891 AGGGCTGGGGGCAGAGAGCTGGG + Intergenic
1023816096 7:43951106-43951128 GAGGCTGAGGGCAGTCAAGGTGG + Intronic
1023848758 7:44139099-44139121 GATGCAGGGGGCAGACAGAAAGG - Intronic
1023855102 7:44178071-44178093 GGGGATGGGGGTAGACAGGGAGG + Intronic
1023922260 7:44638916-44638938 CAGGATGGGGACAGACAGCAGGG + Intronic
1025079315 7:55968171-55968193 GGGAATGGGGGCAGACAGGGAGG - Intronic
1029361758 7:100093291-100093313 GAGACAAGGGGCAGACAGCTAGG - Exonic
1029481158 7:100813822-100813844 GAGGCTGGGGACAGCCAGAAAGG + Intronic
1029549948 7:101232370-101232392 GGGGCAGTGGGAAGACAGCGGGG + Exonic
1029640383 7:101816364-101816386 CGGGGTGGGGGCAGACACCGGGG - Intronic
1029657101 7:101934545-101934567 GAGGCTCGGGGCTGAGAGCTGGG - Intronic
1031931531 7:127690960-127690982 ATGGCTGGGGGCATACAGTGGGG - Intronic
1032508707 7:132455098-132455120 GAGGCTGCAGGCTGACAGCCGGG - Intronic
1033586797 7:142780273-142780295 GAGGCGGGGCACAGAGAGCGTGG - Intergenic
1034236113 7:149570960-149570982 AAGGCCGGGGCCAGACAGCGAGG + Intergenic
1034554143 7:151839300-151839322 GATGCTGGGGCAAGGCAGCGTGG + Intronic
1034556886 7:151855731-151855753 GTGGGTGGGGGCAGGCAGAGGGG + Intronic
1034997840 7:155589652-155589674 GAGGCTGGTGCCAGGCAGCACGG - Intergenic
1035087029 7:156269088-156269110 GAGGCTGGGGGCAGATGGGGAGG + Intergenic
1035326249 7:158067933-158067955 CAGGGTCGGGGCAGACAGGGTGG + Intronic
1036442470 8:8793654-8793676 GAGGCTGAGAGCAGACAGCATGG + Intronic
1036648354 8:10625890-10625912 CAGGTGGGGGGCAGGCAGCGAGG + Intronic
1037608116 8:20454593-20454615 GAGGCTGGGGGCAGAGGGGGTGG - Intergenic
1037638181 8:20719403-20719425 GAGGCATGGAGCAGACAGGGAGG - Intergenic
1037912498 8:22752194-22752216 GAGGATGGGACCAGACAGGGTGG - Intronic
1038026197 8:23592892-23592914 GAGGCTGGGGAGAGACTGAGAGG - Intergenic
1038179803 8:25215380-25215402 GAGGCTGGGGAGAGAGAGAGAGG + Intronic
1038553862 8:28493011-28493033 GAGTGAGGGGGCAGATAGCGTGG - Intergenic
1039085894 8:33779157-33779179 GGGGATGGAGGCAGACAGAGAGG - Intergenic
1039617158 8:38965229-38965251 GAGGCTGGGTGAAGACACCTGGG + Intronic
1045036022 8:98177099-98177121 GAAGCAGGGGGCAGGCAGGGGGG - Intergenic
1045544011 8:103112068-103112090 GAGGCTGGGGGGACAGAGCAAGG + Intergenic
1045611822 8:103852548-103852570 GAGGCGGGAGGGAGAGAGCGAGG - Intronic
1047635448 8:126756756-126756778 GAGGCTGGAGGCACATAGAGGGG - Intergenic
1047953669 8:129956820-129956842 GAGGCTGGGGGGAGGGAGGGAGG - Intronic
1048255727 8:132903738-132903760 GAGGCAGGCGGCAGACAGACAGG + Intronic
1049145823 8:141000809-141000831 GAGGCTTGGGGAAGACTGGGAGG - Intronic
1049384026 8:142331828-142331850 GTGGCTGGGAGAAGACAGGGAGG + Exonic
1049385597 8:142341491-142341513 GAGGCTGGGGTCAGGCCCCGGGG - Intronic
1049408582 8:142462513-142462535 CAGGCTGGGGCCAGACCTCGAGG + Intronic
1049815562 8:144597565-144597587 GAGGATGGGGGCAGGGGGCGGGG + Intronic
1049884313 9:17400-17422 GATGCTGGGGGCAGAGACAGAGG - Intergenic
1050231661 9:3532306-3532328 GAGGGAGGGGGCAGAGAGAGAGG - Intergenic
1051520061 9:17976722-17976744 GAGGCAGGGGGCAGGGAGGGAGG - Intergenic
1053415329 9:37943772-37943794 CTAGCTGGGGGCAGACAGCAGGG - Intronic
1054765995 9:69042883-69042905 GACTCTGGGGCCAGACAGCTTGG + Intronic
1054810678 9:69431432-69431454 GAGGCTGGGGGCTGGCTGCGTGG + Intronic
1055630628 9:78220008-78220030 CAGGCTGGGGGCAGACAGGAGGG + Intergenic
1056565875 9:87771773-87771795 GAGGGTGGGGGCAAGCAGCATGG + Intergenic
1057196766 9:93119869-93119891 GAGGTTGGGGGCGGCCAGCATGG + Intergenic
1057271853 9:93656032-93656054 GAGCCCGAGGGCAGACAGCGCGG - Intronic
1057524125 9:95784351-95784373 GAAGCTGGGGGCACCCAGCGGGG + Intergenic
1058286341 9:103184469-103184491 GTGACTAGGGGCAGACAGGGTGG - Intergenic
1059437437 9:114285182-114285204 GAGGCTTGGGACAGAGAGCAAGG + Intronic
1059528156 9:115012262-115012284 GATGATGGGGGCAGAGAGCAAGG - Intergenic
1059882574 9:118707935-118707957 GAGGCTTGGTGAAGACAGGGAGG + Intergenic
1060885310 9:127148247-127148269 CAGGCTGGGGGCTCACAGCTTGG - Intronic
1061084878 9:128393005-128393027 CAGGCTGGGGGCAGGGAGAGGGG - Intergenic
1061316068 9:129796509-129796531 GAGGCTGGTGGCAGGGAGGGAGG + Intergenic
1061541171 9:131278385-131278407 GTGGCTTGGTGGAGACAGCGCGG + Intergenic
1061550926 9:131334272-131334294 GAGGCTGGGGTCCTACAGCAAGG - Intergenic
1061589772 9:131590820-131590842 GAGCCTGGGCGCAGGCAGCAGGG + Intronic
1061657006 9:132099907-132099929 GGGGCTGGGGACAGTCAGGGAGG + Intergenic
1061874105 9:133535372-133535394 GAGGTGGGGGGCAGGCGGCGGGG + Intronic
1061952760 9:133945542-133945564 GAGGCTGGGGGCATCCTGAGAGG - Intronic
1061997309 9:134193080-134193102 GGGGCTAGGGGCAGAGAGTGGGG - Intergenic
1062183483 9:135203579-135203601 GGGGCTGGGGAAAGACAGCAGGG - Intergenic
1062204622 9:135329225-135329247 GAGGCCTGGGGAAGACAGCCCGG - Intergenic
1062367513 9:136218310-136218332 GGGGCTGGGGGGAGAGAGAGAGG - Intronic
1062473808 9:136717967-136717989 GGGGCTGGGGGCAGAAGGCAGGG + Intronic
1062488964 9:136795227-136795249 GAGGCTGGGGGCTGAGATCACGG - Intronic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1186031732 X:5376054-5376076 GTGGCTGGGGACAGTCAGAGAGG + Intergenic
1187505376 X:19874708-19874730 GAGGCTGGGGGTGGACAGTGAGG + Intronic
1190321985 X:49184969-49184991 GAGGCTAGGGGCGGACGGGGAGG - Intronic
1190505113 X:51119326-51119348 GAGGTGGGGGGCAGCCAGCCCGG - Intergenic
1190929278 X:54934421-54934443 GGGGCTTGGGGCTGACAGAGGGG + Intronic
1192204677 X:69088165-69088187 GAGGCTAGGGGGAGGCAGTGAGG + Intergenic
1192430616 X:71109089-71109111 GAGGTTGGGGTTAGACAGTGTGG + Intronic
1192452704 X:71253715-71253737 GGGGGTGGGGCCAGACAGGGTGG - Intronic
1195255036 X:103082017-103082039 GAGGCTGGGTGGAGACAGGTGGG + Intronic
1197700981 X:129599508-129599530 GAGGCTGAGGGCAGATCACGAGG - Intergenic
1198135168 X:133742245-133742267 GAGGTTGGGGACAGGCAGCTGGG + Intronic
1198312879 X:135437723-135437745 GAGACAGGTGGCAGACAGCGAGG + Intergenic
1198510209 X:137342780-137342802 TAGGCTAGGGGCAGAAAGTGAGG - Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1199693307 X:150325707-150325729 ATGGATGGGGGCAGACAGCTGGG + Intergenic
1200119842 X:153785042-153785064 GAGGTTGGGGGCAGGCAGGCCGG - Intronic
1200247155 X:154532305-154532327 GAGGCCGGTGGCACACAGGGAGG + Intronic
1200401492 X:156022756-156022778 GATGCTGGGGGCAGAGACAGAGG + Intergenic
1201750222 Y:17423431-17423453 GAAGCTGGGGTCAGAAAACGTGG + Intergenic