ID: 1163721730

View in Genome Browser
Species Human (GRCh38)
Location 19:18901096-18901118
Sequence AGGTGGCTCCAAAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163721721_1163721730 20 Left 1163721721 19:18901053-18901075 CCATGAAGGGGGACACCAGCTTG 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG 0: 1
1: 0
2: 3
3: 17
4: 220
1163721723_1163721730 5 Left 1163721723 19:18901068-18901090 CCAGCTTGCGCTCACAGGAGCAG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG 0: 1
1: 0
2: 3
3: 17
4: 220
1163721720_1163721730 23 Left 1163721720 19:18901050-18901072 CCACCATGAAGGGGGACACCAGC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG 0: 1
1: 0
2: 3
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163721730 Original CRISPR AGGTGGCTCCAAAGGGAAGT GGG Intronic
900132136 1:1091721-1091743 GGGTGGGGCCAAATGGAAGTGGG + Intronic
900132150 1:1091759-1091781 GGGTGGGGCCAAATGGAAGTGGG + Intronic
900132197 1:1091903-1091925 AGGTGGAGCCAAATGGAGGTGGG + Intronic
900211738 1:1459613-1459635 AGTTTGCTCCCACGGGAAGTTGG + Intronic
900224547 1:1526913-1526935 AGTTTGCTCCCACGGGAAGTTGG + Intronic
900237258 1:1598749-1598771 AGGTGTCTCCAAGGGGACGCTGG + Exonic
900613108 1:3552808-3552830 AGGTGGCTGCAGAGAAAAGTGGG - Intronic
900925621 1:5704373-5704395 AGGAGGCTGCAGAGGGAGGTGGG + Intergenic
901246934 1:7739175-7739197 AGGTTGCATCAATGGGAAGTTGG - Intronic
902787952 1:18745288-18745310 AGTTGGGTCCAAAGGGCTGTAGG - Intronic
903284106 1:22266510-22266532 ATGTGGCTCCCAGGGGAACTGGG - Intergenic
904238250 1:29127727-29127749 GGGTCCCTCCAAAGAGAAGTGGG - Intergenic
905768189 1:40620598-40620620 AGGTGGCTACAAAGAGGAGGAGG - Intergenic
907050782 1:51328984-51329006 AGGTGGCTTCAAAGAAGAGTGGG + Intronic
907202577 1:52740426-52740448 AGGAGTCTCCAAAGAGTAGTTGG + Intronic
908828089 1:68152730-68152752 ATGTGGCTTCAGGGGGAAGTGGG + Intronic
909730653 1:78885040-78885062 AGGTGGCTCTGCAGAGAAGTTGG + Intergenic
912389039 1:109289023-109289045 AGGCTGCTCCAAGGGGAAGAAGG - Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915587631 1:156852670-156852692 AGGTGGCTCCAAGCAGCAGTGGG + Intronic
916506884 1:165436254-165436276 AGGTGGCTCCAAGGGGACTCAGG - Intronic
916945999 1:169728082-169728104 ATGTGGCCCCACAGGGGAGTGGG - Exonic
917217919 1:172697091-172697113 AGGTGGCCAGAAAGGGAGGTGGG + Intergenic
918147958 1:181774514-181774536 TGGTGGCTCCAAAGGGGTGTTGG + Intronic
918171087 1:181998119-181998141 AGGTGGCTAAGAGGGGAAGTGGG + Intergenic
920004562 1:202823528-202823550 AGGAAGCTCCAAAGGGAATGGGG + Exonic
921087629 1:211810947-211810969 AGGTGACAACAGAGGGAAGTAGG + Intronic
921255074 1:213331665-213331687 AGCTGTCTGCACAGGGAAGTCGG + Intergenic
922243238 1:223770739-223770761 AGGCGGCTCCAAAGGAAACTTGG - Intronic
923631964 1:235655813-235655835 AGGTGACTCAAATGGGAAGTGGG - Intergenic
1062855886 10:779376-779398 GGGTGGCTCCACAGGGAACAGGG + Intergenic
1063754406 10:8990575-8990597 GGGTGGCTTCAAATGTAAGTAGG - Intergenic
1065386895 10:25142921-25142943 AAGGGGTTCCAAAAGGAAGTAGG + Intergenic
1069069089 10:63975693-63975715 AGGTGCATCCAAAGGGCAGCTGG - Intergenic
1071713610 10:88073797-88073819 CGGTGGCTACAAGGGGAAGGTGG - Intergenic
1073486781 10:103824172-103824194 AGGTGGCCCCAAGGGGAGGGTGG + Intronic
1074406199 10:113182027-113182049 AGGTGGGTGCAAAGGGAGATAGG + Intergenic
1074890531 10:117732446-117732468 AGGTAGCTGCAAAAGGCAGTGGG + Intergenic
1076270059 10:129144567-129144589 ATGTGAGTTCAAAGGGAAGTAGG - Intergenic
1076290294 10:129340613-129340635 AGGGTGGTCCAAAGGGAACTGGG - Intergenic
1077545990 11:3170224-3170246 AGGTGGCTCCAGGGGGCTGTGGG + Intergenic
1078011480 11:7576174-7576196 AGGTGACCCCCAAGGGAACTGGG + Intronic
1078096696 11:8301798-8301820 AGGTGTTTCCAAAGGAAAGGAGG - Intergenic
1080170593 11:29297412-29297434 AGATTGCTCCAAAGGTAATTTGG + Intergenic
1080601774 11:33828146-33828168 ATGTGGCTCCAATGTGAATTGGG - Intergenic
1081638143 11:44734610-44734632 AGGTTGCTGGGAAGGGAAGTGGG - Intronic
1081965506 11:47166751-47166773 AGGTGGATGCAGAGGTAAGTGGG - Exonic
1082813315 11:57491808-57491830 AGGAGGCTCCACAGGAAAGTGGG + Exonic
1083265336 11:61544236-61544258 AGGTGGCTCCCAAGGGCTCTGGG - Intronic
1083616740 11:64029950-64029972 AGGAAGCTCCCAAGGGAAGGAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1087482549 11:98719548-98719570 TGGAGGCTACAAAGGGTAGTAGG + Intergenic
1088754313 11:112872978-112873000 AAGTGGCTCGACAGGGCAGTGGG - Intergenic
1090074216 11:123569338-123569360 AGGAGGATCCAAGGGGAATTGGG + Intronic
1090909354 11:131104982-131105004 GGGTGGCTGCAAGGGGAATTCGG + Intergenic
1093098628 12:15000712-15000734 AAATGCCTCCAAAGGCAAGTAGG + Intergenic
1093527765 12:20122648-20122670 AGGAGGCTGGAAAGGGAAATAGG - Intergenic
1093780859 12:23135783-23135805 AGGAGTCACCCAAGGGAAGTAGG + Intergenic
1094479385 12:30869664-30869686 AGGAGGCACCAGAGGGAGGTTGG - Intergenic
1096535413 12:52269242-52269264 AGGTGGCGCCAGAGGAATGTGGG + Intronic
1098627608 12:72691780-72691802 TGCTGGCCCCAAAGGGAAGTGGG + Intergenic
1102628219 12:114253490-114253512 AGGAAGCTCCACTGGGAAGTAGG + Intergenic
1103420641 12:120779533-120779555 TGGTGGTTCCAAAGAGAAGAAGG - Intronic
1104505208 12:129325482-129325504 AGGTGGATCCAAAGGCTTGTTGG + Intronic
1104729849 12:131098679-131098701 AGGTGACTGCAGAGGGAAGAGGG - Intronic
1106133551 13:26958393-26958415 GGGTTGCTCCATAGGGAGGTGGG + Intergenic
1106780530 13:33055030-33055052 TGATGGCTGCAAAGGGAAGAGGG - Exonic
1108028157 13:46200263-46200285 AGCTGGCTGAAAGGGGAAGTGGG + Intronic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1111510333 13:89253478-89253500 TGGTCCCTCCAAAGGAAAGTTGG - Intergenic
1111845987 13:93508997-93509019 AGGTGACTCCACTGGGAAGATGG + Intronic
1116203969 14:41837044-41837066 AGATTGCTCCAAAGGAAAGAAGG + Intronic
1116414341 14:44662463-44662485 AGGTGGCAGAAAAGGAAAGTTGG + Intergenic
1117652908 14:57925173-57925195 AGGTGGGGCCTAATGGAAGTGGG - Intronic
1119078937 14:71673948-71673970 AGGTGGCTCAGAAAGGCAGTGGG + Intronic
1119931729 14:78554039-78554061 AGATGGCCCAAAAGGTAAGTGGG + Intronic
1122170181 14:99866716-99866738 AGGTGGTTGCCAAGGGCAGTGGG - Intronic
1124093138 15:26624766-26624788 AGCTGGCAACAAAGGGAAGGGGG + Intronic
1125342627 15:38689696-38689718 AGTTGCCTCCAGAAGGAAGTAGG - Intergenic
1126190062 15:45869708-45869730 AGTTGGCTCCACTGGGAAGATGG - Intergenic
1127638520 15:60893641-60893663 AAGAGGCTCCTAAGGGAAGCGGG + Intronic
1128576361 15:68777990-68778012 AGCTTGCTTCAAAGGGCAGTAGG + Intergenic
1129996150 15:80008022-80008044 AAGTGGCTCCAAATGAAATTCGG + Intergenic
1130146638 15:81279609-81279631 AGGTGGCTGCACAGGGAAGGAGG - Exonic
1130146937 15:81281563-81281585 AGGTGGCTTCACAGGCAAGGGGG - Intronic
1130370080 15:83277864-83277886 AAGTAGCTCCAAAGAGCAGTGGG - Intronic
1132830249 16:1924481-1924503 AGCTGGGTACAAAGGGAGGTGGG - Intergenic
1133698903 16:8290570-8290592 ACGTGTCTCCAAAGAGTAGTTGG - Intergenic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1137607368 16:49795683-49795705 AGGGGGCTACACAGGGAGGTAGG + Intronic
1138487947 16:57358770-57358792 AGGTGTCTGCAAAGGGACATAGG - Exonic
1138498626 16:57424370-57424392 AGTTGGCTCCAAAGGGAGACGGG - Intergenic
1138933972 16:61696286-61696308 AAGTGGCTCCAGTGGAAAGTGGG + Intronic
1139409777 16:66750414-66750436 TGGTGGCTGCTAAGGTAAGTTGG - Intronic
1139558637 16:67728208-67728230 AGGTGGCTCCAAATGTACGAAGG - Intronic
1139849124 16:69940150-69940172 AGGTGGGGCCAAAGGCAACTAGG - Exonic
1141273956 16:82568098-82568120 AAGTGGCTCCAAACAGAAATTGG + Intergenic
1141609042 16:85170914-85170936 AGGAGGCTCCCGAGGGAAGAGGG + Intergenic
1141863545 16:86734200-86734222 AGGTGACTCCATATGGAAATAGG - Intergenic
1147134608 17:38427888-38427910 AGGGGTCTCTAAAGGGAAGGGGG + Intergenic
1147678620 17:42224708-42224730 AGGTGGGTCCAGAGGGAGGTGGG + Intronic
1148245312 17:46026353-46026375 AGGGAGCCCCAAGGGGAAGTAGG - Exonic
1148960930 17:51392170-51392192 AGGAGGCTCCAGGGGAAAGTGGG + Intergenic
1149423214 17:56530605-56530627 AGGTGGCTCCAAGAAGAACTCGG + Intergenic
1150004814 17:61463081-61463103 AGGTGGCTCCAGAAGGAGGAAGG - Intronic
1152322011 17:79612957-79612979 AGGAGGCTCCAAAGGGCAGTAGG - Intergenic
1155935322 18:31747236-31747258 AGGTGGCTCCAAATGGAATTAGG - Intergenic
1157885022 18:51358561-51358583 AGGTGGCTCCTAAGAGGAGTGGG - Intergenic
1158245835 18:55431252-55431274 AGGTGGAATCAAAGGGATGTAGG - Intronic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1165793894 19:38507475-38507497 AGGTGGGGCCAAAGGGGAGGAGG + Intronic
1167455765 19:49596171-49596193 AGGTGGCTACAAGGGCAAGGGGG + Exonic
926319205 2:11736786-11736808 AGAGGGCTGCAAAGGGAAGGGGG - Intronic
926443899 2:12920846-12920868 AGGTGATTCCAAAGTGAAGTTGG + Intergenic
930055548 2:47249475-47249497 AGGTGGCACCAATGGGCAGGAGG - Intergenic
931256034 2:60573710-60573732 AGATGTCTGCAAAGGGAGGTTGG + Intergenic
931532981 2:63237815-63237837 TGGTGGCTCCAAAAGGAAAGAGG + Intronic
932454375 2:71837604-71837626 ATCTGGCTGCAAAGGGAAGCTGG + Intergenic
932560381 2:72862687-72862709 AGGTGGCGCCAAAGCGCAGCCGG - Intergenic
932879805 2:75490645-75490667 AAGAGGCTCTTAAGGGAAGTTGG + Intronic
933807519 2:86011181-86011203 AGGTGACTGCCAAGGGAAGAAGG + Intergenic
938140243 2:128789475-128789497 ACGTGAGTCCAAAGGGAAGGAGG + Intergenic
939745161 2:145958542-145958564 AGGTGGCTTCCCAGGGAACTGGG + Intergenic
940190054 2:151031247-151031269 AGGCGTCTCAAAAGGGAAGTCGG - Intronic
942004580 2:171685310-171685332 AGGTGGGTAGAAAGGGAAATTGG - Intergenic
942328163 2:174793309-174793331 AGGTGACTTTGAAGGGAAGTAGG + Intergenic
945146109 2:206739911-206739933 AGGAGGCTTCATAGGGATGTTGG - Intronic
945479632 2:210329803-210329825 TGAGGACTCCAAAGGGAAGTTGG - Intergenic
946227377 2:218271220-218271242 AGGAGAATCCAAAGGGAAATGGG - Intronic
948456003 2:238104919-238104941 TGGGGGCTCCAGAGGGAACTGGG + Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948676596 2:239600664-239600686 GGGAGGCTCCAGAGGGAGGTTGG + Intergenic
1168989125 20:2079311-2079333 AGGTGGCTCCTAAAGGAAATGGG - Intergenic
1169940672 20:10933832-10933854 AGGTGGCTCTAGAGCGCAGTTGG - Intergenic
1173866650 20:46316839-46316861 AGGTGGCTCCCTAGGGTAGAGGG + Intergenic
1174520063 20:51122415-51122437 AGATTGCTCTAAAGGGAACTGGG - Intergenic
1175344783 20:58265019-58265041 AGGAGTCTGCAAAGGGTAGTGGG + Intergenic
1176037596 20:63047780-63047802 TGGTGGCTCCAGAGGAATGTTGG + Intergenic
1177961906 21:27677935-27677957 AGGTGGTTACAAATGGAAATGGG + Intergenic
1178296008 21:31410998-31411020 AAGTGGCTCCAAGGGTGAGTGGG + Intronic
1178536072 21:33411388-33411410 AGGTGCCCGGAAAGGGAAGTCGG + Intronic
1180203254 21:46240025-46240047 TGGTGGCTAAAGAGGGAAGTGGG + Intronic
1182202545 22:28588492-28588514 AGGTGTCTCCACAGAGAAATGGG + Intronic
950139387 3:10604757-10604779 TGATGGCTCTAAAGGGAAGTAGG - Intronic
950879111 3:16307667-16307689 TGGTAGCTGGAAAGGGAAGTGGG + Intronic
951702773 3:25512639-25512661 AGGTGGCTTCAAGGAGGAGTAGG - Intronic
954910019 3:54096720-54096742 GAGAGGCTCCAAAGGGAAGGCGG + Intergenic
957076625 3:75607711-75607733 ATGTGGGTCCAACTGGAAGTGGG + Intergenic
961322387 3:126084480-126084502 AGGCGGGTCCCAAGGGAAGTTGG - Intronic
962776832 3:138669109-138669131 AGGTCTCTTAAAAGGGAAGTAGG + Intronic
963225555 3:142858167-142858189 AGGAGGCACCAAAGGGGAGAGGG - Intronic
965284485 3:166800509-166800531 AGGTGCCTCCAAAGAGAAAAGGG - Intergenic
967967949 3:194976980-194977002 AGTTGGCTACAAAGGGCAGAAGG - Intergenic
968618769 4:1594167-1594189 TGCTGGCTCCCAAGGGAAGGAGG - Intergenic
969091003 4:4693987-4694009 TGGTTGCACCAAAGGGAAGGCGG - Intergenic
969239538 4:5889459-5889481 ATGTTGCTCCAGAGGGAGGTGGG + Intronic
970127138 4:12827380-12827402 AGGAGGATACAATGGGAAGTTGG + Intergenic
970902719 4:21178196-21178218 TGGTGGCTCCAAAGGGCACAAGG + Intronic
971632944 4:29018367-29018389 ACCTGGCTCCAAAGGGATTTAGG + Intergenic
972629786 4:40833186-40833208 TGGTGGCTGCACATGGAAGTTGG - Intronic
975385327 4:73751567-73751589 AGGTGTTTCCAGATGGAAGTGGG + Intergenic
980663170 4:135894081-135894103 AGGGGACTCCAAAGGGAAAATGG + Intergenic
982504153 4:156196928-156196950 ACGTGGCGCCAAGGGGAATTTGG + Intergenic
985137484 4:186801781-186801803 AGGAGGGTCCAGAGGGAAGTTGG + Intergenic
985192659 4:187393139-187393161 CGGTGGCTGAAGAGGGAAGTCGG - Intergenic
985782997 5:1880748-1880770 AGCTGGCTCGTAAGGGTAGTAGG + Exonic
986315814 5:6585628-6585650 AGGATGCTCCTAAGAGAAGTGGG - Intergenic
988175504 5:27718529-27718551 AGGTGGCTCAGAAGGGAAATTGG + Intergenic
991559804 5:67938372-67938394 AGTTTGCTCCAAAAGAAAGTAGG - Intergenic
991744920 5:69727726-69727748 AGGTGGTTCCAGACTGAAGTAGG - Intergenic
991752784 5:69827500-69827522 AGGTGGTTCCAGACTGAAGTAGG + Intergenic
991796490 5:70307454-70307476 AGGTGGTTCCAGACTGAAGTAGG - Intergenic
991802403 5:70384234-70384256 AGGTGGTTCCAGACTGAAGTAGG + Intergenic
991824300 5:70603040-70603062 AGGTGGTTCCAGACTGAAGTAGG - Intergenic
991832103 5:70702628-70702650 AGGTGGTTCCAGACTGAAGTAGG + Intergenic
991888869 5:71307010-71307032 AGGTGGTTCCAGACTGAAGTAGG - Intergenic
994049060 5:95342284-95342306 AGGTGGCTCTAAAGGTCAGGTGG + Intergenic
994154712 5:96490206-96490228 AGGAGGCTGGAAAGGTAAGTGGG - Intergenic
994386237 5:99136371-99136393 ATGAGGCTCCTAAGCGAAGTTGG - Intergenic
995903298 5:117094169-117094191 AGCTTGCCCCAAAGCGAAGTGGG - Intergenic
997610806 5:135214207-135214229 AGGACCCTCCAAAGGGAAGCGGG - Intronic
997628356 5:135347161-135347183 GGGTGACTCCAAAGAGAATTTGG - Intronic
998269193 5:140691460-140691482 AGCTGGCTACTAAGGGAACTTGG + Exonic
999605520 5:153310198-153310220 GGGTGCCACCAATGGGAAGTGGG - Intergenic
1000244856 5:159440888-159440910 AGGTGTCTCCAAAAGGTTGTTGG + Intergenic
1000628582 5:163566511-163566533 AGGTGACTCAAAAAGGAAATTGG + Intergenic
1001383142 5:171316872-171316894 AGGTTCCTCCACAGGGAAGGCGG + Intergenic
1001869632 5:175139962-175139984 ACGGGGCTCCAAAGGGGAGAGGG + Intergenic
1002309438 5:178305881-178305903 AGGTGTCTACACAGGGAAGCAGG + Intronic
1002769498 6:278694-278716 AGGTGGCTCTCAAGAGAATTTGG + Intergenic
1004286172 6:14322806-14322828 AGGGGACTCCAGAGGGAAGAGGG + Intergenic
1005555298 6:26973734-26973756 AGGTGGTTCCAGACTGAAGTAGG - Intergenic
1005603437 6:27450487-27450509 AGGTGTCTGCAAACGGAAATGGG + Intergenic
1005717194 6:28561128-28561150 AGATGGGTCTAAAGGGAACTTGG - Intergenic
1006192279 6:32216996-32217018 AGCTGGCTCCAACGGGACATGGG + Exonic
1007071280 6:39040169-39040191 GGGGGGTTCCTAAGGGAAGTGGG - Intergenic
1007775320 6:44221748-44221770 AGGTGGCTACAGAGGGGTGTGGG + Intronic
1010906061 6:81490565-81490587 AGGTGTCACAAAAGGTAAGTGGG + Intergenic
1014822431 6:126006127-126006149 AGGGGACTACAAAGGGTAGTGGG - Intronic
1015954846 6:138588930-138588952 GGGTGGCTCCATATGGAAGGCGG - Intronic
1017501977 6:155034059-155034081 AGGAGACTCCAAAGGGAGGCAGG - Intronic
1018635925 6:165859439-165859461 AAGTGGCCCCCAAGGGAAGGAGG - Intronic
1021842153 7:24729527-24729549 ATGTGGCTCCTGAAGGAAGTGGG + Intronic
1021968474 7:25945132-25945154 AGCACGCTCCAAAGGGAAGGGGG - Intergenic
1022495752 7:30852092-30852114 AGGTGGCTCCAGAGAGAAAATGG - Intronic
1022892008 7:34710873-34710895 AGATGCTTCCAAAGGCAAGTTGG + Intronic
1025026468 7:55520430-55520452 AGGTGGCTCCACAGGGCTGGTGG + Intronic
1026102003 7:67391138-67391160 AGGTGGCTCAAAGGCGGAGTTGG + Intergenic
1028381843 7:90208844-90208866 TGGGGGCTCCAGGGGGAAGTGGG - Intronic
1028830221 7:95319632-95319654 AGCAGGCTTCAAAGGAAAGTTGG + Intronic
1034545940 7:151789435-151789457 AGGTGGCCCAAGAGGGAACTGGG - Intronic
1035787649 8:2274911-2274933 AGATGACTCCAAGGGGAAGGAGG - Intergenic
1035805161 8:2446805-2446827 AGATGACTCCAAGGGGAAGGAGG + Intergenic
1038950182 8:32405338-32405360 TGGTGGCTTCAAATGGGAGTAGG - Intronic
1038996377 8:32927857-32927879 AGCTGGCTCGCAAGGGAATTTGG - Intergenic
1039626899 8:39063300-39063322 AGGTGGATCCTGAGGGAAATTGG + Intronic
1039867013 8:41513785-41513807 AGGTGGATGCAAGGGTAAGTAGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1044077009 8:87834264-87834286 AGGTGGCTCCATAAGGTTGTAGG - Intergenic
1048311619 8:133326832-133326854 GGGTGGTTCCATAGGGATGTGGG + Intergenic
1049069756 8:140347258-140347280 AGGTGGCTGGGAAGGGAAGGCGG - Intronic
1051105823 9:13578951-13578973 AGTTGGCCCTAAAGTGAAGTAGG - Intergenic
1053364694 9:37514361-37514383 TGGGGTCTCCAAAGGGAAGGAGG + Intronic
1057833611 9:98426614-98426636 AGATGGCTCCACAAGGGAGTTGG + Intronic
1057836789 9:98451763-98451785 AGGAGGCTGGGAAGGGAAGTTGG - Intronic
1057951377 9:99371451-99371473 AGGAGGCTGCAAAAGGAAATGGG + Intergenic
1059503420 9:114776399-114776421 AAGTGGCTGCAGGGGGAAGTGGG + Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1061423570 9:130485288-130485310 AGGTAGGTCCCAAAGGAAGTTGG + Intronic
1185862472 X:3592185-3592207 AGGGGGCTCCAAAGGCGAGAGGG + Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1189541457 X:41995318-41995340 AGGTGGCTACTAAGTGATGTTGG + Intergenic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1191136484 X:57070183-57070205 AGGTGGCCAGAAAGGGAAATAGG - Intergenic
1192422422 X:71045569-71045591 AGGTGGCACCAGAAGGCAGTTGG - Intergenic
1193860272 X:86657074-86657096 AGGTGGCTCAGAAGGGTAGTGGG + Intronic
1194062669 X:89223660-89223682 AAATGTCTCAAAAGGGAAGTAGG + Intergenic
1198885736 X:141334109-141334131 ATGTGGCTTCAGATGGAAGTGGG + Intergenic
1199239655 X:145531407-145531429 ATGTGGCTAGAAAGGTAAGTTGG + Intergenic