ID: 1163722058

View in Genome Browser
Species Human (GRCh38)
Location 19:18903043-18903065
Sequence ATGGGGCATCTGGGCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163722058_1163722070 30 Left 1163722058 19:18903043-18903065 CCCAGGCTGCCCAGATGCCCCAT 0: 1
1: 0
2: 2
3: 24
4: 257
Right 1163722070 19:18903096-18903118 CAGGTGAGATCCCTGCTTTGTGG 0: 1
1: 0
2: 0
3: 18
4: 188
1163722058_1163722069 11 Left 1163722058 19:18903043-18903065 CCCAGGCTGCCCAGATGCCCCAT 0: 1
1: 0
2: 2
3: 24
4: 257
Right 1163722069 19:18903077-18903099 CGGAATCTGGATTTCTTTGCAGG 0: 1
1: 0
2: 3
3: 15
4: 128
1163722058_1163722063 -9 Left 1163722058 19:18903043-18903065 CCCAGGCTGCCCAGATGCCCCAT 0: 1
1: 0
2: 2
3: 24
4: 257
Right 1163722063 19:18903057-18903079 ATGCCCCATTTCTGTGAGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 154
1163722058_1163722067 -2 Left 1163722058 19:18903043-18903065 CCCAGGCTGCCCAGATGCCCCAT 0: 1
1: 0
2: 2
3: 24
4: 257
Right 1163722067 19:18903064-18903086 ATTTCTGTGAGGCCGGAATCTGG 0: 1
1: 0
2: 1
3: 36
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163722058 Original CRISPR ATGGGGCATCTGGGCAGCCT GGG (reversed) Intronic
900394884 1:2449198-2449220 CTGGGGCGTCTGGCCAGCCACGG + Intronic
900941244 1:5800005-5800027 GTGGAGCCTCTGGGCAGCCCCGG - Intergenic
901196451 1:7442941-7442963 ATGTGGCATCTGGGAAGGCCAGG - Intronic
901529755 1:9845490-9845512 AGGGAGCTTCGGGGCAGCCTAGG + Intergenic
901838580 1:11939520-11939542 ATGGGACCTCTGGGCACCCCTGG - Intronic
902554798 1:17240605-17240627 AGGAGGCAGCTGGGCAGCCCAGG - Intronic
903634337 1:24800406-24800428 ACGGGGCAGCTGGCCAGGCTGGG - Intronic
903804976 1:25998818-25998840 AAGGGGCCTCTGGCCAGGCTTGG + Intergenic
903926359 1:26833576-26833598 AAGGGCCACCTGGGCTGCCTGGG - Intronic
904207617 1:28864996-28865018 GTGGGGGACCTGGGGAGCCTGGG - Intergenic
907704262 1:56819419-56819441 ATGGGGCAGGTGGGGAGCCTGGG - Intronic
908965615 1:69758527-69758549 ATGGGGCACATGTGCAGCATTGG + Intronic
909544606 1:76831845-76831867 ATGGGGTAGCTGGGCAGGCCTGG - Intergenic
911404799 1:97423212-97423234 AATGGGCATATGGGCAGCATAGG - Intronic
912546055 1:110452699-110452721 ATGGAGGATGTGGGGAGCCTGGG - Intronic
914987313 1:152472009-152472031 ATGGGGCAGCTGGCCAGGCGGGG + Intergenic
916875501 1:168964241-168964263 CTGTGTCATCTGGGCACCCTAGG + Intergenic
920563874 1:206958597-206958619 ATGGGGCAGCTGGTCTGCTTGGG + Exonic
921252085 1:213307710-213307732 AAGGGGCATCTTCTCAGCCTGGG + Intergenic
922388193 1:225109752-225109774 GTGGGGAAACTGGGCACCCTTGG + Intronic
922610151 1:226920516-226920538 TGGGGACATCTGGGCAGCCATGG + Intronic
922632977 1:227133353-227133375 ATGGGGCAGCTGGCCAGGCGGGG - Intronic
923219242 1:231878292-231878314 ATGGGGCACCTGACCAGGCTAGG + Intronic
924446777 1:244140239-244140261 TTGCGGCATCTGACCAGCCTGGG + Intergenic
924707100 1:246510221-246510243 AGGGGGCTTCTGGGGAGCCCAGG - Intergenic
924763598 1:247011139-247011161 ATGTGGCATCTGGCCAGGCGCGG - Intergenic
924779307 1:247131857-247131879 CTGAGGAATCTTGGCAGCCTAGG + Intronic
924948024 1:248858868-248858890 ACGGGGGCTCTGGGCAGCCTGGG - Intronic
1063738253 10:8787120-8787142 ATCAGGTATCTGGGCATCCTTGG + Intergenic
1065535921 10:26714585-26714607 ATGAGGCAGCTGAGCAGGCTAGG - Intronic
1067227147 10:44383723-44383745 CTGGAGAAGCTGGGCAGCCTGGG - Intronic
1067526075 10:47039421-47039443 CTGGGGCATCTGCGTAGCCTGGG - Intergenic
1069760879 10:70810203-70810225 CTGGGGCAGCTGGGCTCCCTAGG + Intergenic
1069908705 10:71747123-71747145 GTGGAGCATCTGGGCAGCTGTGG - Intronic
1070060868 10:72981616-72981638 ATAGGGCCTTTGGGCAGGCTAGG + Intergenic
1072626503 10:97115695-97115717 ACTGGGCACCTGGGCATCCTGGG + Intronic
1072984855 10:100130603-100130625 AGGGGCCCTCTGAGCAGCCTGGG - Intergenic
1073302649 10:102480443-102480465 CTGGGGCCTCAGGGCACCCTGGG + Exonic
1073907220 10:108296276-108296298 AAGGGGAATCTGGGCAGTCATGG + Intergenic
1074200040 10:111226369-111226391 AGAGGGCCTCTGGGCAGACTTGG - Intergenic
1075102776 10:119517919-119517941 AGTGGGCATCTGGTCAGCCAGGG - Intronic
1075273958 10:121076984-121077006 CTGGAGCTCCTGGGCAGCCTGGG - Intergenic
1075448017 10:122527095-122527117 AGGTGGCCTCTGGGCAGCCTGGG + Intergenic
1075722431 10:124595175-124595197 ATGGGGGTTCTGGGCAGGGTTGG + Intronic
1076720315 10:132389531-132389553 GGGGGGCCTCTGGGCAGCCTGGG - Intergenic
1077385578 11:2268103-2268125 ACGTGGCAGCTGGGCAGCCCAGG - Intergenic
1081547031 11:44078809-44078831 ACAGAGCGTCTGGGCAGCCTGGG + Intronic
1083183076 11:61000703-61000725 ATGGGACATCTCAGGAGCCTGGG + Intronic
1083555268 11:63621080-63621102 ATGGGGAATCTGAGCAAGCTGGG + Intergenic
1083617708 11:64034805-64034827 GTGGGGGCTCTGGGCAGGCTTGG + Intronic
1083780137 11:64913498-64913520 ATGGGGCAGCTCTGCAGGCTAGG - Intronic
1083812865 11:65115425-65115447 GTGGGGCAGCTGGGCTTCCTGGG + Intronic
1084041264 11:66544010-66544032 ATGGGGCATCTGAGCTGCTGGGG - Intronic
1084423434 11:69071814-69071836 AGGGGGAGTCTGGGCAGCCTTGG - Intronic
1089420892 11:118331388-118331410 ATGGGGCAGCTGGCCAGGCGGGG + Intergenic
1089609771 11:119662892-119662914 ACGTGGCTACTGGGCAGCCTGGG + Exonic
1089709500 11:120305025-120305047 ATCAGGCATTTGGGCACCCTGGG + Exonic
1090333959 11:125950664-125950686 ATGGGGCCTCTGGGATTCCTTGG + Intergenic
1092131592 12:6116977-6116999 TTGGTGCATCAGGGCAGCCAGGG - Intronic
1096995107 12:55833456-55833478 ACTGGGGATCTGGCCAGCCTTGG + Intergenic
1099709031 12:86196366-86196388 ATGGGGCTTCTGTGCAGAGTAGG - Intronic
1101167479 12:102052923-102052945 CTGGGGCAAGTGTGCAGCCTGGG - Intronic
1101195649 12:102379143-102379165 ATGGGGTATTTGGGGAGCCCTGG + Intergenic
1101571180 12:105955082-105955104 TTGTGTCATCTGGGCAGCCCAGG - Intergenic
1102440929 12:112963426-112963448 ACGGGACATCTGTGCAGCCCTGG + Exonic
1116560875 14:46377167-46377189 CTGAGGAATCTGGGCAGCCCAGG - Intergenic
1118430842 14:65717406-65717428 ATGGGGCAGCTGGGCAGAGGTGG + Intronic
1118630080 14:67694947-67694969 CTGGGGCACTTGGCCAGCCTTGG + Intronic
1119713881 14:76844515-76844537 CTGGGAGATCTGGGCAACCTGGG + Intronic
1121142454 14:91555220-91555242 CTGTGGAATCTGGGCAGTCTGGG + Intergenic
1121254285 14:92519959-92519981 GTAGGGCCTCTGTGCAGCCTTGG + Intronic
1122663678 14:103314611-103314633 GTGGGGCAGCTGGGCAGCCAGGG + Intergenic
1122915746 14:104857776-104857798 GTGGAGCAACTGGGCGGCCTTGG - Intergenic
1122969990 14:105148577-105148599 CTCGGGCATGGGGGCAGCCTGGG + Intronic
1124595168 15:31086206-31086228 ATGGGGCATCAGACCAGGCTGGG + Intronic
1128065065 15:64759343-64759365 CTGGGTGACCTGGGCAGCCTGGG - Intronic
1128486455 15:68095382-68095404 ATGGGGCATGTGGTCATCATGGG + Intronic
1128877302 15:71212917-71212939 ATGTGCCATCTGGGCAGCATGGG + Intronic
1129394696 15:75237509-75237531 ATGGAGCAGCTGGGAAGCCACGG - Intergenic
1129708287 15:77807004-77807026 CAGGCCCATCTGGGCAGCCTCGG + Intronic
1131536945 15:93245435-93245457 GTGCGGAATCTGGGCAGCCTTGG + Intergenic
1132688012 16:1170328-1170350 ATGGGGCAGCAGGGCTCCCTGGG + Intronic
1132840143 16:1974885-1974907 ATGGGTGAGCTGTGCAGCCTGGG - Intronic
1133733426 16:8595536-8595558 ATGGGTCATCAGGGAAACCTGGG + Intergenic
1135894088 16:26382832-26382854 ATGGGGCATCAGTGAGGCCTGGG + Intergenic
1136640740 16:31563254-31563276 ATAGGCCATCTGGGCGGCCACGG + Intergenic
1137673114 16:50290989-50291011 CTGGGGCCTCTGGACAGCTTCGG + Intronic
1138423544 16:56915425-56915447 GTGGGGCTTCAGAGCAGCCTGGG - Exonic
1138556202 16:57772557-57772579 AGGGGGCATCGGGGTGGCCTTGG - Intronic
1138595325 16:58026450-58026472 CTGGTGCTTCTGGGCTGCCTGGG + Exonic
1139885476 16:70204784-70204806 ATGGGGCAGCTGGCCAGGCAGGG - Intergenic
1141697292 16:85626100-85626122 ATGGGGACCCAGGGCAGCCTGGG + Intronic
1142214927 16:88825516-88825538 CTGGGGTTTCTGGGCAGCCGGGG + Intronic
1143050891 17:4124864-4124886 TTGGGCCATCTGGGGAACCTGGG + Intronic
1144620791 17:16817266-16817288 ATGGACCATCTGGGCAACTTGGG + Intergenic
1144747704 17:17626703-17626725 CTGGGTGAGCTGGGCAGCCTTGG + Intergenic
1144944767 17:18964212-18964234 ACGAGGCATGTGGGCAGCCCTGG - Intronic
1145015192 17:19391918-19391940 ATGGGGCATTGAGGCATCCTGGG - Intergenic
1145263638 17:21369029-21369051 GTGGGGCATCCGGGGAGGCTGGG + Intergenic
1146090356 17:29871124-29871146 ATGGGGCATCTGAGAAGTCACGG + Intronic
1146225696 17:31064347-31064369 ATGGTGTATCTGGGCAGGATAGG - Intergenic
1146846942 17:36188061-36188083 AGGGGGCTTCTGGGGATCCTAGG + Intronic
1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG + Intergenic
1147368403 17:39974570-39974592 TTGGGGCACGTGGCCAGCCTTGG - Intronic
1147572180 17:41578169-41578191 ATGGACCATCTGGGCAACTTGGG + Intergenic
1148117760 17:45187326-45187348 ATGCTGCAGCTGGGCTGCCTGGG - Intergenic
1149553170 17:57555094-57555116 ATGGGTCAGTGGGGCAGCCTGGG - Intronic
1149716680 17:58797382-58797404 ATGGTTCCTCTGGGCAGCATGGG - Intronic
1150113169 17:62520122-62520144 ATGGGGCAGGTCAGCAGCCTGGG + Intronic
1150650468 17:67006579-67006601 ATGGGGTGTCTGGGAAGCCTGGG - Intronic
1152289270 17:79429595-79429617 AGGGGGCACCTGGGGAGCCCAGG + Intronic
1152772581 17:82179380-82179402 CTCCGGCATCTGGGCATCCTTGG - Intronic
1152870822 17:82752180-82752202 CAGGGCCATCTCGGCAGCCTGGG - Exonic
1157394525 18:47330780-47330802 ATGGGGCCAATGGGCAGCCCTGG - Intergenic
1157459719 18:47878924-47878946 AGGGTGTATGTGGGCAGCCTGGG + Intronic
1158724764 18:59960808-59960830 ATGGGGCATCTGGAAAGAATAGG - Intergenic
1159365917 18:67465206-67465228 ACTGGGGATCTGAGCAGCCTAGG - Intergenic
1160503852 18:79416635-79416657 ATGGGGCAACTCGACACCCTCGG - Intronic
1160509178 18:79443797-79443819 CTGGGGTCTCTGGGCAGCCTGGG - Intronic
1161024283 19:2028441-2028463 TTGGGGTCTGTGGGCAGCCTCGG - Intronic
1161077116 19:2291175-2291197 CTGGGCCATCTGCGCAGCCTGGG - Exonic
1163722058 19:18903043-18903065 ATGGGGCATCTGGGCAGCCTGGG - Intronic
1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG + Intronic
1164393443 19:27844717-27844739 TTTGAGCCTCTGGGCAGCCTGGG + Intergenic
1165700548 19:37933791-37933813 GTGACTCATCTGGGCAGCCTGGG + Intronic
1166234233 19:41444036-41444058 CTGGGACAGCTGTGCAGCCTGGG + Exonic
1166292525 19:41872178-41872200 ATTGGGCACCTGGTCAGGCTGGG + Exonic
1166512169 19:43416253-43416275 ATGGGGCATTTGGGCTGGGTAGG + Intronic
1167042702 19:47032143-47032165 TTGGGGTATCTGGGCACCCATGG - Intronic
1167515624 19:49921687-49921709 AGGGGGCACCTAGGGAGCCTAGG + Intronic
1167891450 19:52543004-52543026 AGGGGGCATCAGTGCAGCCCAGG + Intronic
1168241559 19:55091571-55091593 AAGGGTCAGCTGGGCAGCCCTGG + Intronic
926296778 2:11574585-11574607 AGGGGGCATTGGGGCAGCCTCGG + Intronic
926305643 2:11635782-11635804 ATGTGTCCACTGGGCAGCCTCGG + Intronic
928169201 2:28992469-28992491 AGGGGGAACCTGGGCTGCCTTGG + Intronic
932736678 2:74259434-74259456 GTGGGGACTCTGGGCTGCCTGGG - Intronic
933305014 2:80586871-80586893 AAGAAGCATCTGGGCAGCCACGG + Intronic
933599678 2:84316883-84316905 ATGGTGCAACTGGGCATACTTGG - Intergenic
936507046 2:113116255-113116277 GTTGGGCATTGGGGCAGCCTGGG - Intronic
937158141 2:119735820-119735842 ATGGGGCCGCTGGGAGGCCTTGG - Intergenic
937200530 2:120201407-120201429 ATGGAGCTACTGGACAGCCTAGG + Intergenic
938072224 2:128314789-128314811 GTGTGGCATCTGGGCCACCTTGG - Intronic
938244665 2:129767319-129767341 AGGGGGAAGCTGGGCTGCCTGGG - Intergenic
938685051 2:133730065-133730087 ATGTGGCATCTGGGCTGCCTAGG + Intergenic
938825977 2:135005812-135005834 TTGGGGCAGCTTAGCAGCCTGGG - Intronic
940299233 2:152160711-152160733 ATGGGGCAGCTGGCCAGGCGGGG - Intronic
941015079 2:160346341-160346363 ATGGGGCCCTGGGGCAGCCTGGG + Intronic
947715495 2:232336988-232337010 AGGGCGCCTCTGGGAAGCCTGGG + Exonic
948236595 2:236395297-236395319 AGGAGGCAGCTGGGAAGCCTGGG + Intronic
948607734 2:239146759-239146781 GTGGGGGGTCAGGGCAGCCTTGG - Intronic
948632921 2:239313426-239313448 AGCGGGCTCCTGGGCAGCCTGGG - Intronic
948686784 2:239675135-239675157 ATGGGGCATCAGAGGAGCCTTGG + Intergenic
949017256 2:241720441-241720463 ACGGAGCATCTGTGCAGTCTAGG - Intronic
1169141011 20:3227634-3227656 CTGGGGCATCTGGGCATTGTAGG - Exonic
1170042506 20:12053237-12053259 ATGTGGCCTCTGTGCAGCCTAGG + Intergenic
1170759868 20:19239833-19239855 AGGGGCCCTGTGGGCAGCCTTGG + Intronic
1172016668 20:31879687-31879709 ATTGGGCGTCCTGGCAGCCTAGG - Intronic
1172501775 20:35432873-35432895 CTGGGGAATCTGGGCTGCCAAGG - Intergenic
1173936487 20:46870589-46870611 AGGGGGCATATAGGCTGCCTGGG - Intergenic
1174324303 20:49767021-49767043 TTTGGGCATCTGAGCATCCTGGG - Intergenic
1175187885 20:57190895-57190917 AGTGGGCATCGGGGCTGCCTCGG + Intronic
1175203320 20:57292480-57292502 GTGGGGGATCTGAGCAGTCTAGG + Intergenic
1175665149 20:60852371-60852393 ATGGTGCATCTCATCAGCCTGGG - Intergenic
1175778601 20:61668336-61668358 CTGCGGCTTCGGGGCAGCCTGGG - Intronic
1175828543 20:61950180-61950202 CTGGGGTATTGGGGCAGCCTGGG - Intergenic
1175923854 20:62462567-62462589 ATGTGGCATCCGGGCACCATTGG - Intergenic
1176221980 20:63974069-63974091 AGAGGGCGTCTGGGCAGCCGCGG - Intronic
1178431255 21:32520528-32520550 ATCTGGCATCTGGGGAGTCTTGG + Intergenic
1180929427 22:19578908-19578930 AAGTGGCATCTGAGCAGACTTGG - Intergenic
1180970012 22:19810413-19810435 GTGGGGCATCAGGGCTGCCCTGG - Intronic
1180979156 22:19870627-19870649 ATGGGTCTTCTGGGCAACCCTGG - Intergenic
1181587454 22:23861345-23861367 ATGAGGCATCAGGGATGCCTTGG + Intronic
1181734451 22:24870704-24870726 ATGGGGCATATTGGAAGCATCGG + Intronic
1181759663 22:25049438-25049460 GTGGAGCATCTGGACAGCCCAGG + Intronic
1181766908 22:25098792-25098814 ATGGGGCAGCCAGGCAGCCCTGG - Intronic
1183123066 22:35746345-35746367 ATCGGGCATCTTGCCAGCCTGGG - Intronic
1183548051 22:38465829-38465851 AGGAGGCATCTGGGCAGGGTTGG + Intergenic
1184566769 22:45296731-45296753 AGGGGGCATCAGGTCAGCCTGGG + Intergenic
949592773 3:5510881-5510903 CTGAGGAATCTGGGCAGCCCAGG + Intergenic
949658632 3:6251444-6251466 ATGGTGCCTCTGGGGATCCTTGG - Intergenic
949753290 3:7379281-7379303 ATGGGCAAGCTGGGCAACCTGGG - Intronic
950028765 3:9838142-9838164 CAAGGGCAGCTGGGCAGCCTGGG + Exonic
950447676 3:13047629-13047651 CTGGGGCAACTGAGCAGCCCTGG + Intronic
951529278 3:23683664-23683686 ATGGAATATCTGGGCAGCCAGGG - Intergenic
952495237 3:33909990-33910012 ATGGGGCTGCTGGGGAGACTTGG + Intergenic
952996024 3:38883184-38883206 ATTGGGCATCAGGGCAGCTGGGG - Intronic
953062580 3:39439469-39439491 GTGGGCCATCTGAGCAGGCTTGG - Intergenic
953370460 3:42383303-42383325 CTGGGGAACATGGGCAGCCTAGG + Intergenic
953573949 3:44097946-44097968 ATGGGCTATGTGGGCAGCCCCGG + Intergenic
953610852 3:44446097-44446119 AGGGGGCATTTGGGAAGGCTAGG + Exonic
953907637 3:46876258-46876280 ATGGGGCCTGTGGGCAGGGTAGG + Intronic
954913769 3:54131552-54131574 ATGTGGCACCTGGGAAGCCTTGG + Intronic
956887329 3:73573315-73573337 ATGTGGCATCTGGGAAGACGAGG + Intronic
957157201 3:76559680-76559702 ATGGGGCACCTGTGCACCTTTGG + Intronic
960547593 3:118934226-118934248 AGGAGGTATCTGGGAAGCCTAGG - Intronic
961163751 3:124750235-124750257 ATGGGGCAGCTGGCCAGGCGGGG + Intergenic
961387063 3:126528690-126528712 AAGGGGGATCTGGGCAGACTGGG + Intronic
962909120 3:139831740-139831762 CTGGGACAACTGGGCACCCTAGG - Intergenic
964814336 3:160700914-160700936 ATAGGGCAGCTGGGGAGCTTGGG - Intergenic
968135708 3:196218019-196218041 CTGGTGCACCTGGGCAGCCGGGG + Intronic
968720437 4:2198636-2198658 CCGGGGCATCTGGACAGCCATGG + Exonic
971580587 4:28334502-28334524 AAGGGGCAAATGTGCAGCCTTGG + Intergenic
981938839 4:150260597-150260619 ATGGGGCACCTGCCCTGCCTGGG - Intergenic
982037035 4:151355973-151355995 ATAGACAATCTGGGCAGCCTTGG - Intergenic
983500342 4:168492750-168492772 ATGGTCCATCTGGGGATCCTGGG - Intronic
985017397 4:185650984-185651006 TGGGGTCCTCTGGGCAGCCTGGG - Intronic
985609188 5:877247-877269 GTGGGGCCTCTGCCCAGCCTGGG - Intronic
985933888 5:3080057-3080079 CTGGGCCATCTGGGCCGTCTTGG - Intergenic
986008008 5:3684234-3684256 GTGGGTCATCTGGGCGCCCTCGG + Intergenic
986285962 5:6359213-6359235 AGAGGGCATCTGGTCTGCCTGGG + Intergenic
986443030 5:7797974-7797996 ATGGGGCATCTGGGCACACAGGG + Intronic
988216896 5:28286801-28286823 AGGGGCCATCTGGGCTTCCTGGG + Intergenic
989178783 5:38556398-38556420 CTGTGGGATCTGGGCAGCCCCGG - Intronic
990999358 5:61767394-61767416 ATGAGGCAGCTGGGCAGTTTTGG + Intergenic
991938526 5:71827692-71827714 ATGAGGCCTTTGGGCAGGCTAGG + Intergenic
992114017 5:73522391-73522413 AAGGAGAAGCTGGGCAGCCTTGG + Intergenic
992556848 5:77912224-77912246 ATGGGTCAACTGGGCAGCCTCGG + Intergenic
992728379 5:79632690-79632712 ATGGAGCTTCTTGGCATCCTTGG + Intronic
992850427 5:80801607-80801629 ATGGTGAACCTGGGCAGACTTGG - Intronic
994843127 5:104951607-104951629 CTGAGGAATCTGGGCAGCCCAGG - Intergenic
995355795 5:111236568-111236590 CTGAGGCATCTGTGCAGCCAAGG - Intronic
997506945 5:134425192-134425214 TGGGGGCATCTGGGCACCATAGG + Intergenic
998232637 5:140371016-140371038 CTAGGGCATCTGGGCATCCTGGG + Intronic
998603867 5:143614028-143614050 AAGGGGCATATGGTCAACCTTGG - Intergenic
1000296543 5:159917256-159917278 CTGTGACATCTGGGCAGCCGTGG + Exonic
1001568197 5:172713991-172714013 CAGGGGGCTCTGGGCAGCCTGGG - Intergenic
1002341053 5:178516764-178516786 AAGGAGCATCTGGGGAGCCTGGG - Intronic
1002481808 5:179506271-179506293 ATGGGGTTTCTGGGCTGCTTTGG + Intergenic
1003507364 6:6751026-6751048 ATGGTGCCTATGGACAGCCTGGG - Intergenic
1006436417 6:34028011-34028033 ATGGGGCATCGGGGCAGGGCGGG + Intronic
1008595325 6:53035996-53036018 ATGTGGCATCTGTGCAGGCAAGG + Intronic
1012132866 6:95519024-95519046 GTGGGGCAGCTGCCCAGCCTAGG + Intergenic
1017164135 6:151391455-151391477 GAGGCGCCTCTGGGCAGCCTCGG + Exonic
1018352053 6:162970217-162970239 AGGTGGCATCTGCACAGCCTGGG - Intronic
1019715901 7:2539222-2539244 ATGGGGCAGCTGTCCAGCCAGGG - Exonic
1020509048 7:9029671-9029693 CTGGGCCATCTGTGCAACCTAGG + Intergenic
1021819968 7:24487146-24487168 ATGGGTCACCTGGGCAGGGTAGG - Intergenic
1021993483 7:26158255-26158277 AAGGGAAATCTGGCCAGCCTGGG - Intronic
1024020301 7:45362362-45362384 GTGAAGCATCTGGGCAGGCTTGG + Intergenic
1029211157 7:98909405-98909427 GTGAAGCATCTGGGGAGCCTGGG - Intronic
1029818266 7:103119698-103119720 ATGGGGCAGCTGGTCTGTCTTGG - Exonic
1032042383 7:128574059-128574081 ATGGGGCAGGTCAGCAGCCTGGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033832427 7:145270135-145270157 AAGGGGCAGACGGGCAGCCTGGG - Intergenic
1034270873 7:149802957-149802979 ATGGGCCATGTGGGAGGCCTGGG + Intergenic
1035253239 7:157610944-157610966 ATGCTGCATCTGGGCAGACTGGG + Intronic
1035314686 7:157990590-157990612 ATGGGGGAGCAGGGCAGGCTGGG + Intronic
1035341825 7:158167076-158167098 TGGGGGCCTCTGGGCAGCATAGG + Exonic
1036579237 8:10057225-10057247 AGGGGGCATCTGGGCAGTGCTGG + Intronic
1040311170 8:46237594-46237616 ATGGGGCATCAGGGTAACTTGGG + Intergenic
1044868347 8:96594353-96594375 CTGGGGCAGCTGAGCAGACTTGG + Intronic
1046007870 8:108507828-108507850 ATGGAGCATTTGGAGAGCCTGGG - Intergenic
1047219747 8:122909912-122909934 GAGGGGCAACTGGGCAACCTGGG - Intronic
1047778541 8:128092982-128093004 AAGAGGCATCTGGGCAGGATGGG - Intergenic
1048257273 8:132914630-132914652 ATGGGGCATCTGTCATGCCTGGG + Intronic
1048360601 8:133694170-133694192 ATGGGGTTTCAGGGAAGCCTGGG + Intergenic
1049625340 8:143617370-143617392 GAGGGGCATGGGGGCAGCCTGGG - Intronic
1051280896 9:15442039-15442061 ATGGGGCAGCTGGCCAGGCAGGG + Intronic
1053100818 9:35370954-35370976 ATGGGGCTTCTGGTCATCCTGGG - Intronic
1053803815 9:41780387-41780409 GTGGGGAACCTGGGGAGCCTAGG + Intergenic
1054141454 9:61534733-61534755 GTGGGGAACCTGGGGAGCCTAGG - Intergenic
1054192115 9:61991782-61991804 GTGGGGAACCTGGGGAGCCTAGG + Intergenic
1054646264 9:67596008-67596030 GTGGGGAACCTGGGGAGCCTAGG - Intergenic
1054756541 9:68964517-68964539 ATGGGGAGTCAGGTCAGCCTGGG - Intronic
1055554760 9:77462863-77462885 ACTGGGCATCTGGGGACCCTGGG - Intronic
1056796681 9:89663412-89663434 GTGGGCCATCTGGGCACCTTGGG + Intergenic
1058445368 9:105050329-105050351 ATGGGGCAACTGGGACCCCTGGG - Intergenic
1059084869 9:111289268-111289290 AAGGTCCTTCTGGGCAGCCTCGG - Intergenic
1059735622 9:117096890-117096912 ATGGGCCATGTGGGCAGTCAGGG + Intronic
1060754747 9:126204394-126204416 AGGGCGCCTCTCGGCAGCCTTGG - Intergenic
1060921726 9:127425071-127425093 TTGGTCCATCTGGGCAGACTGGG - Intronic
1061623655 9:131827755-131827777 GTGGGGCAGCACGGCAGCCTGGG + Intergenic
1062016078 9:134292036-134292058 AAGGGGCAGGAGGGCAGCCTGGG + Intergenic
1062526694 9:136980703-136980725 ATGGGGGATCTGTGCAGTTTGGG + Intronic
1185645309 X:1611366-1611388 ATGTGTCATCTGGGCAGTTTGGG - Intergenic
1190795646 X:53738528-53738550 TGGGGGCATCTGGCCATCCTTGG + Intergenic
1192026393 X:67457015-67457037 CTCAGGAATCTGGGCAGCCTAGG + Intergenic
1193330845 X:80233818-80233840 CCGGGGCATGTCGGCAGCCTCGG - Intergenic
1194369743 X:93058084-93058106 ATGGGGCATAAGGGCAGGATGGG - Intergenic
1195355978 X:104040269-104040291 ATGGGCCAGCTGACCAGCCTCGG - Exonic
1196083166 X:111655109-111655131 TGGGGGCCTCTGGGCAGCATAGG + Intergenic
1196272552 X:113729594-113729616 ATGCTGTATCTGGGCAACCTGGG - Intergenic
1197749730 X:129956426-129956448 TTGGGCTCTCTGGGCAGCCTCGG + Intergenic
1201392516 Y:13513421-13513443 TTGTGGCACCTGTGCAGCCTAGG - Intergenic