ID: 1163720601

View in Genome Browser
Species Human (GRCh38)
Location 19:18896432-18896454
Sequence CGTGCCCCCCGTCACGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163720601_1163720613 27 Left 1163720601 19:18896432-18896454 CCGTGCCCGTGACGGGGGGCACG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1163720613 19:18896482-18896504 CTGGCGACCCCCGCTTCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 133
1163720601_1163720609 8 Left 1163720601 19:18896432-18896454 CCGTGCCCGTGACGGGGGGCACG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1163720609 19:18896463-18896485 TAGCAGGCAGTCCCCTCGACTGG 0: 1
1: 0
2: 1
3: 2
4: 49
1163720601_1163720608 -8 Left 1163720601 19:18896432-18896454 CCGTGCCCGTGACGGGGGGCACG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1163720608 19:18896447-18896469 GGGGCACGGGGGACACTAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163720601 Original CRISPR CGTGCCCCCCGTCACGGGCA CGG (reversed) Intronic
901135374 1:6989657-6989679 CTTCCCCCACGTCACTGGCAGGG + Intronic
902616921 1:17628872-17628894 CCTGCCCCACTTCACAGGCATGG - Intronic
908544274 1:65148440-65148462 CGGGCCGCCCGGCTCGGGCAAGG + Exonic
915168494 1:153962211-153962233 AGTGCTCACCGTCACGTGCAAGG + Exonic
915579274 1:156803779-156803801 GGTGCCCCTCGTCATGGGGAGGG + Intergenic
1069864753 10:71495041-71495063 CCTGCCCCCACTCAGGGGCAGGG - Intronic
1070437907 10:76411738-76411760 TGTGCCCCCTGTCAGGGGCGTGG - Intronic
1076944702 10:133637970-133637992 CGTGGCCCCCTCCAGGGGCAGGG - Intergenic
1083678325 11:64340248-64340270 CGGGCACCCCGACCCGGGCATGG + Exonic
1085296395 11:75434103-75434125 GGTGCCCCCAGTCCTGGGCATGG + Intergenic
1087743413 11:101915160-101915182 CAGGCCCCGCGTCACGGGCGCGG - Exonic
1094567842 12:31616385-31616407 CGGGCCGCCCGGCTCGGGCAAGG - Intergenic
1101771982 12:107760689-107760711 CGTGCACCCCGCCACGGGTTGGG + Exonic
1104442205 12:128802923-128802945 GGTGCCCCCAGTCACGAGCGAGG + Intronic
1104595068 12:130115315-130115337 CATGCCCCAAGTCCCGGGCAGGG - Intergenic
1131097479 15:89665741-89665763 CGCGCCCCCCGGCCCGGGCCTGG - Exonic
1132582961 16:693827-693849 TGTCCCCCCCATCCCGGGCAGGG - Exonic
1132739567 16:1404783-1404805 CGTGTACCCCGTCACGTGGATGG - Intronic
1137555764 16:49469351-49469373 TGTGCCCCCCAGCACGGGCTTGG + Intergenic
1141891071 16:86926755-86926777 CCTGCCCCTCTCCACGGGCAAGG + Intergenic
1146251186 17:31345551-31345573 CGGGCCGCCCGGCTCGGGCAAGG + Intronic
1147605484 17:41771734-41771756 CGTGCCCTCCGTCAGCAGCAAGG - Exonic
1147878000 17:43635193-43635215 AGTGCCCCTCTTCAAGGGCATGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1160853384 19:1205529-1205551 GGAGACGCCCGTCACGGGCAGGG - Intronic
1161068804 19:2250506-2250528 CATGCCCCCCGCCACGGCCCGGG - Intronic
1163720601 19:18896432-18896454 CGTGCCCCCCGTCACGGGCACGG - Intronic
1164777333 19:30863036-30863058 TGCTCCCCCCGTCACGGCCAAGG - Intergenic
1165138256 19:33684336-33684358 CGTGCCGCCCGGCAGGGGCCTGG + Intronic
932779218 2:74549497-74549519 CAGCCCCTCCGTCACGGGCAGGG + Exonic
938101200 2:128499324-128499346 CCTGCCCCTCTTCAAGGGCATGG - Intergenic
938127681 2:128686273-128686295 CCTGTCCCCCATCATGGGCAGGG - Intergenic
1169214751 20:3786543-3786565 GGTGCCCCCCGCCACGGGCCCGG - Exonic
1171782041 20:29427966-29427988 CATGCCCCCCGCCAGGGGCAGGG - Intergenic
1172596920 20:36156009-36156031 AGTGCCTCCTGTCCCGGGCAAGG + Intronic
1173741538 20:45405929-45405951 CGCGCCCCCCGACGCCGGCAAGG - Intronic
1175542617 20:59757204-59757226 CGTGACCCCCATCAAGGGCTGGG - Intronic
1176178713 20:63740007-63740029 CGTGGGCACCGTCACGGGCGCGG - Exonic
1180170765 21:46057076-46057098 TCTGCCACCCGTCACGGGCAGGG - Intergenic
1182319699 22:29470571-29470593 CGTGCCCGCCGTCGCCTGCAGGG + Intergenic
950812181 3:15659325-15659347 AGTGCCCCCCTTCCCAGGCATGG - Intergenic
969237702 4:5877645-5877667 CGTTCCCCCTCTCACGGGTAGGG + Intronic
978330603 4:107609085-107609107 CGTGCCACCTGTCATGGTCAGGG + Intronic
985448088 4:190038480-190038502 CGTGGCCCCCTCCAGGGGCAGGG - Intergenic
992825993 5:80550746-80550768 TCTGCCCCCCGTCTGGGGCAAGG + Intergenic
997338158 5:133122251-133122273 AGTGCCACTCGTGACGGGCAGGG - Intergenic
1002779890 6:357920-357942 CCTGACCCCAGTCACAGGCAAGG + Intergenic
1002782924 6:380639-380661 CGTGCCCCCAGTGCCAGGCAAGG + Intergenic
1003988453 6:11461539-11461561 AGTGCCACCCGTTACGGGAAAGG - Intergenic
1006535523 6:34696311-34696333 CGTCCTCCCCGTCCCGGGAAGGG + Intronic
1019195647 6:170280974-170280996 GGAGCCCCCCGCCGCGGGCACGG - Intergenic
1026984628 7:74547014-74547036 TTTGCCCCCCGACACAGGCACGG + Intronic
1034446002 7:151114726-151114748 CGTGCCCCTCGCCATGGGCCTGG + Intronic
1049680840 8:143917370-143917392 CGTGGACCCCGAGACGGGCAAGG - Exonic
1049689858 8:143953689-143953711 CGCGCCCCCCGGCTCGGGCCCGG + Intronic
1052991731 9:34522748-34522770 AGGGCCTCCCGCCACGGGCACGG - Intronic