ID: 1163723716

View in Genome Browser
Species Human (GRCh38)
Location 19:18910784-18910806
Sequence CCTGCACAGCAGTGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 404}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163723716_1163723731 18 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723731 19:18910825-18910847 AAAGCAGCAGGGGAGCAGAGGGG 0: 1
1: 0
2: 12
3: 74
4: 671
1163723716_1163723725 -8 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723725 19:18910799-18910821 TGTGCAGGTGAGGGAAACTGAGG 0: 1
1: 3
2: 10
3: 102
4: 535
1163723716_1163723729 16 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723729 19:18910823-18910845 ACAAAGCAGCAGGGGAGCAGAGG 0: 1
1: 0
2: 11
3: 192
4: 876
1163723716_1163723727 7 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723727 19:18910814-18910836 AACTGAGGCACAAAGCAGCAGGG 0: 1
1: 4
2: 15
3: 67
4: 565
1163723716_1163723728 8 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723728 19:18910815-18910837 ACTGAGGCACAAAGCAGCAGGGG 0: 1
1: 0
2: 1
3: 57
4: 374
1163723716_1163723732 23 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723732 19:18910830-18910852 AGCAGGGGAGCAGAGGGGAGAGG 0: 1
1: 0
2: 61
3: 863
4: 5472
1163723716_1163723730 17 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723730 19:18910824-18910846 CAAAGCAGCAGGGGAGCAGAGGG 0: 1
1: 0
2: 4
3: 102
4: 1198
1163723716_1163723726 6 Left 1163723716 19:18910784-18910806 CCAGCCCCCCACTGCTGTGCAGG 0: 1
1: 0
2: 1
3: 44
4: 404
Right 1163723726 19:18910813-18910835 AAACTGAGGCACAAAGCAGCAGG 0: 1
1: 0
2: 16
3: 89
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163723716 Original CRISPR CCTGCACAGCAGTGGGGGGC TGG (reversed) Intronic
900002368 1:21764-21786 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
900022087 1:192288-192310 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
900220089 1:1503762-1503784 CATGGGCAGCAGTGGGGTGCAGG + Intergenic
900244740 1:1631816-1631838 ACTGCCCAGCAGTGGGGGCTTGG + Intergenic
900339117 1:2179511-2179533 CTTTCACATCAGTGGGGAGCTGG - Intronic
900513389 1:3070512-3070534 CCTGCAGAGGAGGGGGCGGCGGG - Intronic
901068177 1:6504464-6504486 CCTCCTCCACAGTGGGGGGCTGG + Intronic
901198731 1:7454713-7454735 CCTGGACAGCAGTGCTGGGCGGG + Intronic
901204493 1:7486181-7486203 CCTGCAAAGCAGTGGTATGCTGG + Intronic
901506505 1:9689166-9689188 CCTGCAAAGCAAGGGAGGGCTGG - Intronic
901513589 1:9730672-9730694 CCAGCACAGCAGTGAGGAGGAGG - Exonic
902629703 1:17697299-17697321 TCTGGGCAGCAGTGGGAGGCAGG + Exonic
903907757 1:26697638-26697660 GCTCCCCAGCAGTGGGGGCCCGG - Intronic
904670169 1:32158676-32158698 CCTTCCCAGTAGTGGGGGACTGG - Intronic
905170351 1:36106390-36106412 CCTGCACAGGAGAGTGGGGATGG - Intronic
905329954 1:37187542-37187564 CCTGCACAGCAGTGAGTGGGTGG - Intergenic
905745628 1:40415004-40415026 TCAGCACCACAGTGGGGGGCTGG - Intronic
906067875 1:42995164-42995186 CCTGCACAGGACATGGGGGCCGG + Intergenic
906082487 1:43102350-43102372 GCTGCACAGAAGTGGGGAGGGGG + Intergenic
906447689 1:45917512-45917534 CCTCCACGGCAGTGGGCGGCTGG - Intronic
907298145 1:53468702-53468724 CCAGTACAGCAGGGTGGGGCTGG + Intergenic
911121905 1:94304611-94304633 GCTTCACAGCAGTGGAGAGCAGG + Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
913647327 1:120871008-120871030 CCTGCTCTGTGGTGGGGGGCTGG - Intergenic
914079317 1:144391852-144391874 CCTGCTCTGTGGTGGGGGGCTGG + Intergenic
914099862 1:144574650-144574672 CCTGCTCTGTGGTGGGGGGCTGG - Intergenic
914174218 1:145260399-145260421 CCTGCTCTGTGGTGGGGGGCTGG + Intergenic
914221505 1:145686247-145686269 ACTGGACAGCAGTGGGGGTGGGG - Intronic
914474068 1:148009116-148009138 ACTGGACAGCAGTGGGGGTGGGG - Intergenic
914528882 1:148501583-148501605 CCTGCTCTGTGGTGGGGGGCTGG + Intergenic
914637511 1:149565525-149565547 CCTGCTCTGTGGTGGGGGGCTGG - Intergenic
914803291 1:150975170-150975192 GCCGCACAGCAGTTGGGGGTGGG - Intergenic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
915216596 1:154344585-154344607 CCAGAACGGCAGTGGGGAGCAGG - Intronic
915290128 1:154877951-154877973 CCTACACCACAGTGTGGGGCTGG - Intergenic
918121552 1:181545460-181545482 CCTGCAGGGCTGTGGGGGGATGG + Intronic
918669702 1:187200108-187200130 GCTGCACATCAGTGGTGGACTGG + Intergenic
919701835 1:200638958-200638980 CCTGCATAGGAGTGGAGTGCGGG + Intronic
919872002 1:201829101-201829123 CCTGCGCACCAGAGGCGGGCGGG - Intergenic
919980086 1:202637561-202637583 CCAGCCGAGCAGTGGGGAGCAGG + Intronic
920251200 1:204623529-204623551 CATGCTCAGCAGTGAGGGGGTGG - Intronic
922725481 1:227921053-227921075 CCTGCACAGCAGGGTTGGCCAGG + Exonic
922733967 1:227969774-227969796 CCTACACAGCACTTGGAGGCAGG - Intergenic
1064104356 10:12488903-12488925 GCTGCACAGCAGGAGGGGGACGG - Intronic
1064461030 10:15535119-15535141 CCAGCACAGCACCGGTGGGCCGG - Intronic
1065094068 10:22263553-22263575 CCTGCCCAGCACTGGGTGGCAGG - Intergenic
1066127341 10:32354711-32354733 ACAGCACAGAAGTGGGTGGCAGG + Intronic
1066362973 10:34748762-34748784 CCTGCACTGCAGCAGGGAGCGGG - Intronic
1066573752 10:36802649-36802671 CATGCACAGAAGTGTGTGGCTGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1069869636 10:71525458-71525480 TCTGCACAACAGTGGGAAGCTGG + Intronic
1072606226 10:96984940-96984962 CCTGCAAAACAGAAGGGGGCCGG + Exonic
1073102121 10:101011906-101011928 GCAGGTCAGCAGTGGGGGGCGGG - Intronic
1073327381 10:102650613-102650635 CATGCACTGCTGTGGGGGGATGG + Intronic
1074317167 10:112370508-112370530 CCAGCACAGCACTGGTGGGCCGG - Intergenic
1074983932 10:118641237-118641259 CCAGCCCAGCTGTGGGAGGCTGG - Intergenic
1075003113 10:118812306-118812328 CCTGCAGAGCAGTGGGGTGAGGG + Intergenic
1075488882 10:122849314-122849336 CCTTCACAGCACTGCAGGGCAGG + Exonic
1075731705 10:124640295-124640317 CCTGCACAGCTCTGCGCGGCAGG + Intronic
1076323688 10:129603936-129603958 CCTCCTGAGCAGTGGAGGGCTGG + Intronic
1076701839 10:132277338-132277360 CCCGCACAGGAATGGTGGGCTGG - Intronic
1076783187 10:132735726-132735748 TCTCCACAGCAATGGGAGGCCGG + Intronic
1077185177 11:1232559-1232581 CCTGCCCAGGCGTGGGGGTCTGG - Intronic
1077496359 11:2888444-2888466 CTTGCACACAAGTGGGCGGCGGG + Exonic
1077713650 11:4559671-4559693 CCAGCACAGCAGTGTGGAGTCGG + Intergenic
1081464163 11:43300915-43300937 CCTGCACTGCAATGGGCAGCAGG + Intergenic
1082003486 11:47407615-47407637 CCTGAACAGCAGTGGGAGTCTGG - Intronic
1083269979 11:61567340-61567362 CTTGGACAGCTCTGGGGGGCGGG - Intronic
1083887712 11:65580970-65580992 CCTGCACTGTAGTTGGGGGAGGG + Intronic
1084520174 11:69657964-69657986 TCTGCCCAGCATTGGGGGCCTGG + Intronic
1087212170 11:95455610-95455632 GCTGCACAGCAGTGGGGCTGAGG + Intergenic
1087917904 11:103831545-103831567 CCAGCAAAGCAGTAGGGGGTTGG - Intergenic
1089270651 11:117299592-117299614 CCAGGCCAGGAGTGGGGGGCTGG - Intronic
1089762874 11:120741053-120741075 ACAGCACAGCAGTGGGGTTCTGG - Intronic
1089878220 11:121746548-121746570 CCTGCAAAGCTGTGGGGGTAGGG + Intergenic
1090202488 11:124866301-124866323 CCGGCAGAGCTGTGGCGGGCGGG + Intronic
1090413274 11:126523517-126523539 CCTGCACAGCTGGGGAGGACAGG - Intronic
1090666209 11:128916613-128916635 GCCCCCCAGCAGTGGGGGGCTGG - Exonic
1091375786 12:23826-23848 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
1091380732 12:56859-56881 CCTGGACAGCATTGTGGGGTAGG + Intergenic
1092280204 12:7092463-7092485 CATGCACAGCAGGGAGGGGAGGG + Intronic
1092351502 12:7759765-7759787 GCTGCTCAGGAGTGGGAGGCAGG - Intergenic
1093415587 12:18916835-18916857 GCTGCAAAGGAGTGGGTGGCTGG - Intergenic
1094043898 12:26146147-26146169 CCTGCATAGCAAAGTGGGGCAGG + Intronic
1097512797 12:60564988-60565010 CATGCACACCAGTGGGGAACTGG + Intergenic
1100242234 12:92721324-92721346 CCTGCTCAGCAGTGGGGTTGGGG + Intergenic
1101941514 12:109102552-109102574 CCTGAGCAACAGTGGGGGTCTGG + Intronic
1104485699 12:129149744-129149766 GCTGCCCAACACTGGGGGGCTGG + Intronic
1104935283 12:132361126-132361148 GCTGCACAGCCCTGGGGGTCAGG + Intergenic
1105547451 13:21361271-21361293 CCTGCACAGCCCTGGGGTGCAGG - Intergenic
1106187672 13:27423645-27423667 CCTGCACAGCAGTGCAGTTCTGG - Intergenic
1107021397 13:35756143-35756165 TCTGCATCCCAGTGGGGGGCCGG - Intergenic
1107481615 13:40789982-40790004 GCTGCCCAGGAGTGGGCGGCTGG + Intronic
1108447854 13:50527236-50527258 CCTGCACAGAACAGGAGGGCGGG - Intronic
1108603223 13:52012186-52012208 GCGGGACAGCAGTGGGGGGTTGG - Intergenic
1109416403 13:62046569-62046591 CCTGCAGAGCAGGGGAGGGTGGG + Intergenic
1112922296 13:104628811-104628833 CCTACAAAGCAGAGGGGGGGGGG - Intergenic
1113443133 13:110345436-110345458 CCTGGGAAGCAGTGGGGTGCAGG + Intronic
1113551999 13:111199842-111199864 ACTGGACAGCAGTGGGGAACGGG + Intronic
1113799953 13:113081095-113081117 CCTGCCCAGCAGGAGGGGACTGG - Intronic
1113866041 13:113525213-113525235 CCTGTACAGCAGTGGTCGGGTGG + Intronic
1114065123 14:19053798-19053820 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
1114097140 14:19346204-19346226 TCTGCACTGCTGTTGGGGGCAGG - Intergenic
1114563397 14:23609808-23609830 CATACACAGCAGTCGGGGCCTGG - Intergenic
1116767714 14:49092432-49092454 CCAGCACAGCAGCTGGGGGATGG + Intergenic
1117971304 14:61253505-61253527 CCTTCACTGGGGTGGGGGGCAGG + Intronic
1118990097 14:70790165-70790187 CCTGAGCAGCAGTGGGGGAAGGG + Intronic
1119261341 14:73239866-73239888 CCTGCAGGGGAGTCGGGGGCGGG + Intronic
1119491268 14:75035750-75035772 CCTGAGCAGCAGTGGAGGGCTGG - Intronic
1121425895 14:93851848-93851870 CTTGCAGAGAAGTGGTGGGCAGG - Intergenic
1122146279 14:99690826-99690848 CTGGCACAGAAGTTGGGGGCTGG - Intronic
1122716249 14:103698539-103698561 CCAGCTCAGCAGTGGGGACCAGG + Exonic
1122873225 14:104650929-104650951 CCTGCACTGGAGTGGGACGCAGG - Intergenic
1122945360 14:105006161-105006183 CCTGCCCCTCAGTGGGTGGCTGG + Intronic
1122995433 14:105261363-105261385 ATGGCACAGCAGTGGGGTGCAGG - Intronic
1122996749 14:105269225-105269247 CCGGCAAAGCAGGGGTGGGCTGG + Intronic
1123008931 14:105337961-105337983 CATGCACAGGAGTGGGTGGGTGG + Intronic
1123994689 15:25710279-25710301 CCTGCCCAGCAGGGGGCGCCGGG - Intronic
1124495699 15:30185606-30185628 CCAGCCGAGCAGTGGGGAGCAGG + Intergenic
1124632478 15:31345451-31345473 CCTGGAGAGCACTGGGGTGCGGG + Intronic
1124650267 15:31469135-31469157 CCTGGGCAGAAGTCGGGGGCGGG - Intergenic
1124747874 15:32353040-32353062 CCAGCCGAGCAGTGGGGAGCAGG - Intergenic
1125085342 15:35723294-35723316 GCTGGACAGCAGTGGGATGCTGG + Intergenic
1126541219 15:49826292-49826314 CCTGTCGAGGAGTGGGGGGCTGG - Intergenic
1126878580 15:53070593-53070615 CTTTCACAGATGTGGGGGGCTGG + Intergenic
1127626612 15:60786465-60786487 CTTGCACAGCAGGAGTGGGCTGG + Intronic
1128280130 15:66387384-66387406 ACTGCAGAGCCGTCGGGGGCCGG - Exonic
1129559685 15:76553093-76553115 CCAGCATAGCAGTAGGGGGTGGG - Intronic
1129676252 15:77633602-77633624 CCTGTCCAGCAGAGGGCGGCAGG + Intronic
1130325014 15:82872778-82872800 CATGCACAGCAGAGGTGGCCTGG + Intronic
1130353166 15:83108548-83108570 CCTGCAGTGGAGTGGGAGGCAGG - Intronic
1132141737 15:99402691-99402713 CCTGCTCCGCACTGGGGGCCTGG - Intergenic
1132451144 15:101969175-101969197 CCTGCACAGGGGTGGGAGGGGGG + Intergenic
1132639173 16:970006-970028 CCCGCACAGCTGTGGGGTGAAGG + Intronic
1132772632 16:1572814-1572836 CCTGCCCAGCAGTGGGTTGGGGG + Intronic
1132901205 16:2255477-2255499 CCCGCACAGCAGTGGAAGGCAGG + Intronic
1133019968 16:2963081-2963103 CCAGCACCGCAGTGGGTGCCTGG + Intergenic
1133201055 16:4204696-4204718 CCGGCACAGCAGACGAGGGCTGG + Intronic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1133230022 16:4361999-4362021 GCTGCTCAGCAGCGGGGGACAGG - Exonic
1133237186 16:4392781-4392803 CCTGGGCGGAAGTGGGGGGCAGG + Intronic
1134225378 16:12385913-12385935 CCTGCACAGTGGTGGGGGTGAGG + Intronic
1135407176 16:22206697-22206719 CCGGCAAGGCTGTGGGGGGCTGG + Intronic
1135814069 16:25615987-25616009 GCGGCACAGCAGTGGTGGGTTGG + Intergenic
1136282310 16:29221028-29221050 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1136926605 16:34380856-34380878 GCTCCACAGCAGTGGGGTGTGGG + Intergenic
1136977969 16:35030951-35030973 GCTCCACAGCAGTGGGGTGTGGG - Intergenic
1137551017 16:49437664-49437686 CCTGCAGAAAAGTGGGGGGAAGG - Intergenic
1137718055 16:50611042-50611064 CCTGCCCAGCTGTGGGGGCAGGG - Intronic
1138715866 16:59021505-59021527 CCTCCCCAGCAGGGAGGGGCTGG + Intergenic
1139650164 16:68358226-68358248 CCTGTCCTGCAGTTGGGGGCAGG + Exonic
1141636241 16:85315412-85315434 CCTGCAGAGCCCTGGGGGTCAGG + Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141949832 16:87333331-87333353 CCGGCACAGCAGAGGCAGGCAGG + Intronic
1142029278 16:87830519-87830541 CCAGCACAGCAGGAGGGGGAGGG + Exonic
1142086682 16:88186946-88186968 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1142105230 16:88299063-88299085 CCTGCAAGCCAATGGGGGGCAGG + Intergenic
1142287461 16:89177216-89177238 ACAGCCCTGCAGTGGGGGGCTGG + Intronic
1142874536 17:2843636-2843658 CCTGCAAGGTAGTGGGAGGCAGG - Intronic
1142875404 17:2849319-2849341 TCTGCCCAGCAGTGGGGCGCTGG + Intronic
1143658367 17:8310610-8310632 CCTGCACAGCTGTGTGGATCGGG - Intronic
1144804661 17:17956668-17956690 CCAGCACAGCACTGGCGGGCCGG + Intronic
1147155365 17:38542076-38542098 GCTGCAGAGCAGTGGGGGAGGGG + Intronic
1147263808 17:39223588-39223610 CCTGCTCAGCTGTGTGGGGAGGG - Intronic
1147538457 17:41335715-41335737 TCTGCACAGCAGGGAGGGGTGGG + Intergenic
1148621169 17:49035777-49035799 CCAGCAAAGTGGTGGGGGGCGGG - Intronic
1148742278 17:49899487-49899509 CCTGGACTGCAGTGGAGGGCGGG + Intergenic
1150284777 17:63948610-63948632 CCTGCTCAGCAGTGGGGCTCTGG - Exonic
1151239896 17:72749611-72749633 CCTGGGCAGCAGAGGTGGGCAGG + Intronic
1151471115 17:74318337-74318359 CCGGTACACCAGTGGGAGGCAGG + Intergenic
1151903882 17:77035277-77035299 TCTGCACAGCACAGTGGGGCAGG - Intergenic
1152209173 17:78994045-78994067 CCTGGAGAGCAGGGAGGGGCGGG - Intronic
1152229080 17:79105755-79105777 CCTGCGCAGCAGAGGTGGGGTGG + Intronic
1152352460 17:79791325-79791347 ACTTCACAGCAGTGGGGGCGGGG - Intergenic
1152468709 17:80478902-80478924 CCTGCACAACAGTTGCAGGCTGG - Intergenic
1152697260 17:81803582-81803604 CCTGCAGAGCAGACGGGGGCTGG - Intergenic
1152720870 17:81923313-81923335 CCTGGACAGCAGGCTGGGGCGGG - Intronic
1153255933 18:3171318-3171340 CTTGCACAGCGCTGGGAGGCTGG + Intronic
1153567009 18:6428874-6428896 CCTGCACAGCAATGGGGCCAAGG + Intergenic
1153687594 18:7562100-7562122 CATGCACAGCAGTGGGGCCTCGG - Intergenic
1157572420 18:48721765-48721787 CCTGCACAGGAGTGAGTGTCAGG - Intronic
1157574909 18:48737053-48737075 TCTGCACAGCAGTGGGGCACAGG - Intronic
1157613929 18:48975938-48975960 CGCGCCCAGGAGTGGGGGGCGGG + Intergenic
1158150065 18:54357867-54357889 CATGCGCGGCAGTGGGGCGCCGG - Exonic
1160605709 18:80048197-80048219 CCTCCACAGCACTGCCGGGCTGG + Intronic
1160634120 19:63372-63394 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
1160901088 19:1429079-1429101 CATGCACAGCAGAGGTGGGGAGG - Intronic
1160980165 19:1812922-1812944 CCTGCACCGCAGGGCGGGGTTGG + Intergenic
1161044519 19:2128121-2128143 CCTTCCCTGCAGTGGGGGCCGGG + Intronic
1161316516 19:3619942-3619964 CCTGCCCAGCAGGGGAGGGCAGG + Intronic
1161852786 19:6746237-6746259 CCTGCCCAGCGGCGGGTGGCGGG + Intronic
1162181380 19:8871422-8871444 CCTGGACTGCAGTGGGGGCTGGG + Intronic
1163553821 19:17981695-17981717 CATGAACAGCTGTGGAGGGCGGG - Exonic
1163701673 19:18789537-18789559 CATCCCCAGCAGAGGGGGGCAGG + Intronic
1163723716 19:18910784-18910806 CCTGCACAGCAGTGGGGGGCTGG - Intronic
1163916959 19:20248360-20248382 CCTTTACAGCTGTGGGGGGGTGG - Intergenic
1164158036 19:22608222-22608244 CCTGCCCCGCAGGAGGGGGCTGG - Intergenic
1164243941 19:23414613-23414635 CTTACACAGCAGTGGATGGCAGG - Intergenic
1164654203 19:29909086-29909108 CCTGCACAGCAGGGGTGGTAAGG - Intergenic
1164720158 19:30426014-30426036 CCAGCAGAGCAGTGGTGGGTCGG + Intronic
1165318542 19:35072399-35072421 CCTGCTCAGCAGAGAGAGGCTGG - Intergenic
1166740146 19:45109648-45109670 CCTCCATAGCTGTGGTGGGCTGG - Intronic
1168274459 19:55269428-55269450 TCTGTGCAGCAGTTGGGGGCAGG + Intronic
1168310797 19:55459617-55459639 TCTTCAGAGCAGTGCGGGGCGGG - Intronic
925151515 2:1618441-1618463 GGTGCACAGCAGTGGGTGACAGG - Intergenic
925411671 2:3643246-3643268 CCTCCACAGGAGTGGAGGGAGGG - Intronic
925733499 2:6940980-6941002 CCTGCAGAGCTGGGGGAGGCTGG - Exonic
925829489 2:7880295-7880317 CCTGCACTGCAAGGGAGGGCTGG - Intergenic
925954920 2:8954382-8954404 CCTGCTCAGCCCTGGGGGGCAGG + Intronic
927519196 2:23689020-23689042 CCTGCAGAGCTGTGAGGGGGTGG - Intronic
927618619 2:24627180-24627202 CATGCACAGTAGTGGGGGTAGGG - Intronic
930027319 2:47037013-47037035 CCTGCACAGTAGGATGGGGCAGG - Intronic
930694649 2:54399120-54399142 CCTTCACAGAAGAGAGGGGCTGG + Intergenic
932214035 2:69954765-69954787 CCAGCACAGGAGTGGGGAGGAGG + Intergenic
932219094 2:69986517-69986539 CCTGCTCAGCACTGCTGGGCTGG - Intergenic
934655851 2:96116559-96116581 CCTGCAGGGGAGTGGGGAGCGGG + Intergenic
936567359 2:113591656-113591678 CCTGCACAGGGGTGGGAGGGGGG + Intergenic
937365424 2:121257505-121257527 CCTGAAGAGCAGCAGGGGGCAGG + Intronic
938123013 2:128646824-128646846 GCTGCACAGGAGTGGGTGGCAGG - Intergenic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
938465451 2:131522010-131522032 TCTGGCCAGGAGTGGGGGGCAGG + Intergenic
938482377 2:131672801-131672823 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
939730218 2:145775156-145775178 CCTACCCACCAGTGGGGGGCAGG + Intergenic
940796866 2:158089498-158089520 CCTGGACAGAAGTTGGGGTCGGG - Intronic
941498811 2:166242501-166242523 CCTGCTCAGCAGTGGTGCCCTGG - Exonic
941788778 2:169527711-169527733 CATGGACAGCAGTTGGGGGATGG - Intergenic
942190572 2:173465082-173465104 CCTGCAAGGCAGTGCGGAGCTGG + Intergenic
942613335 2:177763923-177763945 CTTGCACAGCAGGCGGGTGCAGG - Intronic
942783313 2:179671790-179671812 CCAGCAAAGCAGTGGGGGTGTGG + Intronic
943141895 2:183993210-183993232 TCTGCACAGAAGGGTGGGGCAGG + Intergenic
945674775 2:212842915-212842937 GTTCCACAGCAGTGGGTGGCTGG + Intergenic
946772418 2:223102128-223102150 CCTGCAGTGCAGTAGGGGCCAGG - Intronic
947081443 2:226401331-226401353 ACAGCACAGCAGTGGTGGGGTGG - Intergenic
947260777 2:228219604-228219626 CCTGTACGGGGGTGGGGGGCTGG + Intergenic
947993966 2:234511635-234511657 CCAGCAGAGAAGTGGGAGGCTGG + Intergenic
948167780 2:235876552-235876574 GCCACACAGCACTGGGGGGCTGG - Intronic
948616748 2:239204216-239204238 CCTGCACAGCATGGGGACGCCGG - Intronic
948690083 2:239696518-239696540 CATGCACTGCTGTGCGGGGCAGG - Intergenic
948716611 2:239869513-239869535 CCTCCATAGCAGTGGGGTGCAGG + Intergenic
948894148 2:240920518-240920540 CCTGCACAGCAGAGGAAAGCAGG + Intronic
1168760492 20:347074-347096 CCTGCGCCGCAGTTCGGGGCGGG - Exonic
1168996788 20:2139174-2139196 CATGCACAGCAGGATGGGGCTGG - Intronic
1169000158 20:2162731-2162753 ACTGGACAGCGGTGAGGGGCAGG + Intronic
1169578006 20:6987422-6987444 CAAGAACAGCAGTGGGGGCCGGG + Intergenic
1170040609 20:12035717-12035739 ACTGCACAGTATTGGGGTGCAGG + Intergenic
1170850471 20:19999495-19999517 CCTGCTCAGCAGTGAAGGGAAGG - Intronic
1171053372 20:21882831-21882853 GCAACACAGCTGTGGGGGGCAGG + Intergenic
1171183857 20:23110998-23111020 CATGCACAGCACTGGGGGTTAGG + Intergenic
1171407045 20:24918387-24918409 CCGGCACAGGGGAGGGGGGCGGG + Intergenic
1171424393 20:25040548-25040570 CCAGCACAGCACTGGGGAGCAGG - Intronic
1172115930 20:32573719-32573741 TCAGCAGAGCAGTGGGGGTCTGG - Intronic
1172536190 20:35675131-35675153 CCTGCAGAGTGGAGGGGGGCAGG - Exonic
1175544145 20:59767330-59767352 AGTGGGCAGCAGTGGGGGGCTGG - Exonic
1175612805 20:60365439-60365461 CCTGCAGGGCAGGGAGGGGCTGG - Intergenic
1175778645 20:61668563-61668585 CCTGGACAGCAGTGGCCAGCAGG - Intronic
1175905138 20:62375851-62375873 CCTGCACAGAGGTGGGAGGGAGG - Intergenic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1176079537 20:63265410-63265432 CCTGCCCAGGAAAGGGGGGCAGG - Intronic
1176286815 21:5022861-5022883 CGTGGACGGCAGTGGGCGGCGGG + Intronic
1176365500 21:6030227-6030249 CTGGCACAGCAGTGGGTGGCTGG - Intergenic
1177952225 21:27552509-27552531 CCATCACAGCACTGGAGGGCTGG - Intergenic
1178916423 21:36707928-36707950 TCAGGACGGCAGTGGGGGGCTGG + Intronic
1179758018 21:43508318-43508340 CTGGCACAGCAGTGGGTGGCTGG + Intergenic
1179870366 21:44240614-44240636 CGTGGACGGCAGTGGGCGGCGGG - Intronic
1179882981 21:44301029-44301051 GCTGCACAGCCTTGGGGTGCTGG - Intronic
1180483613 22:15776418-15776440 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
1180802293 22:18637554-18637576 GCTGCACATCAGCTGGGGGCGGG - Intergenic
1181033176 22:20157881-20157903 CCCCCACAGCAGGGGAGGGCGGG + Intergenic
1181219433 22:21357707-21357729 GCTGCACATCAGCTGGGGGCGGG + Intergenic
1181844976 22:25699614-25699636 ACTGCACAGCTGTGGGAGGAGGG - Intronic
1182455844 22:30450022-30450044 CCTGGACAGCAGTAGCGGGGAGG - Intronic
1182456436 22:30453959-30453981 CCTGGACAGCAGTTGGGGGGAGG - Intronic
1183090311 22:35518037-35518059 ATTGCACAGCTCTGGGGGGCAGG - Intergenic
1183230697 22:36580224-36580246 CTTGGACACCAGTGGGAGGCAGG - Intronic
1184225830 22:43128399-43128421 CCATCACAGCTGTGGGGAGCAGG - Intronic
1184258122 22:43298599-43298621 GATGCACAGCAGGGGGCGGCAGG - Intronic
1184506461 22:44906761-44906783 GCTGCACAGTAGCGGGGGGCAGG - Intronic
1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG + Intronic
1184732454 22:46378242-46378264 CCCGCACTGAAGTGAGGGGCAGG + Intronic
1184863522 22:47190310-47190332 GCTGCACAGACGTGGGGGGATGG + Intergenic
949820692 3:8112500-8112522 TCAGCAGAGCAGTGGGAGGCTGG + Intergenic
950407381 3:12813186-12813208 CCAGGACAGGAGTGGGGGACAGG - Intronic
950613132 3:14138873-14138895 CCTGCTCAGGGGTGGTGGGCAGG + Intronic
950708224 3:14796969-14796991 GCTGCACAGCACTGTGGGGGAGG - Intergenic
951709551 3:25574574-25574596 ACGGCAGAGCAGTGGGAGGCCGG - Intronic
952958466 3:38575296-38575318 CCTACTCAGCAGTGGAGCGCTGG - Exonic
953319146 3:41956353-41956375 CCTGAGCAGCACTGGAGGGCAGG - Intronic
953909686 3:46885545-46885567 CCTGGAGAGCAGTGGGGCTCTGG - Intronic
954683920 3:52360380-52360402 CCTGGGCAACAGTGGGAGGCTGG + Exonic
955316593 3:57944202-57944224 TTTCCAGAGCAGTGGGGGGCTGG - Intergenic
956567842 3:70659536-70659558 CCTTCAAAGCACTGGGAGGCTGG + Intergenic
957747686 3:84366139-84366161 CCAGCACAGCAGTGGGAAGTCGG - Intergenic
958676873 3:97276882-97276904 CCTGCCCAGCAATTGGTGGCTGG - Intronic
959262349 3:104098344-104098366 CATCCACAGCAGTGGGCGACAGG - Intergenic
961329415 3:126129907-126129929 CCTGCACAGCACTGAGGAACAGG - Intronic
961394990 3:126580415-126580437 CCTGCTCAGAAGGAGGGGGCCGG + Intronic
963049534 3:141129194-141129216 CCTCCACAGCAGAGGTGGGCAGG - Intronic
963967020 3:151383328-151383350 CTATCACAGCAGTGGTGGGCAGG - Intronic
964248686 3:154684741-154684763 CCTGGACAGGACTCGGGGGCAGG - Intergenic
966758389 3:183392841-183392863 CCTATACAGGAGTGGGAGGCAGG - Intronic
967985625 3:195093839-195093861 CCTGAACAGCTGTGGGGAGAAGG - Intronic
968459638 4:718156-718178 GCTGCACGTCAGTGGGCGGCCGG - Intronic
968505358 4:968729-968751 GCTGCACAGCAGGGGTGGGCTGG + Intronic
968516896 4:1019235-1019257 CCTCCCCAGATGTGGGGGGCTGG + Intronic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968810554 4:2797821-2797843 CCTGCCCAGGAGTGGGAGGCTGG - Intronic
968902242 4:3437177-3437199 CCTGCACAGGAGGGCGAGGCTGG + Intronic
969292523 4:6249211-6249233 CCTAGACCACAGTGGGGGGCCGG + Intergenic
969391166 4:6892233-6892255 CCTGACCAGCAGCGTGGGGCAGG + Intergenic
969498478 4:7539697-7539719 CCTCCACAGCAGGAAGGGGCGGG - Intronic
969861080 4:10035689-10035711 TCTGCCCTCCAGTGGGGGGCAGG + Intronic
969880158 4:10166765-10166787 CAGGCACTGCTGTGGGGGGCGGG + Intergenic
971258298 4:25032894-25032916 CTTGCACAGCAGTAAGTGGCAGG - Intergenic
972419911 4:38877564-38877586 GCTGCACAGCAGTGGGTGAGTGG - Intronic
973165639 4:47074450-47074472 CTGGCACAGAAGTGGGAGGCAGG + Intronic
973724728 4:53763943-53763965 CCAGCAGGGCAGTGGGGGCCAGG - Intronic
976324969 4:83760995-83761017 TCAGCACTGCAGTGCGGGGCTGG - Intergenic
977606923 4:98993662-98993684 CCAGCACAGCACTGGTGGGCCGG + Intergenic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
979259136 4:118632674-118632696 CCTACACAGCACTTGGAGGCAGG - Intergenic
979329213 4:119407885-119407907 CCTACACAGCACTTGGAGGCAGG + Intergenic
982828709 4:160031940-160031962 CCCGTAGGGCAGTGGGGGGCTGG - Intergenic
984830925 4:183972118-183972140 CCTGCACAGCGGCGTAGGGCTGG + Intronic
985500294 5:239649-239671 CCTTCACATCAGCGGGGGGAAGG - Intronic
986327506 5:6687284-6687306 GCTGCACAGCTGTGAGGGGCCGG + Intergenic
989113774 5:37931712-37931734 CCTGCACACCAGTGGATGACTGG - Intergenic
994229978 5:97301333-97301355 CAAGCACAGCACTGGTGGGCTGG - Intergenic
994323629 5:98423172-98423194 GCTGCACAGCATGGGGGGGAGGG - Intergenic
995495536 5:112738070-112738092 CCAGTGCTGCAGTGGGGGGCGGG - Intronic
996548780 5:124708729-124708751 CCTGAACAGCACTTGAGGGCAGG - Intronic
996586020 5:125088941-125088963 ACTGCACAGGAGCGGAGGGCGGG - Intergenic
997365100 5:133320650-133320672 CCCGCACAGCAGACGAGGGCTGG - Intronic
998472070 5:142391262-142391284 CCAGCACAGCTGTGGGTAGCTGG + Intergenic
1000120936 5:158197220-158197242 CCTGCCCAGCAGCAGCGGGCTGG - Intergenic
1000734226 5:164879153-164879175 CATGCCCAGCAGTGGTGGACTGG + Intergenic
1001021099 5:168183157-168183179 CATGCACAGGAGTGGGGGTGAGG - Intronic
1001416441 5:171547708-171547730 CCTGCACAGCAGTGGTTGCCTGG - Intergenic
1002778806 6:351059-351081 CCTCCACAGCAGTGGGGATAAGG - Exonic
1003094236 6:3130168-3130190 GCTGCACAAAAGTGGGAGGCAGG - Intronic
1003110699 6:3250007-3250029 CCTCCACAGCAGCAGGGGTCGGG + Intronic
1003119769 6:3309833-3309855 CCTGCTGTGCAGTGAGGGGCTGG - Intronic
1003187894 6:3849146-3849168 CCTGCCCAGCCGTGGCTGGCCGG - Intergenic
1003404228 6:5815415-5815437 CCTGCACAGCCCTGGGGTGCAGG + Intergenic
1004027878 6:11836873-11836895 CCTGCACAGCTGAGGGGACCTGG + Intergenic
1005759817 6:28958029-28958051 CGAGCACAGCACTGGTGGGCTGG - Intergenic
1006297436 6:33176165-33176187 GCTGGACGGCAGTGCGGGGCAGG + Intronic
1006756735 6:36422900-36422922 CCCGCACAGCAATGGTGGGCAGG + Intronic
1006864727 6:37200256-37200278 TCAGCACAGCAGTGGGGGCTGGG + Intergenic
1006908551 6:37549059-37549081 CCAGCACTGCAGTGGGGAGAGGG - Intergenic
1010062980 6:71646252-71646274 CCAGCAAAGCCATGGGGGGCAGG - Intergenic
1010155177 6:72784233-72784255 CCTGAACAGCAGTGGTGGTTTGG - Intronic
1010877121 6:81120554-81120576 GCTGCACAGCAGGAGGTGGCTGG + Intergenic
1011746613 6:90413123-90413145 CATGCACTGCAGTGGGTAGCTGG - Intergenic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1016295013 6:142564708-142564730 CCCTCACTGAAGTGGGGGGCAGG + Intergenic
1016523355 6:144971854-144971876 CCTGTTGAGGAGTGGGGGGCTGG - Intergenic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017757421 6:157541394-157541416 CCTGAACAGCAGTGGGGTGCTGG + Intronic
1018177023 6:161186131-161186153 CCTCCCAAGAAGTGGGGGGCTGG - Intronic
1019103662 6:169651164-169651186 GGAGCACAGCAGTGCGGGGCGGG + Intronic
1019291525 7:252784-252806 CCTACACAGCTGTGCGGTGCTGG - Intronic
1019516812 7:1443807-1443829 CCTGCAGAGCTGTGAGGGGGTGG + Intronic
1019536291 7:1531245-1531267 CCTTCACACCTGCGGGGGGCGGG + Intronic
1019596125 7:1859188-1859210 CCTTCACACCAGGGGGAGGCAGG - Intronic
1020750405 7:12133871-12133893 ACTGCAGAGGAGTTGGGGGCTGG + Intergenic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1022538097 7:31110616-31110638 CTTGCACAGGAGTGGGGCTCTGG + Exonic
1022704126 7:32787269-32787291 ACTGTCCAGGAGTGGGGGGCAGG - Intergenic
1022908307 7:34877011-34877033 ACTGTCCAGGAGTGGGGGGCAGG - Intronic
1023264696 7:38392871-38392893 CGGCCACAGCAGTGTGGGGCTGG - Intronic
1023401491 7:39795096-39795118 CCTGCACAGCAGCAGGGGTAGGG + Intergenic
1023841704 7:44101916-44101938 CCTGGGCTACAGTGGGGGGCTGG - Intergenic
1024074044 7:45809720-45809742 CCTACACAGCACTTGGAGGCAGG - Intergenic
1024665728 7:51545194-51545216 TCTGCTCTGCAGTGGGGGCCAGG - Intergenic
1025053369 7:55745807-55745829 CCTACACAGCACTTGGAGGCAGG + Intergenic
1025131472 7:56376281-56376303 CCTACACAGCACTTGGAGGCAGG + Intergenic
1025182272 7:56829347-56829369 CCTACACAGCACTTGGAGGCAGG + Intergenic
1025689655 7:63747648-63747670 CCTACACAGCACTTGGAGGCAGG - Intergenic
1025740584 7:64192688-64192710 CGTGCCCAGCACTGGGGGGCTGG - Intronic
1027754461 7:82194885-82194907 CCAGCACAAGAATGGGGGGCGGG + Intronic
1029401877 7:100352083-100352105 CCTGGACAGCAGGGGGTGCCGGG - Intronic
1030094572 7:105886591-105886613 CCTACACAGCAGTGCTGGCCAGG - Intronic
1031336168 7:120535585-120535607 ACAGCACAGCAGTGGGAGGCAGG - Intronic
1031413113 7:121464518-121464540 CCTGCACAGAACTGGGGGAAGGG - Intergenic
1031547489 7:123068292-123068314 CATGCACAGCATTGGGGGAGGGG + Intergenic
1032366723 7:131306984-131307006 CCTGCAGAGTAGTGGGGCCCTGG - Intronic
1033474195 7:141674919-141674941 CCTGCGCTCCACTGGGGGGCAGG - Intronic
1033524393 7:142196142-142196164 CCTGCACAGCTCTGGTGGGAGGG - Intronic
1034147220 7:148884066-148884088 CCGGCACAGCAGTGGCGGGGAGG + Intronic
1034172299 7:149071802-149071824 CCAGCACAGCCGGGAGGGGCCGG - Exonic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1034226367 7:149486962-149486984 ACTGCACAGCAGGGGGTGGGTGG + Intronic
1034441366 7:151087439-151087461 CCTGCTCCGCAGTGGGGCGGGGG + Intronic
1034587380 7:152106919-152106941 CATGCACATCAGTGGGGGTGAGG - Intronic
1034661463 7:152773839-152773861 AGTGCCCAGCAGTGTGGGGCGGG + Intronic
1035395977 7:158534856-158534878 CCTGCACAGCCAGGGAGGGCGGG + Intronic
1035675472 8:1452716-1452738 CCTCCACAGCAGCCGGGGTCAGG + Intergenic
1036682744 8:10887518-10887540 CCTTTACAGAAGTGGAGGGCTGG - Intergenic
1037808585 8:22072467-22072489 CCTGCACAGGGGTGGAGGGTGGG - Intronic
1038040107 8:23717081-23717103 CATGCATAGCAGTGGTGGGAGGG + Intergenic
1038870711 8:31490051-31490073 CGAGCACAGCACTGGTGGGCTGG - Intergenic
1038938534 8:32278836-32278858 CCTGCACAGTGGTGGGTGGCTGG - Intronic
1039661441 8:39471274-39471296 CCAGCACCGCAGTGGCTGGCTGG + Intergenic
1043701136 8:83290537-83290559 CGAGCACAGCACTGGTGGGCTGG - Intergenic
1049104544 8:140603747-140603769 CCGCCACAGCAGCGTGGGGCTGG - Intronic
1049195462 8:141313268-141313290 CCTACACAGCGGTGGGGTGGGGG + Intergenic
1049601183 8:143508358-143508380 CCTGCACAGGGGAGGGGCGCTGG + Intronic
1049608457 8:143541032-143541054 CCAGCCCCGCAGTGGGGCGCGGG + Intronic
1049706407 8:144045215-144045237 TATGCACAGTTGTGGGGGGCAGG - Intronic
1049771252 8:144383086-144383108 CCTCCACAGGGGTGTGGGGCTGG - Exonic
1049885174 9:21877-21899 CCTGCACAGGGGTGGGAGGGGGG - Intergenic
1053283092 9:36834223-36834245 CCAGCACAACAGAGGGTGGCGGG - Exonic
1053328782 9:37183984-37184006 CCTGCACAGTAGAGAGGGGTTGG + Intronic
1055731133 9:79280184-79280206 CTTGAGCAGCAGTGGTGGGCAGG + Intergenic
1055745194 9:79436535-79436557 GGTGCACATCAGTGGTGGGCTGG + Intergenic
1057283142 9:93727024-93727046 CCAGCACAGCAGAGGTGGCCTGG - Intergenic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1059451414 9:114373327-114373349 CCTGAACAGCAGTATGGGGCAGG - Intronic
1060228276 9:121809339-121809361 CCAGCACAGCAGAGCGGGGAAGG - Intergenic
1060820561 9:126659236-126659258 CCTGCCCAGCACTGGTGGCCAGG - Intronic
1061049037 9:128183294-128183316 CCTAGACAGCTGTGGGGCGCAGG + Intronic
1061429176 9:130520325-130520347 CATTCACAGCAGTGGGCAGCAGG - Intergenic
1061445310 9:130634135-130634157 CCTGCACAGAAGAGAAGGGCTGG + Intronic
1061675691 9:132214344-132214366 CCTGCGCTGCAGGGAGGGGCAGG - Intronic
1061712512 9:132497957-132497979 CCTGCCCAGCGCTTGGGGGCCGG + Intronic
1062277361 9:135737187-135737209 CCTGCACAGCAGGTCAGGGCTGG + Intronic
1062290383 9:135791735-135791757 CCTGCAGAGCTGGGAGGGGCAGG + Intronic
1062412144 9:136430973-136430995 TCTGCACCGCAGCGGTGGGCAGG + Intronic
1062501004 9:136852082-136852104 TCTGCTCGGCAGTGTGGGGCGGG - Intronic
1203786828 EBV:132962-132984 ACTGCCCAGCACGGGGGGGCAGG - Intergenic
1203654166 Un_KI270752v1:7536-7558 CCTGGGCAGCAGTGCTGGGCAGG + Intergenic
1187139058 X:16575637-16575659 CCAGCACAGCGCTGGTGGGCCGG - Intergenic
1187473269 X:19588216-19588238 CCTGCAGAGCAGTGAGGGTCAGG + Intronic
1189697367 X:43678157-43678179 CCAGCCCAGCAGTGGGAAGCGGG - Intronic
1190917957 X:54824217-54824239 TTTCCACAGCAGTGGGGGGATGG + Intergenic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1192362324 X:70447622-70447644 CCTCCTCAGAAGTGGGGAGCTGG - Intronic
1194194063 X:90870475-90870497 GCTGCACAGCAGGGGGGTCCTGG - Intergenic
1194278203 X:91913460-91913482 ACTGCACAGCAGAGGTGGCCAGG + Intronic
1195107921 X:101617923-101617945 CCTGCAGAGTAATAGGGGGCTGG + Exonic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1195411027 X:104567672-104567694 CCTGAGCAGCAGTGGGGACCTGG - Intronic
1195688244 X:107604031-107604053 CCTGCCCATCAGTGAGGGGCAGG - Exonic
1196039074 X:111182146-111182168 CCTGGACAGGAAAGGGGGGCAGG - Intronic
1197641682 X:128974991-128975013 CATGGACAGCAGTGGGGGAGGGG + Intergenic
1199540568 X:148953598-148953620 CTTGCACTGCAGGTGGGGGCTGG - Exonic
1200595540 Y:5135535-5135557 ACTGCACAGCAGAGGCGGCCAGG + Intronic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1202113224 Y:21446243-21446265 CCTGCCAGGCAGTGTGGGGCTGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic