ID: 1163711649

View in Genome Browser
Species Human (GRCh38)
Location 19:18850712-18850734
Sequence TGTCCCAGTTGATGTCCTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163711649_1163711651 4 Left 1163711649 19:18850712-18850734 CCTCAAGGACATCAACTGGGACA 0: 1
1: 0
2: 2
3: 29
4: 238
Right 1163711651 19:18850739-18850761 GCAGTGGCAGCCGCTGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 202
1163711649_1163711656 28 Left 1163711649 19:18850712-18850734 CCTCAAGGACATCAACTGGGACA 0: 1
1: 0
2: 2
3: 29
4: 238
Right 1163711656 19:18850763-18850785 CCGCTGCTTCCTGTCCTGGCTGG 0: 1
1: 0
2: 2
3: 27
4: 234
1163711649_1163711654 24 Left 1163711649 19:18850712-18850734 CCTCAAGGACATCAACTGGGACA 0: 1
1: 0
2: 2
3: 29
4: 238
Right 1163711654 19:18850759-18850781 AGGACCGCTGCTTCCTGTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163711649 Original CRISPR TGTCCCAGTTGATGTCCTTG AGG (reversed) Exonic