ID: 1163704643

View in Genome Browser
Species Human (GRCh38)
Location 19:18805015-18805037
Sequence TTTTATGTAAATATGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163704643_1163704645 -4 Left 1163704643 19:18805015-18805037 CCTTCCTTCATATTTACATAAAA No data
Right 1163704645 19:18805034-18805056 AAAATACCCTTCTGTGACCCAGG No data
1163704643_1163704647 2 Left 1163704643 19:18805015-18805037 CCTTCCTTCATATTTACATAAAA No data
Right 1163704647 19:18805040-18805062 CCCTTCTGTGACCCAGGACTTGG No data
1163704643_1163704651 23 Left 1163704643 19:18805015-18805037 CCTTCCTTCATATTTACATAAAA No data
Right 1163704651 19:18805061-18805083 GGCTTAAATGTCAACACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163704643 Original CRISPR TTTTATGTAAATATGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr