ID: 1163702698

View in Genome Browser
Species Human (GRCh38)
Location 19:18794130-18794152
Sequence GTTATCTGGAGAATATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163702698_1163702701 2 Left 1163702698 19:18794130-18794152 CCTGCTGATATTCTCCAGATAAC No data
Right 1163702701 19:18794155-18794177 TCCAGCCTAGCCATGATCCTCGG No data
1163702698_1163702703 3 Left 1163702698 19:18794130-18794152 CCTGCTGATATTCTCCAGATAAC No data
Right 1163702703 19:18794156-18794178 CCAGCCTAGCCATGATCCTCGGG No data
1163702698_1163702707 20 Left 1163702698 19:18794130-18794152 CCTGCTGATATTCTCCAGATAAC No data
Right 1163702707 19:18794173-18794195 CTCGGGACTGTGAGTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163702698 Original CRISPR GTTATCTGGAGAATATCAGC AGG (reversed) Intergenic
No off target data available for this crispr