ID: 1163711651

View in Genome Browser
Species Human (GRCh38)
Location 19:18850739-18850761
Sequence GCAGTGGCAGCCGCTGATCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163711646_1163711651 13 Left 1163711646 19:18850703-18850725 CCAGAGCAGCCTCAAGGACATCA 0: 1
1: 0
2: 2
3: 16
4: 163
Right 1163711651 19:18850739-18850761 GCAGTGGCAGCCGCTGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 202
1163711645_1163711651 17 Left 1163711645 19:18850699-18850721 CCAGCCAGAGCAGCCTCAAGGAC 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1163711651 19:18850739-18850761 GCAGTGGCAGCCGCTGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 202
1163711649_1163711651 4 Left 1163711649 19:18850712-18850734 CCTCAAGGACATCAACTGGGACA 0: 1
1: 0
2: 2
3: 29
4: 238
Right 1163711651 19:18850739-18850761 GCAGTGGCAGCCGCTGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 202
1163711643_1163711651 23 Left 1163711643 19:18850693-18850715 CCTGTGCCAGCCAGAGCAGCCTC 0: 1
1: 0
2: 4
3: 48
4: 380
Right 1163711651 19:18850739-18850761 GCAGTGGCAGCCGCTGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 202
1163711642_1163711651 24 Left 1163711642 19:18850692-18850714 CCCTGTGCCAGCCAGAGCAGCCT 0: 1
1: 0
2: 3
3: 35
4: 327
Right 1163711651 19:18850739-18850761 GCAGTGGCAGCCGCTGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163711651 Original CRISPR GCAGTGGCAGCCGCTGATCC AGG Exonic