ID: 1163711656

View in Genome Browser
Species Human (GRCh38)
Location 19:18850763-18850785
Sequence CCGCTGCTTCCTGTCCTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163711649_1163711656 28 Left 1163711649 19:18850712-18850734 CCTCAAGGACATCAACTGGGACA 0: 1
1: 0
2: 2
3: 29
4: 238
Right 1163711656 19:18850763-18850785 CCGCTGCTTCCTGTCCTGGCTGG 0: 1
1: 0
2: 2
3: 27
4: 234
1163711652_1163711656 -9 Left 1163711652 19:18850749-18850771 CCGCTGATCCAGGACCGCTGCTT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1163711656 19:18850763-18850785 CCGCTGCTTCCTGTCCTGGCTGG 0: 1
1: 0
2: 2
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163711656 Original CRISPR CCGCTGCTTCCTGTCCTGGC TGG Exonic