ID: 1163709997

View in Genome Browser
Species Human (GRCh38)
Location 19:18840671-18840693
Sequence AGTGCTGTTCGGGGCTCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163709982_1163709997 24 Left 1163709982 19:18840624-18840646 CCTGGCTGGAGGGGCTGGTGGGA 0: 1
1: 0
2: 3
3: 93
4: 788
Right 1163709997 19:18840671-18840693 AGTGCTGTTCGGGGCTCCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 89
1163709989_1163709997 -8 Left 1163709989 19:18840656-18840678 CCGGGCCCTGGCACCAGTGCTGT 0: 1
1: 0
2: 3
3: 35
4: 421
Right 1163709997 19:18840671-18840693 AGTGCTGTTCGGGGCTCCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163709997 Original CRISPR AGTGCTGTTCGGGGCTCCGG AGG Intronic
901973993 1:12930033-12930055 AGTGCTCTTGAGGGCTCAGGAGG + Intronic
902011187 1:13271735-13271757 AGTGCTCTTGAGGGCTCAGGAGG - Intergenic
902245462 1:15117775-15117797 TCTGCTTTTCGAGGCTCCGGAGG + Exonic
902776015 1:18675517-18675539 GGTGCTGTCCTGGGCTCTGGAGG + Intronic
903785549 1:25859046-25859068 CGTGCTGTTGGGGGGTCTGGAGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906694662 1:47815963-47815985 GGTGCTGTGCGGGGGTCCTGGGG + Intronic
907207689 1:52788534-52788556 AGTGCTGTTGGGAGCCCAGGAGG + Intronic
912505670 1:110154066-110154088 AGTGCTGTTCTGGATTCCAGTGG + Intronic
913681039 1:121187026-121187048 GGTGCTTTTCGGGGTGCCGGGGG - Exonic
914032869 1:143974666-143974688 GGTGCTTTTCGGGGTGCCGGGGG - Intergenic
914156577 1:145093300-145093322 GGTGCTTTTCGGGGTGCCGGGGG + Exonic
915915817 1:159940218-159940240 AGTGCTGTTCAGGGCACTGGGGG + Intronic
920468351 1:206205550-206205572 GGTGCTTTTCGGGGTGCCGGGGG - Intronic
924615910 1:245611867-245611889 AGTCCTGTTGGTGGCTCCTGCGG - Exonic
1071247437 10:83780267-83780289 GGTGCTGGTAGGTGCTCCGGTGG - Intergenic
1077194367 11:1272048-1272070 AGTGGGGTGCGGGGCGCCGGAGG + Intergenic
1088179442 11:107092536-107092558 AGTGCTGTTGGGGGTTACGGTGG + Intergenic
1091309628 11:134563207-134563229 AGTGCTGCTCTGGGCTCTTGGGG + Intergenic
1091692709 12:2607899-2607921 AGTGCTGTGCAGGGCTACAGAGG + Intronic
1095979521 12:47963521-47963543 TGCGCTCTTCGCGGCTCCGGAGG - Intergenic
1097274889 12:57806306-57806328 AGTGCAGGTCTGGGCTCCGAGGG + Intronic
1101829579 12:108246840-108246862 AGTGCTGTGGGGGGCTGCAGGGG + Intronic
1106121938 13:26867230-26867252 AGTGCTGTTTGCGGGTCCGTAGG + Intergenic
1106242818 13:27924205-27924227 GGGGCTGTGCGGGGCTCCGGGGG + Intronic
1113927897 13:113951472-113951494 AGTGCTGTTGGTGGCGGCGGGGG - Intergenic
1116066067 14:39984741-39984763 AGTGCTGTTCTGGACTACAGTGG + Intergenic
1117394809 14:55298640-55298662 AGCGCTGTTCGGGGCTGGAGGGG + Intronic
1117823703 14:59678152-59678174 AGTCCTGTTCTGGGGTCTGGAGG + Intronic
1118438348 14:65791245-65791267 AGCGCTGTTCGGGGGTGGGGAGG + Intergenic
1127153629 15:56105505-56105527 AGTGCTGTCCTAGGATCCGGAGG - Intronic
1131231788 15:90665299-90665321 AGCGCTGTGCCGGGCTCCGGGGG - Intergenic
1132777932 16:1606259-1606281 AGTGCTGTTTGTGGATCCTGAGG - Intronic
1134239370 16:12494098-12494120 AGTGCTATGCGAGGCTCAGGTGG + Intronic
1139116255 16:63957581-63957603 AGTGCTGTTCTGGGTTTTGGGGG + Intergenic
1139421331 16:66851244-66851266 AATTCTTTTCTGGGCTCCGGGGG - Intronic
1139631803 16:68235931-68235953 CGTCCTCTTCGGGGCTACGGCGG - Exonic
1142585416 17:969521-969543 ACGCCTATTCGGGGCTCCGGCGG + Intronic
1142699139 17:1649088-1649110 GGCGCTGGGCGGGGCTCCGGGGG - Intronic
1142699156 17:1649129-1649151 GGCGCTGGGCGGGGCTCCGGGGG - Intronic
1144650955 17:17006504-17006526 AGGGCAGTTCAGGGCTGCGGTGG - Intergenic
1144723835 17:17491375-17491397 GCTGCTGTTCGGGGCTCAGGTGG - Exonic
1146951517 17:36909964-36909986 AGTGCTGTTCTGGGCACCAAAGG - Intergenic
1148687004 17:49506662-49506684 AGTGCGGTTCGGGGGGCGGGGGG + Intronic
1149975317 17:61259805-61259827 AGTGCTTTTAGGGGCACCTGAGG + Intronic
1153947862 18:10032671-10032693 AGCGCTGTGCGGGGCGCCCGGGG + Intergenic
1157424291 18:47571727-47571749 AGTGCTGTTCGGGGTTTCTAAGG - Intergenic
1163709997 19:18840671-18840693 AGTGCTGTTCGGGGCTCCGGAGG + Intronic
1163742285 19:19022815-19022837 AGTGCTGTTGGGGCTTCCTGAGG + Intronic
1165383610 19:35497499-35497521 AGTGCTTTTCGGGGCCTCGGTGG + Exonic
1166765604 19:45251167-45251189 CGGGCTGGTCGGGGCGCCGGGGG - Intronic
935417839 2:102837528-102837550 AGTGCTGTGGGGGGTTCGGGGGG + Intronic
941000952 2:160203542-160203564 AGTGCTGCCCTGGGCTCCAGAGG + Intronic
947461262 2:230306524-230306546 AGTGCTCTTGGGGGCCCAGGAGG + Intronic
1168918996 20:1515574-1515596 AGTGCTGTTCAGGTCTCAGAAGG + Intergenic
1174111817 20:48202438-48202460 AGTGCTTTTAGGGGCTGGGGAGG + Intergenic
1175388102 20:58610208-58610230 AGGGCTGTCCTGGGCTCCAGAGG + Intergenic
1175590133 20:60182861-60182883 GGCGCTGTTCCGGGCTCTGGAGG - Intergenic
1175907211 20:62386802-62386824 GCTGCTATTCGGGGCTCCCGAGG + Intergenic
1178856537 21:36254826-36254848 AGTGTTGTTTGGGGCTGTGGGGG + Intronic
1181751070 22:24989583-24989605 AGGGCTGGTCAGGGCTCAGGGGG + Intronic
1184098864 22:42331024-42331046 AGGGCTGCTCGGGGCTGGGGCGG + Intronic
1184602029 22:45549377-45549399 AGTCCTGTGTGGGGCTCCCGAGG - Intronic
950364285 3:12472015-12472037 AGGGCTGTTCCTGGCTCGGGGGG + Intergenic
954353602 3:50066332-50066354 TGTGCTGTGCGGGGCTGTGGGGG - Exonic
954448999 3:50561649-50561671 AGTGCTGGGCTGGGCTCCGAAGG - Intronic
957227682 3:77470921-77470943 AGTGTTGTTTGGGTCTCCTGCGG + Intronic
967388414 3:188931773-188931795 AGTGCTGTCCAGGGCTCAGGAGG + Intergenic
970537081 4:17040950-17040972 AGCGGTGTTCGGGGCTCCCGGGG + Intergenic
975064494 4:70043374-70043396 AGGGATGTTCAGGGCTCAGGAGG + Intergenic
978955195 4:114603652-114603674 AGAGCTATTCGGGGCTCGAGAGG - Intronic
985080567 4:186260299-186260321 GGTACTGTTCTGGGCCCCGGGGG + Intergenic
987130000 5:14851338-14851360 AGTGCCATTCGGGGCTCAGAAGG + Intronic
987847908 5:23311474-23311496 TGTGTTGTTGGGGGCTCCGGTGG - Intergenic
991894940 5:71385407-71385429 AGTGCAGTTCGGTTCTCAGGGGG + Intergenic
1003260972 6:4515847-4515869 AGTGCTGTTCCAGGCACCGAGGG + Intergenic
1019110080 6:169702401-169702423 AGTGCTGCTGGGGACACCGGAGG - Exonic
1024279863 7:47710089-47710111 AGTGCTGTTGGGGTCACCTGTGG + Intronic
1024965519 7:55019630-55019652 GGAGCGGTTCGGGGCGCCGGAGG - Intronic
1026977956 7:74510080-74510102 AGTGGTGTTTGGGGCAGCGGTGG + Intronic
1029734194 7:102456485-102456507 AGTACTTTGCGGGGCTCAGGTGG - Exonic
1030470755 7:109959718-109959740 AGTGCCATTTGGGGCTCCTGTGG - Intergenic
1034913551 7:155018164-155018186 AGTGCTGTACGGGGGTCAAGAGG - Intergenic
1035704296 8:1663360-1663382 AGTGCTGTTTGGGGACCCGGTGG + Intronic
1036643766 8:10599789-10599811 AGGGCTGTCCTGGGGTCCGGAGG + Intergenic
1036826168 8:11977800-11977822 AGTGTTGTTCAGGGCAGCGGAGG + Intergenic
1045495286 8:102702965-102702987 AGTGCTGATCAGGGCTCCCCAGG + Intergenic
1049002862 8:139837359-139837381 AGTGCCGTTGGGGGCTGTGGTGG - Intronic
1049411102 8:142474371-142474393 AGTGCTGCTCCTGGCTACGGTGG - Intronic
1061391137 9:130317837-130317859 AGCGCTGTTTGGGGCTAAGGAGG + Intronic
1062437350 9:136552177-136552199 CGAGCTATTCGGGTCTCCGGGGG + Intergenic
1186638189 X:11427945-11427967 ACAGCTGTTGGGGGCTGCGGAGG + Intronic
1187496854 X:19802828-19802850 AGAGCTGTTCTGGGCCCCGGGGG - Intronic
1189122881 X:38413919-38413941 AGTGCTTTTCGAGGCTGAGGTGG - Intronic
1189301133 X:39953083-39953105 AGTTCTGTTCTGGGCTGCAGTGG - Intergenic
1190000928 X:46685649-46685671 GGAGCTGTTCAGGGCTCTGGGGG + Intronic
1190014368 X:46814084-46814106 AGTACTGTTCTGGGCACTGGGGG - Intergenic
1195343337 X:103925948-103925970 AGGACTGTTGGGGGCTCCTGTGG + Intronic
1196887476 X:120261889-120261911 AGTACTGTTCTGAGCTCTGGAGG - Intronic
1200077393 X:153557964-153557986 AGTGCTGTTCTTGGCTTTGGGGG + Intronic
1200309122 X:155059052-155059074 AGTGCTGTTCAGGCATCCTGAGG + Exonic