ID: 1163715609

View in Genome Browser
Species Human (GRCh38)
Location 19:18870509-18870531
Sequence CCAAGGACGGGGAGCGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163715592_1163715609 14 Left 1163715592 19:18870472-18870494 CCCTAGAGGAGCAGAGTTGGAGG 0: 1
1: 0
2: 2
3: 28
4: 237
Right 1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 204
1163715594_1163715609 13 Left 1163715594 19:18870473-18870495 CCTAGAGGAGCAGAGTTGGAGGG 0: 1
1: 3
2: 7
3: 58
4: 354
Right 1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163715609 Original CRISPR CCAAGGACGGGGAGCGTGGC CGG Exonic
900537116 1:3184378-3184400 CCAACGACAGGGTGCGGGGCGGG + Intronic
900614012 1:3556218-3556240 CCCAGGATGGGGAGTGGGGCAGG + Intronic
900751538 1:4400953-4400975 GGAAGGATGGGGAGTGTGGCAGG + Intergenic
900997373 1:6129877-6129899 CCAAGGCCGTGGAGGGAGGCAGG - Intronic
901026693 1:6282163-6282185 CCCAGGCCGGGGAGGGTGGTGGG - Intronic
901167497 1:7230627-7230649 CCAAGGAGGTGGAGGGTGGAGGG + Intronic
901630341 1:10644921-10644943 CCAAGCGCGAGGAGTGTGGCAGG - Exonic
903644498 1:24886405-24886427 CAGAGGAGGGGGAGCCTGGCTGG - Intergenic
904784650 1:32974764-32974786 TCCCGGACGGGGAGCCTGGCCGG + Intergenic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
907873815 1:58466510-58466532 CCAAGGACTTGGAGCCTGGAAGG + Intronic
916185550 1:162129115-162129137 CCAAGGAGGCGGAGCTTAGCTGG - Intronic
917807474 1:178626614-178626636 CCAGGGGCGGGGAGTGTGGGAGG + Intergenic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
919127507 1:193413571-193413593 CAAAGAACAGGGAGTGTGGCTGG + Intergenic
923281206 1:232444797-232444819 CCACGGACTGGGAGCCAGGCTGG - Intronic
1064384489 10:14878666-14878688 CCAAGCGCGAGGAGCGGGGCGGG - Intergenic
1065077682 10:22097692-22097714 CCAAGGATGGGGAGGGAGGGAGG - Intergenic
1071875285 10:89837547-89837569 TCAAGGGCAGGGAGCGCGGCTGG + Intergenic
1072151707 10:92689762-92689784 CCGGGGGCGGGGAGCTTGGCCGG + Intergenic
1074535954 10:114328830-114328852 GCAAGGACAGGGAGAGTGCCCGG + Intronic
1075451872 10:122557353-122557375 AGAAGGACGGGGAGCCTGGTGGG - Intergenic
1075495261 10:122914337-122914359 CCAAGGTTGAGGACCGTGGCCGG - Intergenic
1076016917 10:127035088-127035110 CCAAGAAGGGGAACCGTGGCTGG - Intronic
1076999753 11:316584-316606 CACAGGACAGGGCGCGTGGCGGG - Intergenic
1077321927 11:1946640-1946662 CCGAGGATGGACAGCGTGGCTGG + Intergenic
1077797503 11:5507889-5507911 GCAGGGACGGGTAGTGTGGCAGG - Exonic
1078023453 11:7673523-7673545 CGAAGGGCGGGGAGTGGGGCGGG - Intronic
1078181485 11:9015315-9015337 CCAAGGCAGGGGAGTGTGGTAGG + Intergenic
1078535587 11:12170847-12170869 CTAAGGACAGGGAGCATGCCTGG + Intronic
1079380585 11:19933992-19934014 CCAAGGAAGGGGAGCGGAGCCGG + Exonic
1079983589 11:27177507-27177529 CAAAGGACGGGGAGATTGACAGG - Intergenic
1083384913 11:62300465-62300487 CCAAGGAGGGGGAGGGTTGGTGG + Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG + Intergenic
1083799975 11:65041139-65041161 CGAAGGCCGGGGATCATGGCGGG + Exonic
1087140054 11:94756222-94756244 CACAGGATGGGGGGCGTGGCAGG + Intronic
1087553253 11:99679610-99679632 CCAAGGACAGGGAGAGGGACAGG - Intronic
1090788261 11:130069238-130069260 CCAAGGGTGCGGAGCGCGGCCGG + Intergenic
1202804943 11_KI270721v1_random:1953-1975 CCGAGGATGGACAGCGTGGCTGG + Intergenic
1091435095 12:465936-465958 CCCAGAACAGGGAGTGTGGCAGG - Intronic
1092349667 12:7745917-7745939 TCAAGAAAGGGGAACGTGGCCGG + Intronic
1094222515 12:28009487-28009509 CCAGGGAGAGGGAGGGTGGCAGG + Intergenic
1096239011 12:49949524-49949546 CCCAGGAGAGGGAGCGAGGCTGG + Intergenic
1096786225 12:54018640-54018662 CCCAGGCCGGGGAGCAGGGCGGG - Intronic
1097399719 12:59114212-59114234 TCAAGCAGGGGGAGCTTGGCGGG - Intergenic
1100206326 12:92354190-92354212 CACAGGATGGGGAACGTGGCTGG - Intergenic
1100522307 12:95387017-95387039 CCAAGGAGAGGGAGCGATGCGGG - Intergenic
1104861989 12:131928868-131928890 ACGGGGACGGGGAGCGGGGCTGG + Intergenic
1105070176 12:133229607-133229629 CCCAGGGCTGGGATCGTGGCTGG - Intronic
1106558556 13:30830244-30830266 CCCAGGACTGGGACAGTGGCTGG - Intergenic
1108868909 13:54958478-54958500 CACAGGATGGGGGGCGTGGCGGG - Intergenic
1112101291 13:96192440-96192462 CCAAAAGCGGGGAGGGTGGCAGG - Intronic
1112187203 13:97138687-97138709 CCAAGAAAGGGGAGAGTGGTGGG + Intergenic
1112406220 13:99123111-99123133 GCAGGGATGAGGAGCGTGGCAGG + Intergenic
1113254919 13:108495956-108495978 CCAAGCGCGGGGAACGCGGCGGG + Intergenic
1113662889 13:112118911-112118933 CCAGGCACGGGGAGCATGGCAGG + Intergenic
1113811281 13:113144070-113144092 GCAAGGACGGGGAGTGTCCCTGG + Exonic
1116972572 14:51081955-51081977 CCCAGGGCAGGGAGGGTGGCTGG - Intronic
1118867439 14:69714497-69714519 CCAAGGACAGCGAGTGAGGCTGG + Exonic
1121252004 14:92506290-92506312 CCAAGGGAGGGCAGCATGGCCGG + Intergenic
1122364819 14:101188356-101188378 CCAAGGTAGTGGGGCGTGGCGGG - Intergenic
1122819541 14:104334587-104334609 CCATGGGCGGCGAGCGTGGCGGG + Intergenic
1123021049 14:105398217-105398239 CCCAGGACGGGGCGCGCGGGCGG - Intergenic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124819787 15:33033402-33033424 CCAAGGACAGGGACTGTGGTAGG - Intronic
1126065632 15:44824407-44824429 CCAAGGTCGGGGAGCTTGTGGGG - Intergenic
1126094203 15:45076160-45076182 CCAAGGTCGGGGAGCTTGTGGGG + Exonic
1126582225 15:50252399-50252421 CCAGGGACGGGCAGCCTGGTGGG - Intronic
1128508929 15:68301848-68301870 CCAAGGACAAGGGGCGTGCCTGG - Exonic
1128780539 15:70356123-70356145 CCAAGGAGCTGGAGTGTGGCTGG + Intergenic
1129710744 15:77819257-77819279 CCCGGGACGGTGAGTGTGGCCGG - Intronic
1130257009 15:82330434-82330456 CCAAGGACAGGGATCGAGGGGGG + Intergenic
1134132854 16:11661377-11661399 CCAAGCACCGGAAACGTGGCTGG + Intergenic
1134863220 16:17579514-17579536 CCATGGAGGGGGAGCCAGGCTGG + Intergenic
1136372533 16:29845323-29845345 CCAGGGACGAGGAGCATGGAAGG - Intronic
1137402607 16:48165503-48165525 CCAAGGAAGGGGACTGGGGCAGG - Intergenic
1139637053 16:68264280-68264302 TCCAGGGCGGCGAGCGTGGCCGG + Intergenic
1141680646 16:85541805-85541827 CCAAGGACAAGCAGCGAGGCAGG - Intergenic
1141702088 16:85647174-85647196 CCAAGGACAGGGGGCATGGACGG - Intronic
1141763484 16:86044157-86044179 CCCACCACGGGGTGCGTGGCTGG - Intergenic
1142407450 16:89898674-89898696 GCCAGGACAGGGAGCGTGGACGG - Intronic
1142514424 17:417840-417862 CCTAGAACGTGGAGCGGGGCAGG + Intronic
1142514435 17:417908-417930 CCTAGAACGTGGAGCGGGGCAGG + Intronic
1144120090 17:12144098-12144120 CCAAGAGCGGAGAGCATGGCTGG - Intergenic
1144695820 17:17303412-17303434 CGCGGGACGGGGAGCGGGGCGGG - Exonic
1144739664 17:17574781-17574803 CCCAGCACTGGGAGCTTGGCTGG - Intronic
1145780543 17:27560127-27560149 CAAATGACTGGGAGCGGGGCAGG - Intronic
1146201322 17:30861195-30861217 CCAAGGGCGGGGAGGGGGGTGGG - Intronic
1146400020 17:32494710-32494732 CCCAGGACTCGGAGTGTGGCCGG + Exonic
1148079623 17:44960492-44960514 CGGGGGAGGGGGAGCGTGGCAGG - Intronic
1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG + Intronic
1149467511 17:56891578-56891600 CCAAGGATTGGGAGCATGGGAGG - Exonic
1149931056 17:60756103-60756125 CCATGGATGGGGGGCGTGGTGGG + Intronic
1151352879 17:73542196-73542218 CCAGGGATGGGAAGCGTGGAGGG - Intronic
1153220014 18:2853300-2853322 CCAAGGGCTGGGGGGGTGGCAGG - Intronic
1156228083 18:35128888-35128910 CCAAGGAGGGGAAGTGGGGCTGG - Intronic
1156369326 18:36458500-36458522 CCAAGGATGGGGAGTGTCTCTGG + Intronic
1160429767 18:78803430-78803452 CCCAGGGCGGGGTGCATGGCGGG + Intergenic
1161262612 19:3346139-3346161 CCAGGGCTGGGGAGGGTGGCTGG - Intergenic
1163035100 19:14565353-14565375 CCTAGGATGGGGCGCCTGGCTGG + Intronic
1163263320 19:16204255-16204277 CCAAGGACAGGAAGGGTGGGGGG - Intronic
1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG + Exonic
1165258141 19:34592375-34592397 CCATGGAAGGGGAGTGAGGCTGG + Intergenic
1165843157 19:38801627-38801649 CCAAGGAAGGGAAGAGTAGCCGG + Intergenic
1166094583 19:40530810-40530832 CCAAGGGAGGGGAGCGAAGCGGG + Intronic
1166780581 19:45340666-45340688 CCACGGGCGGTGGGCGTGGCCGG + Intronic
1167144344 19:47672947-47672969 CCAAGGAAGGGGAGGGTGGTGGG - Intronic
1167220239 19:48194577-48194599 CCGAGGTCGGGGAGCTGGGCGGG + Intronic
1167638894 19:50669304-50669326 TCAAGGAGGGGGACCCTGGCGGG + Intronic
1168240987 19:55088816-55088838 CCAAGGGCGGGGGGCGGGGTGGG - Intergenic
926197265 2:10771596-10771618 CCAGGGACAGGGAGGCTGGCAGG - Intronic
927835311 2:26392633-26392655 TCAAGGACTGGGAACGTGCCAGG + Exonic
928123599 2:28601508-28601530 CCAAGGACCTGGAGGGTGGTGGG - Intronic
928371173 2:30741276-30741298 CCAAGGACAGGAAGGATGGCAGG - Intronic
932556518 2:72829634-72829656 CACAGGATGGGGAGCGGGGCAGG - Intergenic
932575600 2:72960819-72960841 ACTGGGACTGGGAGCGTGGCTGG - Intronic
934954051 2:98601909-98601931 CCACGGACGGGGAAGGGGGCAGG - Intronic
935192584 2:100790889-100790911 CCAGGGACTGGGAGGGAGGCGGG - Intergenic
936513542 2:113167608-113167630 CCAATGACTGGGCACGTGGCAGG - Intronic
937991384 2:127664275-127664297 CCAGGGGCGGGGCGGGTGGCGGG - Intronic
938114902 2:128596309-128596331 CCAAGGAGGTGGAGCCTGCCGGG - Intergenic
946406179 2:219493141-219493163 CCAAGGAAGGTGGGCATGGCTGG + Exonic
1168997781 20:2145762-2145784 CCAAGGAAAGGCAGGGTGGCGGG - Exonic
1169405913 20:5321131-5321153 CCATAGACAGGGAGCATGGCTGG - Intergenic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1171382060 20:24741792-24741814 CCAGGGAGGGGCAGAGTGGCCGG - Intergenic
1173362249 20:42355197-42355219 CCAAGGAGGGGGAGCTTGCAGGG - Intronic
1173873749 20:46357219-46357241 CCAAGGCCGGGGCCCATGGCTGG - Intronic
1173911421 20:46673760-46673782 CCAGGCACTGGGAGTGTGGCAGG - Intronic
1174181810 20:48679805-48679827 CCAATGCTGGGGGGCGTGGCTGG - Intronic
1175813102 20:61869512-61869534 CCACAGACGAGGAACGTGGCTGG - Intronic
1176550793 21:8220222-8220244 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176550908 21:8220954-8220976 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176569591 21:8402489-8402511 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176569707 21:8403221-8403243 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176569817 21:8403953-8403975 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176577618 21:8447428-8447450 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176577728 21:8448160-8448182 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1177338128 21:19760068-19760090 CCAAGGACGGGGCGCACGGCCGG + Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1179011941 21:37563199-37563221 CCAAGGCCGGGGACTCTGGCTGG + Intergenic
1179785447 21:43727464-43727486 CCAAGGACAGGGACAGGGGCTGG - Intronic
1183107140 22:35622721-35622743 CCAAGGCTGGGGAGGGTGGAGGG - Intronic
1183134416 22:35872811-35872833 CCCAGGATGGGGGGCATGGCAGG + Intronic
1183695899 22:39421993-39422015 CCATGGCCGGAGAGCGTGGCTGG + Intronic
1203255808 22_KI270733v1_random:137231-137253 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1203255917 22_KI270733v1_random:137921-137943 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
949883529 3:8678684-8678706 CCCAGGAGGGGAAGAGTGGCTGG - Intronic
949970038 3:9396886-9396908 CGAAGGAAGGGGAGGGTGGGAGG + Intergenic
954265901 3:49470229-49470251 GCAAGGGCGGGGCGCGCGGCCGG - Exonic
955408947 3:58643517-58643539 CTCAGGAGGGGAAGCGTGGCTGG - Intronic
956735321 3:72233485-72233507 CACAGGATGGGGGGCGTGGCAGG + Intergenic
960994547 3:123332287-123332309 CCAAGGATGGGGGGCATGGAGGG + Intronic
966108455 3:176365098-176365120 CCAAGGACAGGAAGTGAGGCTGG - Intergenic
966285791 3:178293840-178293862 AGAAGGACGTGGAGTGTGGCTGG - Intergenic
969467434 4:7366136-7366158 CCAAGGAGGAGGAGGGTGGCAGG - Intronic
970579247 4:17458956-17458978 CACAGGATGGGGAGTGTGGCAGG + Intergenic
975622172 4:76306584-76306606 CCAGGGGCGGGGAGCGGGGCGGG + Intronic
977810362 4:101348811-101348833 CCAAGGACTGGCAACGTGGTTGG + Exonic
980734450 4:136867189-136867211 CAAAGGATGGGGAGTATGGCAGG - Intergenic
982241755 4:153306833-153306855 GCAAGGACTGGGAGCCTGGGAGG - Intronic
984755184 4:183319631-183319653 CGAAGCTAGGGGAGCGTGGCTGG + Exonic
984755396 4:183321839-183321861 CAAAGCTAGGGGAGCGTGGCTGG + Exonic
990468864 5:56094877-56094899 CCACGGACGGGGTGCGGGGTGGG + Intergenic
990674288 5:58166133-58166155 CCCAGAACAGGAAGCGTGGCTGG + Intergenic
991310036 5:65228698-65228720 CAAAGGCTGGGGAGGGTGGCAGG - Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
995831719 5:116361694-116361716 CCAAGTCCCGGGAGCGTGTCGGG - Intronic
997530765 5:134579941-134579963 GCAAGGGAGGGGAGGGTGGCAGG - Exonic
998978000 5:147669300-147669322 CCAAGGAGAGGGAGCCAGGCAGG + Intronic
999856909 5:155605008-155605030 CCAAGGAGGGGGAGAGAGGTGGG + Intergenic
1007388199 6:41533695-41533717 CCAAGGTCAGGGAGGGTGGGTGG - Intergenic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1011388634 6:86825544-86825566 CCAAGGACTGTGAGCCTGGAAGG + Intergenic
1014447691 6:121547337-121547359 CACAGGATGGGGAGTGTGGCAGG + Intergenic
1016892909 6:149024170-149024192 ACAAGGACGGGCAGCCAGGCTGG - Intronic
1018598928 6:165517709-165517731 CCAAGGACGGGGTGAATGGAGGG + Intronic
1019405843 7:883708-883730 CCGAGGCCGGGGAGAGTGGGGGG - Intronic
1019465429 7:1185600-1185622 CCACGGAGGGGGAGGGTGGACGG - Intergenic
1019882965 7:3879576-3879598 CTGAGTACCGGGAGCGTGGCTGG - Intronic
1021027729 7:15688594-15688616 CCAAGGGCGTGGGGAGTGGCAGG - Intergenic
1022372310 7:29783406-29783428 CACAGGATGGGGGGCGTGGCAGG - Intergenic
1025951275 7:66147373-66147395 CCAAGGACTGAGACCGTGTCTGG - Intronic
1028398918 7:90403760-90403782 CCAAGGACTGGGAGCTTTGCTGG + Intronic
1029452172 7:100647337-100647359 GCAGGGAGGGGGAGCGGGGCAGG - Intronic
1029556689 7:101275212-101275234 CCAAGGACAAGGAACGAGGCTGG - Intergenic
1031586228 7:123534735-123534757 CCAAAGACTGGGGGCGGGGCCGG + Intronic
1034054081 7:148016169-148016191 CAAAGGACGTGGAGATTGGCAGG - Intronic
1034489785 7:151387079-151387101 GCAAGCACAGGGAGCCTGGCTGG - Intronic
1035726263 8:1825609-1825631 CCATGGAAGGGGAGTGGGGCTGG - Intronic
1036579646 8:10062031-10062053 GCAAGGAGTGGGAGCCTGGCTGG + Intronic
1037560835 8:20073140-20073162 CTAAGGAAGGGGAGAGAGGCTGG - Intergenic
1037906733 8:22719790-22719812 CCAGGGAGGGGCAGGGTGGCTGG + Intronic
1037987477 8:23299032-23299054 TCAGGGAAGGGGAGCGTGGCAGG + Intronic
1039870362 8:41540520-41540542 CCGGGGAAGGGGAGCTTGGCCGG + Intronic
1041792741 8:61714723-61714745 GCAGGGGCGGGGAGCGCGGCAGG - Intergenic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1044142479 8:88672556-88672578 CCACGGGCGGGGAGGGGGGCGGG + Intergenic
1044858048 8:96495197-96495219 CCAGAGAGGGCGAGCGTGGCGGG - Intronic
1045111221 8:98940677-98940699 CCAAGGCCGGGGACCTTGTCCGG - Intronic
1045649153 8:104326671-104326693 CCAAGGAGGGGTTGGGTGGCAGG - Intergenic
1049552666 8:143267630-143267652 CCAAGCCCGGGGAGCGGGGTGGG + Intronic
1052219135 9:25998351-25998373 CCAAGGATGGAGAGAGAGGCAGG - Intergenic
1052990794 9:34518408-34518430 GCAAGGGCTGGGAGTGTGGCTGG + Intronic
1054895947 9:70311307-70311329 CCAAGGAGAGGGAGAGTGACTGG + Intronic
1056578973 9:87876599-87876621 CCAAGGTCGGTGGGTGTGGCTGG + Intergenic
1061729213 9:132600499-132600521 CCAAGGACAGGCACAGTGGCAGG + Intronic
1061907217 9:133704867-133704889 GCAAGGACGGGGCACGTGGAGGG + Intronic
1062272482 9:135716057-135716079 CCCAGGGCGGCGTGCGTGGCTGG + Intronic
1062684814 9:137806325-137806347 CCAAGGTGGAGAAGCGTGGCAGG - Intronic
1203472075 Un_GL000220v1:119620-119642 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1185762811 X:2701279-2701301 CCATGGACTGGGAGGGTGGATGG - Intronic
1185931102 X:4204329-4204351 CCAAAAAAGGGGAGGGTGGCAGG + Intergenic
1189072437 X:37878011-37878033 CCAAGGACGGGGAGAGAGACAGG - Intronic
1195037731 X:100985419-100985441 CCAAGTATGGGCAGGGTGGCAGG + Intronic
1200986664 Y:9308036-9308058 CCAAGGATGGGGACGTTGGCGGG - Intergenic