ID: 1163701112

View in Genome Browser
Species Human (GRCh38)
Location 19:18787099-18787121
Sequence ATCCAAGGGAAGGCTAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163701103_1163701112 7 Left 1163701103 19:18787069-18787091 CCCACAGGAACTTTAAGAATGAA 0: 1
1: 0
2: 1
3: 26
4: 270
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1163701101_1163701112 15 Left 1163701101 19:18787061-18787083 CCGTCCGGCCCACAGGAACTTTA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1163701102_1163701112 11 Left 1163701102 19:18787065-18787087 CCGGCCCACAGGAACTTTAAGAA 0: 1
1: 0
2: 3
3: 19
4: 206
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1163701098_1163701112 20 Left 1163701098 19:18787056-18787078 CCACCCCGTCCGGCCCACAGGAA 0: 1
1: 0
2: 3
3: 37
4: 422
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1163701100_1163701112 16 Left 1163701100 19:18787060-18787082 CCCGTCCGGCCCACAGGAACTTT 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1163701099_1163701112 17 Left 1163701099 19:18787059-18787081 CCCCGTCCGGCCCACAGGAACTT 0: 1
1: 0
2: 1
3: 29
4: 257
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1163701104_1163701112 6 Left 1163701104 19:18787070-18787092 CCACAGGAACTTTAAGAATGAAT 0: 1
1: 0
2: 3
3: 22
4: 253
Right 1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163701112 Original CRISPR ATCCAAGGGAAGGCTAGTGA GGG Intronic
902154591 1:14474437-14474459 ATCCAAGGGGAGACTATTCAGGG + Intergenic
902184681 1:14716498-14716520 GTCCAAGGGAAGGATTATGAGGG - Intronic
906398850 1:45490453-45490475 ATCGGAGGGAAGTCAAGTGAAGG + Intronic
906610624 1:47199394-47199416 ATCCAGGAGAAGGATGGTGATGG + Intergenic
906865766 1:49418043-49418065 ATCCAAGGGAAGACTTGGAATGG - Intronic
907558232 1:55364149-55364171 AACCAAGGGAAGGCTGGGCAGGG + Intergenic
907728088 1:57039151-57039173 ATTCAAGGAAATGCCAGTGATGG - Intronic
908454498 1:64289771-64289793 ATCTAAGGGAAGGATGGTAATGG + Intergenic
916051906 1:161042287-161042309 ATCCAAGGGAAGCTTTATGAGGG - Intronic
920519852 1:206615266-206615288 AGGGAAGAGAAGGCTAGTGAAGG - Intergenic
921330127 1:214027182-214027204 ACCCAGGGAAAGGCTAGAGAAGG - Intronic
922125570 1:222718034-222718056 AACCAAGTGAAAGCTAATGATGG + Intronic
923557094 1:235009834-235009856 ATCAAAGGGAAGACTGGTGTTGG + Intergenic
1063608910 10:7546634-7546656 ATCCGAGGGAAAGCTAATGAGGG + Intergenic
1064416253 10:15152757-15152779 GTCCAAGGGAGGGTTAGTGAAGG + Intronic
1066433088 10:35371483-35371505 ATACAAGGGAAGGTCAGTGAAGG - Intronic
1070282710 10:75061626-75061648 AGTCAAGGGAAAGGTAGTGAGGG + Intergenic
1070772116 10:79088574-79088596 GTCCCAGGGAAGGTTGGTGAAGG - Intronic
1072219347 10:93314755-93314777 TTCCAAGGGAAGGCCAGGCATGG + Intronic
1073894500 10:108139164-108139186 ACCCAGGGGAAGGCCAGTCATGG - Intergenic
1074837290 10:117309442-117309464 ATCAAAGGCCAGGCTAGAGATGG - Intronic
1076326171 10:129624611-129624633 ATCCAAGGGAAGGCAGAGGAGGG + Intronic
1079574907 11:21991389-21991411 AGACAAGGGAAGGATAGGGAGGG + Intergenic
1079575055 11:21993686-21993708 AGACAAGGGAAGGATAGGGAGGG + Intergenic
1079877368 11:25876845-25876867 TTCCAAGGGAAGGCAAGACAGGG - Intergenic
1080457352 11:32429191-32429213 ACCCAAGGGAAAGCTGGTGAGGG + Intronic
1080811667 11:35710550-35710572 ATGGAAGGGAAGGCTAGTTATGG + Intronic
1082691265 11:56307848-56307870 ATGCATTGGAAGGGTAGTGATGG + Intergenic
1083018215 11:59478211-59478233 ATCCATGGGGAGGGCAGTGAAGG - Exonic
1083029491 11:59579054-59579076 ATCCCTGGGAAGGGTAGTGAGGG - Intronic
1083995451 11:66269335-66269357 AGCCAAGGGAAGGGGTGTGACGG - Intronic
1087279074 11:96190331-96190353 GTCCCAGGGAAGGTTAATGAGGG + Intronic
1088594515 11:111430354-111430376 ATTCAGTGGAAGGCTAGTCAAGG - Intronic
1088991133 11:114954508-114954530 ATTCAAGGGACTGCCAGTGATGG - Intergenic
1092780475 12:11981733-11981755 TTTCAAGGGAAGGCTTTTGAAGG + Intergenic
1093103439 12:15055791-15055813 AAGCAAGGGAAGGCCAGGGAAGG + Intergenic
1093406959 12:18816142-18816164 AAACAAGGGAATGTTAGTGATGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098469097 12:70823795-70823817 AGCCAAGAGAGGGCCAGTGAGGG + Intronic
1100380475 12:94057157-94057179 ATAGAATGGAAGGCTGGTGAGGG - Intergenic
1101323747 12:103696740-103696762 AACCAAGGAAAGGCCAGGGACGG + Intronic
1102012229 12:109625805-109625827 ATCCAAGGGTGGTCTCGTGAGGG - Intergenic
1106412411 13:29519665-29519687 TTCCATGGGAAGGCCAGGGAGGG - Intronic
1107007567 13:35631507-35631529 AACCAAAGGAAGGCTAATTATGG + Intronic
1113366655 13:109682839-109682861 AGCCAAGGGAGGGCTAATGATGG - Intergenic
1113472148 13:110554833-110554855 TTTCAAGGAAAGGCTCGTGATGG - Intronic
1119335482 14:73829909-73829931 TTCCAAGGGCAGGCTGCTGAAGG - Intergenic
1119743786 14:77030101-77030123 ATCCCAGGGAAGGCTGGAGAAGG + Intergenic
1119774009 14:77237422-77237444 ATCCCAGGAAAGGCCAGTAAGGG + Intronic
1121042345 14:90759335-90759357 AGCCAAGGGATGGGTGGTGACGG + Intronic
1121205542 14:92163192-92163214 ATCTAAGGGTAGGCTAGTTGTGG - Exonic
1121441232 14:93950908-93950930 CTCTAAGGGAAGGCGAGTTAGGG - Intronic
1124724069 15:32139373-32139395 ATACAAGGGAAGGCAATTGTTGG + Intronic
1124804801 15:32870827-32870849 ATTCAAGGGAAGGCTTCTCATGG - Intronic
1131872428 15:96776233-96776255 AACCAAGAGAAGGGAAGTGATGG - Intergenic
1132395822 15:101473396-101473418 ATCCAAATGAAGGCTAGGCATGG - Intronic
1135459439 16:22628644-22628666 ATCCAAGGGAAAGCGAGTGGTGG + Intergenic
1138341206 16:56290174-56290196 TTCCAAGGGAGGGGAAGTGATGG - Intronic
1138865823 16:60818136-60818158 ATCCATGTGAAGGTTTGTGAAGG + Intergenic
1140200186 16:72888641-72888663 AGCCAAGGGAAGGCAAGGGAAGG + Intronic
1140770717 16:78201653-78201675 ATCCAAGGAATGCCCAGTGAGGG - Intronic
1141612221 16:85188084-85188106 ATCCAAGGGGAGGCAGGTGTGGG + Intergenic
1141724539 16:85778500-85778522 ATCCAAGGGCAGGGGAGAGAAGG + Intronic
1143017813 17:3900540-3900562 ATGGGAGGGAAGGCCAGTGAGGG - Intronic
1143323366 17:6082267-6082289 ATCCCAGGGAACACTAGTGGGGG + Intronic
1144401932 17:14913009-14913031 AGGAAAGAGAAGGCTAGTGAGGG + Intergenic
1146605058 17:34250949-34250971 GGCCCAGGGAAGGCTCGTGATGG - Intergenic
1147038214 17:37697721-37697743 GTCGAAGGGCAGGGTAGTGAGGG + Intronic
1149156730 17:53639787-53639809 ATCCAAGAGAAAGTTAGAGATGG - Intergenic
1150937374 17:69651417-69651439 ATCCTAGGGAAGGACAGTAATGG - Intergenic
1151692040 17:75692562-75692584 AGGCAAGGGAAGACTTGTGACGG + Intronic
1156262736 18:35459922-35459944 ATCCCAGGGAAGGAAAGCGAGGG + Intronic
1159255486 18:65939444-65939466 ATCCAAGGGCAGGCTGGCGGTGG - Intergenic
1161670050 19:5602073-5602095 ATGGAAGGGAAGGCTAATGAAGG + Intronic
1162924621 19:13923974-13923996 ATACAAGTGAAGGATGGTGAGGG + Intronic
1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG + Intronic
1166538184 19:43589014-43589036 ATCCAAGGGCAGACAAGGGATGG - Exonic
1167051897 19:47084488-47084510 ATGAAAGGGAAGGGTAGAGATGG + Intronic
1167892756 19:52555232-52555254 ATACAAGGGATGACCAGTGACGG - Exonic
930582224 2:53226034-53226056 TTTAAAGTGAAGGCTAGTGAAGG - Intergenic
932679570 2:73813177-73813199 ATTCAAGGGAAAGATAGGGAAGG + Intronic
940438417 2:153683630-153683652 ATTAACGTGAAGGCTAGTGAGGG + Intergenic
940855955 2:158728892-158728914 ATCCAAGGGAACACTAATGATGG - Intergenic
941377570 2:164750692-164750714 ATGCATTGGAAGGCCAGTGAAGG - Intronic
945386776 2:209210200-209210222 TTTCAAGGGCAGGCTAGTGGTGG - Intergenic
946107691 2:217386368-217386390 ATCCCAGGTAAGGCTTATGAAGG - Intronic
946990609 2:225325514-225325536 TTGCAAGGGAAGGATAGTGGGGG - Intergenic
947995494 2:234523915-234523937 TTCCAAGGGCAGGCAACTGAGGG - Intergenic
1168895956 20:1323634-1323656 ATCCGAGGGATGGGGAGTGAGGG - Intronic
1169092169 20:2867600-2867622 TGCCAAGGGAAGGCTAGATAGGG - Intronic
1169957222 20:11117575-11117597 CTTCAAGAGAAGGCTTGTGAAGG + Intergenic
1175542064 20:59754230-59754252 AACCCAGGGATGGCAAGTGAAGG + Intronic
1175867394 20:62186817-62186839 ATCCCAGGGAAGGCTGGGCACGG - Intronic
1176078793 20:63261367-63261389 ATCCAGGGGAGGGCCAGTGCGGG - Intronic
1178276690 21:31245251-31245273 TTCCAAGTGAAGGCTAAGGAGGG - Intronic
1178498909 21:33109875-33109897 AAACAAGGGAAGGGTGGTGAGGG - Intergenic
1183472337 22:38016356-38016378 ATCCCAGGGACGGCTGGTGGAGG - Intronic
1184183591 22:42848620-42848642 ATGTAAAGGAATGCTAGTGAGGG + Intronic
1184804264 22:46782396-46782418 ATGGAAGGGAAGGCTCGAGATGG - Intronic
949537220 3:5005249-5005271 AGCCAAGGGAAGGCTTTTTAAGG - Intergenic
952238153 3:31501883-31501905 TTCCAAGTGAAGGCCAGTCACGG + Intergenic
952906157 3:38140333-38140355 CTCCATGGGAAGGCTTGGGAGGG - Intronic
955158520 3:56441835-56441857 ATCCCAGGGAAGGCTGGGGATGG - Intronic
956815789 3:72907062-72907084 ATCCAAGGGAAGGCAGATGGTGG + Intronic
958542319 3:95494709-95494731 ATCAAAGGAGAGGCTAATGATGG + Intergenic
958990527 3:100839034-100839056 ATCCAATGTAAAACTAGTGATGG - Intronic
959112790 3:102142218-102142240 AACAAAGGGAAGGAAAGTGAAGG - Intronic
960065052 3:113362510-113362532 ATCCAGGAGAAGGATAGGGATGG - Intronic
962204815 3:133425913-133425935 GGGCAAGGGAAGGCTAGGGAAGG + Intronic
965668584 3:171122350-171122372 AGCCAAGGGAACGTTAGTGCTGG - Intronic
968999518 4:3969081-3969103 ACACCAGGGAAGGCTTGTGATGG - Intergenic
970140232 4:12974278-12974300 AAGCAAGGGAAGGGAAGTGAAGG + Intergenic
972330221 4:38057326-38057348 ATACAAGGGAAGGGGAGGGAGGG - Intronic
973147031 4:46840052-46840074 ATCCAAAGGAAGGCAATTGCTGG + Intronic
973695004 4:53482067-53482089 CTCCAAGGGAAAACTAGGGAAGG + Intronic
977444692 4:97115890-97115912 ATCCAAGGAAAGCCTAGAAAGGG + Intergenic
977996298 4:103500558-103500580 AGCCATGGGAAGGCTTGTCAGGG - Intergenic
978788265 4:112634343-112634365 AGTCAAGGGAAGGCCAGTGAAGG + Intronic
979637672 4:122976608-122976630 CTAAAAGGGGAGGCTAGTGAGGG - Intronic
984982290 4:185294081-185294103 ATCCAAGAGAATGATAGTGCTGG + Intronic
986497466 5:8359649-8359671 CACCAGGGGAAGGCCAGTGAAGG + Intergenic
988871275 5:35392688-35392710 ATCCAAAAGAAGGCTGGTAAAGG + Intergenic
989200223 5:38755824-38755846 GTCACAGGGAAGACTAGTGAAGG + Intergenic
991665826 5:68999034-68999056 CTCCAAGGCAAGGCTGGAGATGG - Intergenic
992400418 5:76405766-76405788 CTTCATGGGAAGGCTAGGGAAGG + Intronic
995449901 5:112289154-112289176 ATGGAAGAGAAGGCTAGAGAAGG + Intronic
997725443 5:136116585-136116607 AGCCAAGTGAAGGCTTTTGAAGG + Intergenic
1001876582 5:175206807-175206829 ATCCAAGCAAAAGCTACTGAGGG + Intergenic
1001925166 5:175630898-175630920 ATTCAAGCAGAGGCTAGTGAGGG - Intergenic
1005591193 6:27329342-27329364 ATCTCAGGGAAGGCTATTTAGGG - Intergenic
1007068242 6:39014858-39014880 TCCCAAGAGAAGGCAAGTGAGGG + Intronic
1007454728 6:41967887-41967909 ACTCAAGGGAAGGCTGGAGAAGG - Intronic
1008686244 6:53929158-53929180 CTCCAAGGGTAGGCTATTAAAGG - Intergenic
1014459303 6:121676504-121676526 ATCAAAGGTAAGGCTTGTGAAGG - Intergenic
1018335387 6:162781823-162781845 ATCCAAAGGAAGGCAAGAAAAGG + Intronic
1018641543 6:165908573-165908595 CACCAAGGCAAGTCTAGTGAAGG + Intronic
1018740198 6:166722598-166722620 CTCCAGGGATAGGCTAGTGAGGG - Intronic
1020856375 7:13430136-13430158 ATCCAAGGGAAGGCAACTGAAGG + Intergenic
1021075607 7:16300593-16300615 AACCAGGGGAAGGGGAGTGAGGG + Intronic
1023498660 7:40825149-40825171 ATCCAAAGAAATGCAAGTGAAGG - Intronic
1024515364 7:50248283-50248305 AGGCAAGGGAAGGCAAGGGAAGG + Intergenic
1029376975 7:100184360-100184382 ATCCAAAGGAAGGCAAGCAAAGG - Intronic
1031591568 7:123598790-123598812 AGCCAAGCAAAGGCAAGTGACGG - Intronic
1031785123 7:126020703-126020725 ATCCAAGGGACAGCTAGTAAGGG + Intergenic
1032717673 7:134524541-134524563 ATGCAAGTGAAGGCAACTGAAGG + Intergenic
1037086366 8:14855789-14855811 TTCCAAAGGCAGCCTAGTGATGG + Intronic
1045342501 8:101267222-101267244 ATGTAAGGGAAGGCCAGTCAAGG - Intergenic
1047927136 8:129693025-129693047 TTCCAAGGGCAGGATAGTGCAGG - Intergenic
1049703481 8:144025257-144025279 AACCAAGGGGAGGATTGTGAGGG - Intronic
1049775085 8:144400388-144400410 GTCAAAGGGCAGGCTGGTGAGGG + Exonic
1049974586 9:849420-849442 ATACAGGGAAAGGCCAGTGACGG + Intronic
1050135153 9:2455233-2455255 AACCATGGGAAGGGTAGTGGGGG - Intergenic
1060986797 9:127824753-127824775 ATCCAAGGGAGGGGAAGGGAAGG + Intronic
1061377319 9:130234240-130234262 AGCCAAGAGAAGGCCAGGGAAGG - Exonic
1061616641 9:131784764-131784786 ATCCAAGGGAAAGCTGGTGAGGG + Intergenic
1062437632 9:136553625-136553647 ATTCAAGGGAAGAAGAGTGAAGG + Intergenic
1186108571 X:6231276-6231298 AAGGAAGGGAAGGGTAGTGAAGG + Intergenic
1186758072 X:12694077-12694099 CTCCCAGGGGAGGCTAGTAAGGG - Intronic
1187035953 X:15539478-15539500 TTCAGAGGGAAGGCTTGTGATGG - Intronic
1187591289 X:20720243-20720265 TTTCAAGGGAAGTCTAGGGAAGG + Intergenic
1188039076 X:25350932-25350954 ACCCAAGGAAAGGTAAGTGAAGG - Intergenic
1188496983 X:30791780-30791802 ATGCAAGGCAAGGCAAGTCAAGG - Intergenic
1188817470 X:34732591-34732613 AGCAAAGTGAAGGCAAGTGAAGG - Intergenic
1194967341 X:100303587-100303609 ATTCAAGGGAACACCAGTGAAGG + Intronic
1197683847 X:129417007-129417029 ATCCAAGGGCAGGGTGGTGGAGG + Intergenic
1197696896 X:129559487-129559509 ATCCAAGGGAAGGCCAAGCACGG - Intronic
1197707697 X:129646403-129646425 CTCCAAGGAATGGCTGGTGATGG + Exonic
1197839466 X:130730117-130730139 GACAAAGGGAAGGCTAGTGAAGG - Intronic
1201074316 Y:10175472-10175494 GGGCAAGGGTAGGCTAGTGACGG + Intergenic
1201211409 Y:11684193-11684215 ATCCAATGGAAAGTTATTGAAGG + Intergenic