ID: 1163708949

View in Genome Browser
Species Human (GRCh38)
Location 19:18833808-18833830
Sequence CCACGTAAGCCCCCCATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163708949_1163708951 1 Left 1163708949 19:18833808-18833830 CCTTGCATGGGGGGCTTACGTGG No data
Right 1163708951 19:18833832-18833854 AGTCGATTGAGTCACTCTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 18
1163708949_1163708952 2 Left 1163708949 19:18833808-18833830 CCTTGCATGGGGGGCTTACGTGG No data
Right 1163708952 19:18833833-18833855 GTCGATTGAGTCACTCTCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 14
1163708949_1163708953 18 Left 1163708949 19:18833808-18833830 CCTTGCATGGGGGGCTTACGTGG No data
Right 1163708953 19:18833849-18833871 TCGTGGGTAGACCACCCACTTGG 0: 1
1: 0
2: 0
3: 4
4: 44
1163708949_1163708954 19 Left 1163708949 19:18833808-18833830 CCTTGCATGGGGGGCTTACGTGG No data
Right 1163708954 19:18833850-18833872 CGTGGGTAGACCACCCACTTGGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163708949 Original CRISPR CCACGTAAGCCCCCCATGCA AGG (reversed) Intronic
No off target data available for this crispr