ID: 1163717060

View in Genome Browser
Species Human (GRCh38)
Location 19:18878862-18878884
Sequence ACCCGTCCAAGCGTGTTCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 7}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163717060_1163717070 26 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717070 19:18878911-18878933 CGGGCCCCTCCACACTCACTCGG 0: 1
1: 0
2: 1
3: 18
4: 174
1163717060_1163717065 -1 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717065 19:18878884-18878906 TGACACTAAAGGAGGGAACGCGG 0: 1
1: 0
2: 0
3: 5
4: 102
1163717060_1163717069 7 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717069 19:18878892-18878914 AAGGAGGGAACGCGGGGTGCGGG 0: 1
1: 0
2: 0
3: 21
4: 259
1163717060_1163717063 -9 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717063 19:18878876-18878898 TGGACGGGTGACACTAAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 63
1163717060_1163717064 -8 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717064 19:18878877-18878899 GGACGGGTGACACTAAAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 80
1163717060_1163717067 1 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717067 19:18878886-18878908 ACACTAAAGGAGGGAACGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 50
1163717060_1163717066 0 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717066 19:18878885-18878907 GACACTAAAGGAGGGAACGCGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1163717060_1163717068 6 Left 1163717060 19:18878862-18878884 CCCACGAACACGCTTGGACGGGT 0: 1
1: 0
2: 0
3: 5
4: 7
Right 1163717068 19:18878891-18878913 AAAGGAGGGAACGCGGGGTGCGG 0: 1
1: 0
2: 1
3: 32
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163717060 Original CRISPR ACCCGTCCAAGCGTGTTCGT GGG (reversed) Exonic