ID: 1163702130

View in Genome Browser
Species Human (GRCh38)
Location 19:18791231-18791253
Sequence CAGGGTGAGCAGAAGAACGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 373}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163702124_1163702130 2 Left 1163702124 19:18791206-18791228 CCTGTCCGGACGCGCCGAGGGCA 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG 0: 1
1: 0
2: 1
3: 22
4: 373
1163702119_1163702130 17 Left 1163702119 19:18791191-18791213 CCAACGGGCTCTGGCCCTGTCCG 0: 1
1: 0
2: 2
3: 9
4: 103
Right 1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG 0: 1
1: 0
2: 1
3: 22
4: 373
1163702118_1163702130 18 Left 1163702118 19:18791190-18791212 CCCAACGGGCTCTGGCCCTGTCC 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG 0: 1
1: 0
2: 1
3: 22
4: 373
1163702123_1163702130 3 Left 1163702123 19:18791205-18791227 CCCTGTCCGGACGCGCCGAGGGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG 0: 1
1: 0
2: 1
3: 22
4: 373
1163702125_1163702130 -3 Left 1163702125 19:18791211-18791233 CCGGACGCGCCGAGGGCAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG 0: 1
1: 0
2: 1
3: 22
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163702130 Original CRISPR CAGGGTGAGCAGAAGAACGC AGG Exonic
905773898 1:40655527-40655549 CAAGGTGAGCAGAAGAGAGCAGG + Intronic
906566003 1:46801540-46801562 CAGGTTGAGCAGACAAAGGCTGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
907336713 1:53704517-53704539 CTGGGTGAGCAGATGAACAGTGG + Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911342039 1:96651403-96651425 GAGGGTGAGCTGAAGAAGGGCGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
915059566 1:153169832-153169854 GAGGGTGAGAAGAATAAGGCAGG - Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915139991 1:153761640-153761662 GAGGGTGAGCTGCAGAACTCAGG - Exonic
916718515 1:167464665-167464687 CAGGGTGAGTAGAAGAAGAGGGG + Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918319392 1:183350261-183350283 CAGGGTGTGCAGGAGAACAAGGG + Intronic
920379530 1:205527664-205527686 CAGGGTGTGCAGGAGAATGAGGG + Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921570473 1:216772126-216772148 CATGGTGAGCTGAAGAATGGAGG + Intronic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921647711 1:217637434-217637456 CAGGTTGAGAAAAAGAAAGCAGG + Intronic
921689073 1:218126915-218126937 CAGGAACAGCACAAGAACGCAGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924772724 1:247090494-247090516 AAGGGGGAGCAGCAGAACCCGGG + Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1066243119 10:33556852-33556874 CAGGGTGAGCGGAGGAGAGCTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1068116771 10:52744677-52744699 CAGGGTGAGGAGCAGAGAGCAGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070446587 10:76510541-76510563 CAGGGAGATCAGAAGAACCTCGG + Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072374527 10:94800991-94801013 GAGGGTGAGCTGAAGAAGGGTGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1073038996 10:100586591-100586613 CAGGGTGAGCAGAAATAAACAGG - Intergenic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1075873293 10:125786757-125786779 GAGGGTGAGCAGAAGAAATGAGG + Intronic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1075990783 10:126836943-126836965 GAGGGTGAAAAGAAGAACTCTGG - Intergenic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1078797522 11:14607634-14607656 CAGGGGGAGCAGGTGAAGGCAGG + Intronic
1078981133 11:16536474-16536496 GAGGGTGAGCTGAAGAAGGGCGG + Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1082113957 11:48307692-48307714 CAGGGTGAGGACTAGAACACAGG + Intergenic
1082234763 11:49810817-49810839 CAAGGTGATCAGAACAATGCTGG + Intergenic
1082608468 11:55271509-55271531 CAAGGTGATCAGAACAATGCTGG + Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1082884224 11:58066715-58066737 CAGGGTCACCAGAAGAACAGAGG - Intronic
1083003716 11:59321429-59321451 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084531129 11:69728520-69728542 AAGAGTGACCAGCAGAACGCTGG + Intergenic
1084900130 11:72303428-72303450 CAGGGTGGCAAGAAGAACCCTGG + Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094757774 12:33492412-33492434 GAGGGTGAGCTGAAGAAGGGTGG + Intergenic
1095468138 12:42509472-42509494 AAGGGTGAGCAGAATAAGGCAGG - Intronic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1100741706 12:97600983-97601005 CAGGGTGATCAGAACAAAACAGG - Intergenic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1104951446 12:132442415-132442437 CTGGGAGTGCAGAGGAACGCGGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107674164 13:42777244-42777266 AACGGTGAGCAGAAGAAGGGTGG - Intergenic
1108591192 13:51914416-51914438 CAAGGTGAGCAGGAGAACACTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1112338961 13:98537118-98537140 CAGTGTAGGCTGAAGAACGCTGG - Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1114494754 14:23124954-23124976 CAGGGAGGGCTGAAGAAAGCTGG - Intergenic
1114624610 14:24120741-24120763 CTAGTTGAGCAGAAGAACTCTGG - Intronic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118876925 14:69793740-69793762 CAGGGGGAGCAGATGAACTTGGG + Intronic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1122286063 14:100653624-100653646 CAGGGTGAGAAGAGGCTCGCTGG - Intergenic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1126348006 15:47717215-47717237 GAGGGTGCGCAGCAGAGCGCCGG + Intronic
1126452428 15:48823394-48823416 TAGGGGGAGCAGAAAAACGTTGG + Intergenic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129338621 15:74870103-74870125 CTGGGTGGGAAGAAGAAAGCTGG - Intronic
1129738779 15:77979904-77979926 CAGGGTCAGGAGGAGAAAGCTGG - Intergenic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1133611871 16:7441146-7441168 AATGGTGAGCAGGAGAACCCTGG - Intronic
1135340992 16:21647860-21647882 CAGGGTGCGGACAAGAAAGCAGG - Intronic
1137730768 16:50687983-50688005 CAGAGTGAGCAGAAGCTCACAGG + Intergenic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1137884153 16:52084548-52084570 CCCAGTGAGCAGAAGAACCCTGG + Intergenic
1138109997 16:54316160-54316182 GGGGGAGAGCAGAAGAAAGCAGG - Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1139383507 16:66549524-66549546 CAGGGAGGGCAGGAGAGCGCCGG + Intronic
1140955526 16:79861480-79861502 CAGGGGCTGCAGAAGAGCGCAGG + Intergenic
1142125859 16:88409967-88409989 CAGGGTGCGCAGCAGAGCCCAGG + Intergenic
1142220310 16:88851054-88851076 CAGGGTCAGCAGATGAGAGCTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143484951 17:7249001-7249023 CAGGGTGAGGCAAAGAACACTGG + Intronic
1148688097 17:49512049-49512071 CAGGGTGAGCAGCGGCCCGCTGG + Exonic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1151077247 17:71287723-71287745 GGGGGTGAGCAGGAGAACGGAGG + Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1154041992 18:10865156-10865178 CAGGGTGAGGACATGAAGGCAGG + Intronic
1154982808 18:21517807-21517829 CAGCGAGGGCAGAAGAAAGCAGG - Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1156035937 18:32769184-32769206 TTGGGTGAGCAGAAGAGCCCAGG - Intronic
1157206711 18:45706905-45706927 AATGGTGAGCAGAAGAGCACAGG + Intergenic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1160251988 18:77210692-77210714 CAGGGTGTGAAGAAGAAGGCAGG - Intergenic
1160368766 18:78352945-78352967 CGGGGTGAGCTGAAGAGCTCTGG + Intergenic
1160731906 19:645035-645057 CAGGGTGAGCAGAAGCTCTCGGG - Intergenic
1161666465 19:5579981-5580003 CAGGGTGTGCAGAAGCCCCCAGG - Intergenic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1162050027 19:8027504-8027526 CAGGGTGCGCAGAGGACCTCAGG + Intronic
1162397125 19:10423747-10423769 CAGGGTGAGTAGAAAAAAACAGG + Intronic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164556319 19:29255462-29255484 GAGGGTGAGCTGAAGCATGCTGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165931283 19:39360896-39360918 CCTGGTGAGCAGAAGAACCTGGG - Intronic
1166324837 19:42042756-42042778 CTGGGTGGGCAGAAGAAAGCAGG + Intronic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925059960 2:883452-883474 CAGGGGGAGCAGCAGAGGGCTGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925933688 2:8732818-8732840 CAGGGTGTGGAGAACAACGGGGG - Intronic
926292122 2:11539540-11539562 AAGGGTCAGGAGAAGAACACAGG - Intronic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927964667 2:27261831-27261853 GGGGGTGAGCAGAAGAGAGCTGG - Intronic
928244074 2:29612098-29612120 CAGGGTGTGCAACAGAACCCAGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
932621730 2:73268936-73268958 GAGGTGGAGCAGAAGATCGCGGG - Exonic
933317794 2:80736558-80736580 GAGAGTGAGCAGAAGTACGGTGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
936799065 2:116244165-116244187 CAGGGTGAGGAGAATAGAGCAGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939200293 2:139025203-139025225 CAGAGTGAGCAGCAGCACTCAGG - Intergenic
940525197 2:154805343-154805365 CAGAGGGAGTAGAAGAACGCCGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
946905055 2:224407673-224407695 CTGGGTGAGCAGCAGAACCAGGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947669267 2:231926205-231926227 CAGCGTGAGCAGCAGGGCGCAGG + Exonic
948487892 2:238292362-238292384 CAGGGTGAGGCGAAGAAAGATGG - Intergenic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1173946494 20:46955040-46955062 ATGGGTGAGCAGAGGAAGGCAGG + Intronic
1174751125 20:53112201-53112223 CAGGGAGAGCAGAACCACACAGG + Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175048457 20:56129559-56129581 CAGGGTTAGGGGAAGAAAGCAGG + Intergenic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1179962780 21:44779562-44779584 CAGGGGGAGCAGAGTAACCCAGG - Intronic
1181930375 22:26396086-26396108 CAGGGTGCTCAGAACAAAGCAGG + Intergenic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1184273768 22:43399079-43399101 GAGGGTGAGCAGCTGAACCCAGG - Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949857276 3:8473210-8473232 CAGGGTGAGTAGGAGATCACTGG - Intergenic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960939767 3:122925975-122925997 CAGGGTTACCAGAAGACTGCTGG + Intronic
961820177 3:129571874-129571896 GTGGGTGAGCAGCAGAAGGCAGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962665963 3:137654052-137654074 GAGGGTGAGCCGAAGAAGGGTGG + Intergenic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965820075 3:172676344-172676366 CATGGTGACAAGAAGAAGGCAGG - Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969477186 4:7428333-7428355 CAGGATGAGCGAATGAACGCTGG - Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970496227 4:16628774-16628796 GAGGGTGAGCCGAAGAAGGGTGG + Intronic
970517935 4:16851950-16851972 CAGAGTAGGCAGAAGAACACTGG - Intronic
972675454 4:41256316-41256338 CTGGGAGAGCAGTAGAAAGCTGG - Intergenic
974279938 4:59779963-59779985 GAGGGTGAGCGGAAGCAGGCTGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975570269 4:75809718-75809740 CATAGTGAGAAGAAGAATGCTGG - Intronic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
976759529 4:88533244-88533266 CAGCGTGGGCAGAATAAAGCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983412251 4:167416609-167416631 CATGGTGATGAGAAGAAGGCGGG - Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984924065 4:184791333-184791355 CTGGCTGAGCAGAAGAGTGCAGG + Intronic
985088356 4:186338401-186338423 CTGAGTGAAAAGAAGAACGCTGG - Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
990628046 5:57636328-57636350 TAGGATGGGCAGAAGGACGCAGG + Intergenic
990804246 5:59640330-59640352 AAGGGTGAGAGGAAGAACTCCGG - Intronic
991105411 5:62837237-62837259 GAGGGTGAGCTGAAGCACGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994111412 5:96008784-96008806 CAGAGAGAGCAGAAGAATCCTGG + Intergenic
995134967 5:108671193-108671215 GAGGGTGAGCAGAAGAAGTGTGG - Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996019528 5:118576444-118576466 GAGGGTGAGGAGAGGAACGTGGG + Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996856563 5:128014803-128014825 CAGGGTGAGCTTATGAACACAGG + Intergenic
997454418 5:134006288-134006310 CAGGGGGAGGACAAGAACTCAGG + Intergenic
997528826 5:134569973-134569995 CAGGGAGAGCAGTAGACTGCAGG - Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1005349914 6:24924061-24924083 CAGGCTGAGCAGACCCACGCTGG + Intronic
1006844191 6:37051235-37051257 CAGGGTGGGCAGGAGAGGGCTGG - Intergenic
1007929150 6:45675330-45675352 CAGGGTGAGCTGTAGAAGACGGG - Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015433307 6:133155389-133155411 GAGGGTGAGCAGAAGCATGTTGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018742572 6:166741789-166741811 CGGTGAGAGCAGAAGAATGCTGG - Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1023927382 7:44679530-44679552 CAGGGTAATCACAAGAACTCAGG + Intronic
1025255165 7:57379777-57379799 CAGGGTATGATGAAGAACGCAGG - Intergenic
1026535159 7:71233118-71233140 CAGGGTTAGCAGCCGAACACGGG - Intronic
1028703958 7:93816177-93816199 CATGGTGAGCAGAAACACTCTGG - Intronic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1031717379 7:125125515-125125537 GAGGGCGAGCAGAAGCAGGCTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032926851 7:136615817-136615839 AAGGGTGAGTTGAAGAACGGAGG + Intergenic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035048468 7:155984350-155984372 CAGGGTGAGCTCAATCACGCTGG - Intergenic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036129807 8:6098563-6098585 CAGAGAGAGCAGAAGCACCCAGG - Intergenic
1036432341 8:8702442-8702464 CAGGTTGAGCAGGAGCCCGCAGG - Exonic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1038662310 8:29507694-29507716 GAGGGTGAGAAGAGGAACGTGGG + Intergenic
1040745991 8:50643230-50643252 CAGTGTCAGCATAAGAAAGCAGG - Intronic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046283022 8:112058773-112058795 CAGAGTCAGCACAAGAACTCTGG - Intergenic
1047198842 8:122746514-122746536 GAGGGTGACCAGCAGAATGCAGG - Intergenic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1049422526 8:142523280-142523302 CAGGATGGGCAGAAGAACTGGGG + Intronic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1053302267 9:36960625-36960647 CAAGGTGAGCAGAATAATCCAGG + Intronic
1053417693 9:37957005-37957027 CAGGCTTAGGAGAAGAACTCAGG - Intronic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055409662 9:76015592-76015614 ATGGGTGAGCAGAAAAACACTGG + Intronic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1057677873 9:97149908-97149930 CAGGGTGGGGAGGAGAAGGCTGG - Intergenic
1057698186 9:97342147-97342169 GAGGGTGAGCCGAAGAAGGGCGG - Intronic
1057791246 9:98126624-98126646 CAAGGTGGGCAGCAGAACACAGG - Exonic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1062546668 9:137066657-137066679 CTGGGTGTGCAGAAGAGAGCTGG - Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1189804868 X:44725227-44725249 TAGGGTGACCAAAAGAAAGCTGG + Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192537447 X:71940420-71940442 AAGGGTGAGCAGATGATTGCAGG + Intergenic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194208586 X:91040470-91040492 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1195475465 X:105279978-105280000 CTGGGTGAGAAGAACAAAGCTGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198417434 X:136434781-136434803 CACGGTGAGCTGGAGAAAGCAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic