ID: 1163710184

View in Genome Browser
Species Human (GRCh38)
Location 19:18841882-18841904
Sequence GCGAGAGGCCCTTTCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163710181_1163710184 -5 Left 1163710181 19:18841864-18841886 CCATTGGTGAGAGGGGAGGCGAG No data
Right 1163710184 19:18841882-18841904 GCGAGAGGCCCTTTCTCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 110
1163710174_1163710184 11 Left 1163710174 19:18841848-18841870 CCGGTCCACACAGGTGCCATTGG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1163710184 19:18841882-18841904 GCGAGAGGCCCTTTCTCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 110
1163710176_1163710184 6 Left 1163710176 19:18841853-18841875 CCACACAGGTGCCATTGGTGAGA 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1163710184 19:18841882-18841904 GCGAGAGGCCCTTTCTCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163710184 Original CRISPR GCGAGAGGCCCTTTCTCTTT GGG Intronic
900517901 1:3091834-3091856 GGGACAGGCCCTTTCTCTCCAGG - Intronic
904682547 1:32239676-32239698 GAGAGAGCTCCTTACTCTTTAGG - Intergenic
906869963 1:49467430-49467452 GGGTAAGTCCCTTTCTCTTTAGG + Intronic
907462931 1:54616005-54616027 CAGAGAGGCCCTTACCCTTTTGG + Exonic
909030114 1:70529519-70529541 GCTTCAGGTCCTTTCTCTTTAGG + Intergenic
912760599 1:112363170-112363192 GCCAGAGGACCTTTGTCTTTTGG - Intergenic
913658323 1:120983031-120983053 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914009685 1:143766118-143766140 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914648305 1:149674792-149674814 GATAGGGGCCCTTTCTATTTTGG + Intergenic
915777553 1:158507100-158507122 GGGAGAGACCCTTTCTGCTTGGG - Intergenic
917341220 1:173979904-173979926 GAGTGAGACCCTGTCTCTTTAGG - Intronic
919620096 1:199855133-199855155 CACAGAGGCCTTTTCTCTTTCGG - Intergenic
920594821 1:207258835-207258857 GAGAGAGGCCCTGTTTGTTTGGG - Intergenic
922205903 1:223446014-223446036 GCCAGAGTCCCTTCCTTTTTAGG - Intergenic
924456429 1:244222523-244222545 GAGAGATGCCATTTCTGTTTAGG - Intergenic
1063355558 10:5395370-5395392 GCGCGAGGCCGTTACTCTGTGGG - Exonic
1064618576 10:17191184-17191206 GCTAGAGACACTTTCTCTCTGGG - Intronic
1065843464 10:29725560-29725582 GGGAGAGTCACTTCCTCTTTAGG - Intronic
1066067921 10:31775712-31775734 TAGAAAGGCCATTTCTCTTTTGG + Intergenic
1066110319 10:32189887-32189909 GCGAGAGGCCATTTCTCCCAAGG + Intergenic
1066570856 10:36770226-36770248 TAGTAAGGCCCTTTCTCTTTAGG + Intergenic
1067184700 10:44016653-44016675 GCTGGAGGCCCTTTCTCCATAGG + Intergenic
1074536734 10:114333332-114333354 GCTGGAGGCCCTTTCTCTTCAGG - Intronic
1075613248 10:123870614-123870636 GAGAGAGGCCCTGTCCCTCTGGG - Intronic
1076570296 10:131428276-131428298 GTGAGAGGGCCTTCCTCTTCTGG + Intergenic
1076990741 11:272248-272270 GGGGGAGGCGCTTTCTCTCTGGG + Intergenic
1077323569 11:1953551-1953573 CCCAGAGGCACTTTCTCTCTGGG + Intronic
1077811344 11:5640771-5640793 GGGTGAGGCCTTTTCTCTGTAGG + Intronic
1082086966 11:48058234-48058256 ACCAGAGACCCTGTCTCTTTTGG - Intronic
1083457113 11:62786708-62786730 GCCGGAGGACCCTTCTCTTTCGG + Exonic
1084556138 11:69877210-69877232 GGGAGAGGCTCATTCTCTTCTGG - Intergenic
1085163676 11:74374753-74374775 TCAACAGGCCCTTTCTCCTTTGG - Intronic
1087816272 11:102662475-102662497 GTCAGAGGCCCTTCCTCTTCTGG - Intergenic
1202806556 11_KI270721v1_random:8746-8768 CCCAGAGGCACTTTCTCTCTGGG + Intergenic
1094150759 12:27280512-27280534 GCCAGAGGAGCTTTTTCTTTTGG + Intronic
1097170472 12:57110116-57110138 TCCAGAGGACCTTTCTCTCTTGG - Intronic
1104111743 12:125710845-125710867 GTGAGAGGCCCTTTTGCTCTGGG + Intergenic
1112096299 13:96135929-96135951 GAGAGAGGCCCTTTCTTTTGGGG - Intronic
1116495276 14:45552802-45552824 GAGAGAGACTCTTTCTCTTTGGG - Intergenic
1120524233 14:85559290-85559312 AAGAGGGGCCCTTTCTCCTTCGG + Intronic
1121506447 14:94481425-94481447 CCAAGGTGCCCTTTCTCTTTGGG - Intergenic
1124609912 15:31201258-31201280 GCCCCAGGCCCCTTCTCTTTTGG + Intergenic
1128307856 15:66611783-66611805 GGCAGAGGCCCTTTCTGATTTGG + Intronic
1132580674 16:683386-683408 CCGAGTGGGCCTCTCTCTTTCGG - Exonic
1136622670 16:31440682-31440704 GCCAGAGGCCCTTTCTTATATGG - Intronic
1141786367 16:86203497-86203519 GAGGGAGGCCCTCTGTCTTTTGG + Intergenic
1143983259 17:10889177-10889199 GCTAGGGGCCATTTCCCTTTGGG + Intergenic
1145817715 17:27807620-27807642 GCTAGAGGCTCTTTTCCTTTGGG - Intronic
1146692029 17:34883343-34883365 GGGACAAGCCCTTTCTCTCTGGG - Intergenic
1146982381 17:37176452-37176474 TCCAGATGCCCATTCTCTTTGGG + Intronic
1148074613 17:44928256-44928278 GGAGGAGGCCCTTTCTCCTTTGG + Exonic
1150644453 17:66969309-66969331 GCGCCAGGACCCTTCTCTTTGGG - Intronic
1152698372 17:81807196-81807218 GGGAGAGGCCCCTACTCTGTGGG + Intronic
1152763372 17:82121566-82121588 GAGAGAGGCCCTTCACCTTTTGG + Intronic
1153346979 18:4037567-4037589 GCGCCATGCCTTTTCTCTTTTGG + Intronic
1154210617 18:12376398-12376420 GCAGGAGGCTCTTTCTCTGTTGG - Intronic
1158600763 18:58853989-58854011 AATAGAGGCCCTTTCTCTTGGGG - Intergenic
1163710184 19:18841882-18841904 GCGAGAGGCCCTTTCTCTTTGGG + Intronic
1164158671 19:22612142-22612164 TGGAGAAGCCCTTTCTCTGTAGG + Intergenic
1165041876 19:33074318-33074340 CCGAGTAGCCCTATCTCTTTAGG + Intergenic
1166419388 19:42624728-42624750 GCGACAGACCCTTACTCTTAAGG + Intronic
927307519 2:21590547-21590569 GGGAAAGCCCCTTTCTCTCTGGG - Intergenic
928402233 2:30987522-30987544 GCGAGTAGCCATTTTTCTTTTGG - Intronic
931655788 2:64510385-64510407 GTAAGAGGCCCATTCTCCTTTGG - Intergenic
931665436 2:64606996-64607018 GTGTGAGGCCCTTTGTATTTTGG + Intergenic
933994405 2:87657199-87657221 GAGAGAGGCCCTTTGTCCCTCGG - Intergenic
934745170 2:96754724-96754746 GCTAGAGGCCATTTCTTATTGGG - Intergenic
936249105 2:110853724-110853746 GCCCGAGGCCCTTTCTTGTTTGG + Intronic
936299453 2:111293714-111293736 GAGAGAGGCCCTTTGTCCCTCGG + Intergenic
937773559 2:125749713-125749735 GCAAGAGGCCCTTTTGCTTCTGG - Intergenic
939216132 2:139240844-139240866 CCCAAAAGCCCTTTCTCTTTGGG - Intergenic
941696841 2:168562172-168562194 GTTGCAGGCCCTTTCTCTTTGGG + Intronic
942205092 2:173612198-173612220 TCAAGTGGCCCTATCTCTTTAGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172753912 20:37270142-37270164 GCCAGATGCCCTTTCTCCTGTGG - Intergenic
1174060034 20:47826209-47826231 CCCAGAGGCCGTTTCTCTGTGGG + Intergenic
1177760836 21:25400447-25400469 GGGAGAGACTCTTTCTGTTTGGG + Intergenic
1177953425 21:27567389-27567411 TTGAGAGCCCCATTCTCTTTGGG - Intergenic
1180066268 21:45414080-45414102 GGGGGAGGCCCTTTCTGTATTGG + Intronic
1182508051 22:30799527-30799549 GCAAGTTGCCCTTTGTCTTTGGG - Intronic
1183077735 22:35437338-35437360 GTGAGAGAACCTCTCTCTTTTGG - Intergenic
1185277591 22:49956552-49956574 GGGAGAGGCCCTTTCCCCTCTGG - Intergenic
949484066 3:4520641-4520663 GAGCCAGGCCCTTGCTCTTTGGG - Intronic
954537366 3:51371264-51371286 GAGAGAAGCCCCTTCCCTTTTGG + Intronic
965931339 3:174046060-174046082 GAGATAGCACCTTTCTCTTTAGG - Intronic
969584054 4:8081767-8081789 GTGAGAGGCCCTTTCCCTTGGGG - Intronic
975552968 4:75631751-75631773 GCGAGAAGCCCTGTCCCATTTGG + Intergenic
976162504 4:82218578-82218600 GTGAAGGACCCTTTCTCTTTGGG - Intergenic
976609812 4:87018860-87018882 TCGAGAGGACATTTTTCTTTGGG + Intronic
978620865 4:110633359-110633381 TGGAGAGGACTTTTCTCTTTGGG + Intronic
979105634 4:116683079-116683101 GCTAGAGCTCCTTTCTCTATGGG - Intergenic
980983842 4:139676504-139676526 GGCAGAAGTCCTTTCTCTTTGGG + Intronic
982068207 4:151673031-151673053 GCCAGGTGCCCTTTCCCTTTGGG - Intronic
984790451 4:183610107-183610129 GAGAGATCCCCTCTCTCTTTGGG - Intergenic
989681358 5:44032826-44032848 GAGAGAGGCCCTGTTTGTTTAGG + Intergenic
990861776 5:60335410-60335432 GAGAGAGGGCCTCTGTCTTTTGG - Intronic
990961143 5:61394648-61394670 CCAAGTGTCCCTTTCTCTTTTGG - Intronic
992127240 5:73654382-73654404 GGGAGAGGCCTTTCCTCTCTAGG + Intronic
996317928 5:122182283-122182305 GCGAGCAGCCCTTTCTTTTTTGG + Intergenic
999777506 5:154822859-154822881 CAGAGAGGCCTTTTCTCTTTTGG + Intronic
1005599842 6:27415199-27415221 GTAAGAGTCCTTTTCTCTTTGGG - Intergenic
1006215847 6:32442091-32442113 GTGAGAGAACATTTCTCTTTAGG + Intronic
1007810662 6:44483358-44483380 GCGAGGTGCCCTTTCTCTCTGGG + Intergenic
1009810247 6:68653146-68653168 GAGAGGAGCCCCTTCTCTTTAGG - Intronic
1011566943 6:88685373-88685395 CCTAGATACCCTTTCTCTTTCGG - Intronic
1015767864 6:136738060-136738082 GCGATAAGCCATTTCTCATTCGG - Intronic
1022464509 7:30644319-30644341 GAGAGAGCCCTTCTCTCTTTGGG + Intergenic
1026795726 7:73364702-73364724 GCTAGAGGCCCCTTCTTTTATGG + Intergenic
1028069447 7:86433394-86433416 GGCAGAAGCCCTTTCTCTATGGG - Intergenic
1032210556 7:129910359-129910381 TACAGAGTCCCTTTCTCTTTTGG - Intronic
1034876699 7:154730734-154730756 TCTAGGGGCCCTTTCTCTTAGGG - Intronic
1041141026 8:54819819-54819841 GAGAGAGGCTTTTTCTGTTTAGG - Intergenic
1043612211 8:82078693-82078715 GAGAGAGACCCTGTCTCTTAAGG + Intergenic
1048377318 8:133834038-133834060 GGGAGAGGCACTTGCTCTTTAGG + Intergenic
1049252310 8:141595846-141595868 GCGAGAGGCGCTCTCTCCCTCGG + Intergenic
1051782814 9:20708761-20708783 GTGAGAGACCCTGTCTCTTAAGG + Intronic
1060394280 9:123304577-123304599 GAGAGAGGCCCTAACTCTTCTGG - Intergenic
1187966348 X:24616149-24616171 GGTAGAGGCCCTTTCAGTTTGGG + Intronic
1190160248 X:48026999-48027021 AGGAGAGGCCATTTCTCATTTGG + Intronic
1199761905 X:150911379-150911401 GCGGGAATCTCTTTCTCTTTAGG - Intergenic
1200285622 X:154819608-154819630 GCAAAATGCCCTTTCTCTTTGGG + Intronic