ID: 1163710682

View in Genome Browser
Species Human (GRCh38)
Location 19:18845031-18845053
Sequence CCCCATGAGCACCTGTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163710680_1163710682 -5 Left 1163710680 19:18845013-18845035 CCTCTGTGGGGTGCTGCTCCCCA 0: 1
1: 0
2: 2
3: 21
4: 223
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1163710675_1163710682 17 Left 1163710675 19:18844991-18845013 CCAGCCAGGCGGGCTGGAGGGGC No data
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1163710671_1163710682 19 Left 1163710671 19:18844989-18845011 CCCCAGCCAGGCGGGCTGGAGGG 0: 1
1: 0
2: 5
3: 46
4: 384
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1163710676_1163710682 13 Left 1163710676 19:18844995-18845017 CCAGGCGGGCTGGAGGGGCCTCT 0: 1
1: 0
2: 6
3: 31
4: 283
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1163710668_1163710682 26 Left 1163710668 19:18844982-18845004 CCATGCACCCCAGCCAGGCGGGC 0: 1
1: 0
2: 1
3: 41
4: 512
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1163710666_1163710682 27 Left 1163710666 19:18844981-18845003 CCCATGCACCCCAGCCAGGCGGG 0: 1
1: 0
2: 1
3: 56
4: 1322
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207
1163710673_1163710682 18 Left 1163710673 19:18844990-18845012 CCCAGCCAGGCGGGCTGGAGGGG 0: 1
1: 0
2: 3
3: 44
4: 356
Right 1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163710682 Original CRISPR CCCCATGAGCACCTGTCCCT AGG Intronic
900330199 1:2130376-2130398 CGCCAGGAGCCCCTGGCCCTGGG - Intronic
900616272 1:3567047-3567069 CCCCAAGTGCACCTGCCGCTGGG - Intronic
900640527 1:3686086-3686108 CCCTCTGGCCACCTGTCCCTGGG + Intronic
901379370 1:8862788-8862810 CCCCAGGAGCTCCTGGCTCTGGG - Intronic
903238058 1:21963610-21963632 CTCCCTGAGCACCTCTCCGTTGG - Intergenic
904367999 1:30029230-30029252 CCACATCAGGACTTGTCCCTGGG + Intergenic
912963641 1:114217920-114217942 CTCCCTGAGCACCTGTGCATTGG - Intergenic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
918056413 1:181025425-181025447 CCCCATGGGGAACTGTCCATAGG - Intergenic
918580989 1:186128785-186128807 ACCCAGGAGCACCCATCCCTGGG + Intronic
922706507 1:227793414-227793436 CCCCGTGAGCACAGGCCCCTGGG - Intergenic
923143688 1:231183039-231183061 CCCCACGAGCTCCTGCCCCAAGG - Intronic
1064712903 10:18144519-18144541 CTCCATGAGCACCTGGACTTTGG - Intronic
1065278596 10:24112331-24112353 CCTCATGACCATCTGTTCCTGGG - Intronic
1066277837 10:33886502-33886524 TCCCATGAGTATCTGTCCCATGG - Intergenic
1070774633 10:79102501-79102523 CCCCCTCAGCTCCTGGCCCTGGG - Intronic
1071164258 10:82786274-82786296 CCTCATGAAGCCCTGTCCCTAGG - Intronic
1071570570 10:86694499-86694521 CCCCATCAGCACCTCTCTCTGGG + Intronic
1072738985 10:97898300-97898322 CCCCATGACCCACTCTCCCTAGG - Intronic
1075584324 10:123646166-123646188 CCCCATGAGTAATTGTTCCTAGG + Intergenic
1075687972 10:124377216-124377238 CCCCATGCACTCTTGTCCCTTGG - Intergenic
1076766379 10:132636583-132636605 CCCCAGTCGCTCCTGTCCCTTGG + Intronic
1077096515 11:801380-801402 CCCCCTGAGCACCTGCCTGTGGG + Intronic
1077160614 11:1110836-1110858 CCCCAGGGCCACCTGACCCTCGG - Intergenic
1077160628 11:1110906-1110928 CCCCAGTACCACCTGACCCTCGG - Intergenic
1077160637 11:1110960-1110982 CCCCAGGGTCACCTGACCCTCGG - Intergenic
1077160650 11:1111016-1111038 CCCCAGGGCCACCTGACCCTTGG - Intergenic
1077302805 11:1854965-1854987 CCCCAGGATCATCTGTGCCTTGG - Intronic
1077551884 11:3204112-3204134 CCCCATGTTCACCTTTCCCCAGG + Intergenic
1078717924 11:13857530-13857552 CCCCAGCAGCACAGGTCCCTGGG - Intergenic
1079642924 11:22829638-22829660 CGCCTTGAGCACCTGTCCTCGGG - Intronic
1081693845 11:45095669-45095691 CCCCAAGAGGACATGTCCCAGGG - Intergenic
1085175786 11:74487097-74487119 CCCACTGACCACCTGTTCCTGGG + Intergenic
1085351954 11:75803317-75803339 CCCGAAGACCACCTGCCCCTGGG + Intergenic
1090145031 11:124312407-124312429 CCTCATAAGCACATGTCCCTTGG - Intergenic
1090580830 11:128156902-128156924 CTTCATGAGCAACTGGCCCTAGG + Intergenic
1091563330 12:1630368-1630390 CCCCGAGAGCCCCTGTCCCCAGG - Intronic
1093187470 12:16037774-16037796 CCCCATGTCTCCCTGTCCCTCGG + Intergenic
1095306597 12:40645731-40645753 CCCCATGGGCACCTCTCTTTGGG + Intergenic
1096651371 12:53063507-53063529 CCCCTTCAGCAGCTGTCCCCTGG + Intronic
1096673854 12:53215869-53215891 CCCCATGTGCATTTGTTCCTTGG + Intronic
1099682560 12:85846003-85846025 CACCATGTGCACCTCTCCATAGG - Intergenic
1103948597 12:124540285-124540307 CCTCATGGACACCTGTTCCTCGG - Intronic
1104424216 12:128661387-128661409 CCCCATGATTACGTATCCCTTGG - Intronic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1105561198 13:21492545-21492567 TCCCATGAGCCCCTGACCTTGGG + Intergenic
1108514956 13:51192380-51192402 CCCCATGATGACCTGGCCTTGGG - Intergenic
1113151299 13:107267095-107267117 CCCCATAAGCACTTGGCTCTTGG + Intronic
1113766076 13:112881884-112881906 CTACCAGAGCACCTGTCCCTCGG + Exonic
1115004648 14:28467830-28467852 CACAAAGAACACCTGTCCCTTGG + Intergenic
1120980385 14:90284073-90284095 GCCCATGAGCAGCTGTCCTGAGG + Intronic
1122648052 14:103207833-103207855 CGCCATCAGCACCTGGCGCTCGG - Intergenic
1202897157 14_GL000194v1_random:16824-16846 CCCCATGAACACCAGTCCTCAGG + Intergenic
1125681001 15:41530124-41530146 CCCCAGGAGTTCCAGTCCCTGGG - Intronic
1127787998 15:62373072-62373094 TCCCATGAGGGCCTGTCCCTAGG - Intergenic
1128123767 15:65174658-65174680 CCACATGTACAGCTGTCCCTTGG + Intronic
1128515327 15:68338491-68338513 TCCCAACAGCACCTGGCCCTAGG - Intronic
1129599203 15:76988421-76988443 CCCCATGCCCACCAGTTCCTGGG + Intergenic
1131520439 15:93110101-93110123 CCCCCAGACCCCCTGTCCCTGGG + Intergenic
1131559388 15:93426205-93426227 CACCATGAGCACGTGTCTCCAGG - Intergenic
1132149285 15:99447963-99447985 CTGCCTGAGCACCTGTCCTTTGG + Intergenic
1132376754 15:101333254-101333276 CAGCATGAGCAGCTGTCCTTGGG - Intronic
1132891518 16:2207107-2207129 CCCCATGAGCACCCCTCACCTGG - Exonic
1134102082 16:11459723-11459745 CCCCATGACCCCATGTCCCCAGG - Intronic
1134691556 16:16193910-16193932 CCCCATGAGCACAGATCCCTGGG - Intronic
1135700113 16:24624955-24624977 TCACATGAGCACCTTCCCCTGGG - Intergenic
1137727993 16:50669972-50669994 CCTCATGAGACCCTGTCCCCTGG - Intronic
1138418805 16:56886366-56886388 CCCCGTGAGCACCAGGCACTGGG - Exonic
1140699273 16:77566447-77566469 CCCTAGGGGCACCTTTCCCTTGG - Intergenic
1141711490 16:85701910-85701932 CTCCACGAGAACCTCTCCCTGGG - Intronic
1142808829 17:2385921-2385943 CGCCAGGCCCACCTGTCCCTTGG + Exonic
1149521830 17:57323540-57323562 ACGCAGGAGCACCTGTCCCAGGG - Intronic
1151758314 17:76087218-76087240 CCCCCTGAGCTCCAGTCCCAGGG + Intronic
1152495871 17:80671010-80671032 CCCCTAAAGCACCTGGCCCTGGG + Intronic
1153811959 18:8759911-8759933 CCCCATGAGCATGAGCCCCTGGG - Intronic
1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG + Intergenic
1157108169 18:44794147-44794169 CACCAGCAGCACCTTTCCCTTGG + Intronic
1157301463 18:46482801-46482823 CCACATCTGCACCTCTCCCTGGG - Intronic
1157525111 18:48374720-48374742 CCCCATTAGCACCCATCCGTTGG - Intronic
1157693744 18:49704161-49704183 CACCCTGAGGACCTGTCCCCTGG + Intergenic
1159038226 18:63297909-63297931 ACAGATGAGCACGTGTCCCTGGG + Intronic
1160007272 18:75076642-75076664 TCCCATGAACACCTGCCCCATGG + Intergenic
1160174281 18:76580056-76580078 CCCCGTGAAGACCTGTCCTTAGG - Intergenic
1160497202 18:79382693-79382715 CCACACGAGCATCTGTGCCTGGG - Intergenic
1160523988 18:79524788-79524810 GCCCACGAGCACCTGAGCCTCGG - Intronic
1161295811 19:3519737-3519759 CCCCAGGAGCCCCTGCCCCCAGG + Intronic
1161607295 19:5222263-5222285 CCCCATGAGTGCCTGGCACTGGG + Intronic
1161647847 19:5465364-5465386 CAACATGAGCACATGTCCCATGG + Intergenic
1162750561 19:12826763-12826785 CCCCACGCTCACCTGTCCATAGG + Exonic
1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG + Intronic
1163845850 19:19637743-19637765 CCCCATGAGGTCCTGTCCCCTGG - Intronic
1164708674 19:30339250-30339272 CCCAAAGAGCACCTGGCCCATGG - Intronic
1165824281 19:38696842-38696864 CTCCCTGAGCACCTGTGCTTGGG + Intronic
1166505077 19:43365880-43365902 CCCCATGCTCAGCTGTCCCGTGG + Intergenic
1166558251 19:43715930-43715952 CCCCATGAGCAGCTGGGGCTTGG + Intergenic
1167266336 19:48484764-48484786 CCCCACTAGCCCCTGGCCCTGGG + Intergenic
925943629 2:8841279-8841301 CCCCCTGGGCACATGTCCTTAGG - Intergenic
929870429 2:45754634-45754656 CCCCTTGAGGGCCTGCCCCTGGG + Intronic
934588354 2:95525799-95525821 CCCCATGGGCACCGTTGCCTTGG + Intergenic
935304503 2:101723899-101723921 GGCCAGGAGCCCCTGTCCCTAGG - Intronic
937141480 2:119605617-119605639 CACCAGGAGCCCCTGTGCCTTGG + Intronic
937358090 2:121211071-121211093 TCCCATGGGCTCCTGTGCCTAGG - Intergenic
937441557 2:121919967-121919989 GCCCCTGACCACCTGTCCCAAGG - Intergenic
937784017 2:125873964-125873986 CTCCATTAGTACCTTTCCCTAGG - Intergenic
937993902 2:127679209-127679231 CCCCAGGAGCACCCCTCCCTGGG + Intronic
938491154 2:131761974-131761996 CCCCATGAACACCAGTCCTCAGG - Intronic
938496410 2:131800363-131800385 CCCCATGAACACCAGTCCTCAGG + Intronic
938692326 2:133803045-133803067 CCCCATGATCACCTGTTTTTGGG + Intergenic
941413440 2:165188670-165188692 CCTCCTGAGTACCTGTACCTGGG - Intronic
943119378 2:183715450-183715472 CCCCATGATCCCCTTTCCCTAGG + Intergenic
944303769 2:198156302-198156324 CACCTTGAGCACATGTCCTTAGG + Intronic
944882705 2:204029707-204029729 CACCATGAGGAGCTGTTCCTTGG - Intergenic
945276414 2:207991828-207991850 CCCCAAGACCACCTACCCCTGGG + Intronic
948147178 2:235716536-235716558 CTTAATGAGCACCTGTGCCTGGG + Intronic
948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG + Intronic
1169511973 20:6274468-6274490 CCACATGAACAGCTGTCCCTTGG + Intergenic
1171413778 20:24963862-24963884 CACGATGGGCACCTGTACCTGGG - Exonic
1175381204 20:58565727-58565749 CCCCTTGAGCACTTCTCACTGGG - Intergenic
1175898504 20:62350804-62350826 CCTCAGGAGCACCTGTTCCGGGG - Intronic
1176170511 20:63694431-63694453 CCCCAAGAGCACCTGAACCAGGG + Exonic
1176616842 21:9032813-9032835 CCCCATGAACACCAGTCCTCAGG + Intergenic
1176708290 21:10130834-10130856 CCCCATGAACACCAGTCCTCAGG - Intergenic
1180057712 21:45367450-45367472 CCCCAGGAGTACCTTTCCCAGGG - Intergenic
1181429701 22:22871631-22871653 TCCCATGAGCACCAGTCCTCAGG + Intronic
1182365439 22:29775779-29775801 GCCAATGAGGACTTGTCCCTCGG + Intergenic
1182872201 22:33657834-33657856 CCCCCTGAGTACATGTCCTTGGG + Intronic
1183122694 22:35742538-35742560 TCCCTTTAGCAGCTGTCCCTTGG + Intronic
1183520815 22:38295176-38295198 CCCCTTGAGCTTCTGTCCCAAGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184697319 22:46147319-46147341 GTCCATCAGCACCTGGCCCTGGG - Intergenic
1185331159 22:50252602-50252624 CCCCATCAGGCCCTGCCCCTGGG + Intronic
950263587 3:11559425-11559447 CTCCGTGATCACCTGTGCCTCGG - Exonic
951701787 3:25504367-25504389 GCCAATGAGAATCTGTCCCTAGG - Intronic
952792536 3:37211684-37211706 CCCCATGAGGACCTCTCCATAGG + Intergenic
952873105 3:37919746-37919768 CTCCATCAGCATCTGTTCCTGGG + Intronic
953238578 3:41127543-41127565 CCCTATGCCCACCTGTCCATTGG - Intergenic
954223371 3:49167742-49167764 CCCCATGAGATCCTGGCCCCTGG - Intergenic
955404261 3:58615969-58615991 CCACCTGTGCACCTTTCCCTAGG - Intronic
956290933 3:67658868-67658890 CCCCTTGAACACCTGTGACTAGG + Intergenic
962197419 3:133376320-133376342 CCACCTGAGGGCCTGTCCCTGGG + Intronic
962960885 3:140310014-140310036 CCCCATGACCAGATCTCCCTTGG - Intronic
963080746 3:141391499-141391521 CCCCATGAGTACCAGACTCTGGG - Intronic
964074490 3:152676731-152676753 TCCAATGACCACCTGTCTCTGGG - Intergenic
965722420 3:171676476-171676498 ACACAGCAGCACCTGTCCCTAGG + Intronic
967234478 3:187370871-187370893 CCTCATACGCACCTGACCCTGGG - Exonic
968235042 3:197026480-197026502 TCCCTGGAGCTCCTGTCCCTGGG + Intronic
968503218 4:960710-960732 CAGCATGTGCACCTGTCCCAGGG + Exonic
968506920 4:974953-974975 CCCCAAGACCCCCTGTGCCTGGG + Intronic
969015087 4:4098714-4098736 TCCCCTGAGCAGCTTTCCCTGGG + Intergenic
969578509 4:8050405-8050427 ACCCCTGAGCACCTGGCCCCAGG - Intronic
969798045 4:9541183-9541205 TCCCCTGAGCAGCTTTCCCTGGG - Intergenic
972258746 4:37386748-37386770 CCCCATGAACACCTCCCACTAGG - Intronic
975321153 4:73011455-73011477 ACCCCTGAGCACCTGGCCATGGG + Intergenic
976202307 4:82591443-82591465 GCCCATGAGCCCCTGTCTCAGGG + Intergenic
976937667 4:90658422-90658444 CCCCAGGAACTCCTCTCCCTGGG + Intronic
977324052 4:95552639-95552661 TCCCATTAGCACCTGTCACTGGG - Intergenic
979555862 4:122046679-122046701 CCCCATGATCTCCTCTCTCTTGG - Intergenic
982082889 4:151807564-151807586 CGCCAAGAACTCCTGTCCCTAGG - Intergenic
985720132 5:1484630-1484652 TGCCAGGAGCATCTGTCCCTAGG + Intronic
987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG + Exonic
991449523 5:66737292-66737314 CACCATGTGGACCTGTCCATTGG + Intronic
991655587 5:68901092-68901114 TGCCTTGATCACCTGTCCCTGGG + Intergenic
994043194 5:95281510-95281532 CCCCATGAGCAGCAGACGCTAGG + Intronic
995218326 5:109620278-109620300 GCTAATGAGCACTTGTCCCTAGG - Intergenic
997667615 5:135644443-135644465 CCCCAGGTGCACATGTCTCTAGG + Intergenic
998096049 5:139395968-139395990 CCCCACCAGCGCCTGTCCCCAGG - Intergenic
998232153 5:140367609-140367631 CCCCTGGAGCTTCTGTCCCTTGG - Intronic
998914649 5:147000788-147000810 CACCATCAGCAAATGTCCCTTGG + Intronic
999463055 5:151772817-151772839 CCCCCAGAGCACTTGTCCCTCGG + Intronic
1002099538 5:176850577-176850599 CCCCATCAGCTCCTGCCCCGGGG - Intronic
1002189948 5:177473081-177473103 CCCCGTGCACACCTGTCCCCCGG + Exonic
1003073626 6:2963976-2963998 CACCAGGAACACCTGTCCCGAGG + Intronic
1007428729 6:41764079-41764101 CCCAGTGAGCTCCTGTCCCTGGG - Intergenic
1007430837 6:41775927-41775949 CCCCATTAACATCTGGCCCTTGG - Intronic
1007792474 6:44319192-44319214 CCCCATAATCAACTGTCCCTTGG - Intronic
1008160417 6:48068952-48068974 CCGCATGAGCAGCGTTCCCTCGG + Intergenic
1009485590 6:64218127-64218149 CAGCATGAGGCCCTGTCCCTAGG + Intronic
1021500957 7:21330765-21330787 TCCCATGAGCACCTGGCCAAAGG - Intergenic
1023606157 7:41933082-41933104 CCCCTTGTGTTCCTGTCCCTGGG + Intergenic
1024729035 7:52234335-52234357 CCCCATAAGCACCTGCTCATAGG - Intergenic
1026310308 7:69177869-69177891 CCCCCTGAGCACTGGTGCCTAGG - Intergenic
1026899550 7:74029351-74029373 CCCCATAACCAACTGTGCCTGGG - Intronic
1034339475 7:150342266-150342288 CCCCATGAGAATCTATCCCACGG - Intergenic
1037580981 8:20245918-20245940 CTACATGGACACCTGTCCCTGGG + Intergenic
1038534870 8:28346768-28346790 CCCCATGAGGACCTGAAGCTGGG + Exonic
1041254034 8:55963558-55963580 GCTGATGAGCACCTGCCCCTTGG - Intronic
1041376809 8:57214443-57214465 CCCCCTGAGCAGTTGGCCCTAGG + Intergenic
1043023880 8:75042440-75042462 CCCCATGATTACCTGTCTGTGGG - Intergenic
1045506978 8:102785681-102785703 CCTCATGTGCAGCTGTACCTGGG + Intergenic
1045555220 8:103208885-103208907 CCCCAGGAGGACCTGGCCATAGG + Intronic
1049398759 8:142415401-142415423 CCCCATTAGCCCCTGTCCACCGG - Intergenic
1049465512 8:142749618-142749640 CCCCCTGGGCACCTGACCCCTGG + Intergenic
1049571304 8:143371462-143371484 CCCCAGGATCCCCTGGCCCTGGG - Intronic
1049767756 8:144362828-144362850 CCCCATCAGCACCGGTGCTTGGG + Intergenic
1049998631 9:1053011-1053033 CGCCATGGGCACCTGGTCCTGGG + Intronic
1052336345 9:27324223-27324245 CCCCAAGTGCTCCTGTCCCAAGG + Intergenic
1053129990 9:35609343-35609365 CTTCATCAGCACCTGTTCCTCGG + Exonic
1053135149 9:35646303-35646325 CCCCCTGAGGGTCTGTCCCTGGG + Intronic
1053645253 9:40116348-40116370 CCCCATGAACACCAGTCCTCAGG - Intergenic
1053760462 9:41347180-41347202 CCCCATGAACACCAGTCCTCAGG + Intergenic
1054326275 9:63714248-63714270 CCCCATGAACACCAGTCCTCAGG - Intergenic
1054539319 9:66259623-66259645 CCCCATGAACACCAGTCCTCAGG + Intergenic
1055318061 9:75053951-75053973 CCCCATGAGCAGCTTTTCCATGG - Intergenic
1057305815 9:93911366-93911388 CGCCAGCAGCACCTGGCCCTGGG + Intergenic
1057793594 9:98140257-98140279 CTCCAACAGCACCTGTCCCCTGG - Intronic
1058167417 9:101635804-101635826 CTCCAAAAGCATCTGTCCCTGGG - Intronic
1059717497 9:116927225-116927247 CCTCATCAGAACCTCTCCCTAGG + Intronic
1060322124 9:122572188-122572210 CCCCATGATCACCTCCCACTAGG + Intergenic
1060589500 9:124808010-124808032 CCCCATGAGGACCCCTCCCCAGG - Intronic
1061500096 9:130997168-130997190 CCCCAGGATCACCTGTGTCTGGG - Intergenic
1061799321 9:133105473-133105495 CCCCTGCAGCTCCTGTCCCTGGG + Intronic
1061895441 9:133644497-133644519 CCCCTCGAGGTCCTGTCCCTGGG - Intronic
1062198405 9:135287259-135287281 CCCCTTGTCCACCTGACCCTTGG - Intergenic
1062252765 9:135606545-135606567 CCCCGTGAGCTCCTGGCCCATGG - Intergenic
1062445678 9:136593178-136593200 CCCCATGAGCTGCGGTCCCAGGG + Intergenic
1202793051 9_KI270719v1_random:99803-99825 CCCCATGAACACCAGTCCTCAGG - Intergenic
1186465731 X:9783246-9783268 CCCTATGAGCGCCTGCCCCGGGG - Intronic
1187440864 X:19318582-19318604 CTTGCTGAGCACCTGTCCCTGGG - Intergenic
1190497705 X:51042343-51042365 CCCCATGAGGCCCTTTCTCTTGG + Intergenic
1192328999 X:70159475-70159497 CACCCTGAGCACCCGTGCCTTGG - Intronic
1193596495 X:83451975-83451997 CCCCATGATCCACTGTCTCTGGG + Intergenic
1201144452 Y:11056065-11056087 CACCATGAGCACCAGTCCAATGG - Intergenic
1201150242 Y:11091664-11091686 CCCCATGAACACCAGTCCTCAGG + Intergenic