ID: 1163724211

View in Genome Browser
Species Human (GRCh38)
Location 19:18913335-18913357
Sequence CACCTCTAACCTCTGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 543}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163724201_1163724211 11 Left 1163724201 19:18913301-18913323 CCCAGTCACACTTAAGAAGCCAG 0: 1
1: 0
2: 2
3: 12
4: 140
Right 1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 543
1163724202_1163724211 10 Left 1163724202 19:18913302-18913324 CCAGTCACACTTAAGAAGCCAGG 0: 1
1: 0
2: 4
3: 6
4: 102
Right 1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 543
1163724199_1163724211 28 Left 1163724199 19:18913284-18913306 CCAAGTTCAGTGTCTGCCCCAGT 0: 1
1: 0
2: 0
3: 34
4: 246
Right 1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 543
1163724200_1163724211 12 Left 1163724200 19:18913300-18913322 CCCCAGTCACACTTAAGAAGCCA 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 543
1163724198_1163724211 29 Left 1163724198 19:18913283-18913305 CCCAAGTTCAGTGTCTGCCCCAG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 543
1163724206_1163724211 -8 Left 1163724206 19:18913320-18913342 CCAGGGTGGCACCCGCACCTCTA 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG 0: 1
1: 0
2: 1
3: 16
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163724211 Original CRISPR CACCTCTAACCTCTGGACAT GGG Intronic
901106715 1:6762062-6762084 CACCTCTAATCTCAGCACTTTGG - Intergenic
901243371 1:7708370-7708392 CACCTCTAATCTCTGCACTTTGG + Intronic
902028115 1:13399400-13399422 CACCTGTAACCTCAGCACTTCGG - Intergenic
902032281 1:13431557-13431579 CACCTGTAATCTCTGCACTTTGG + Intergenic
902230466 1:15024151-15024173 CCCTTCTGACCTCTGGGCATTGG - Intronic
902254678 1:15180300-15180322 CAGCTCTAAGCTATGGACAAAGG + Intronic
903419327 1:23207136-23207158 CATCTGTAATCTCAGGACATTGG + Intergenic
903585843 1:24414789-24414811 CACCTGTAATCTCAGGACTTTGG - Intronic
903693219 1:25189083-25189105 CACCTGTAACCTCAGCACTTTGG + Intergenic
904018404 1:27442283-27442305 CACCTGTAATCTCAGGACTTTGG + Intronic
904148772 1:28418689-28418711 CACCTGTAATCTCAGGACTTTGG + Intronic
904167580 1:28567901-28567923 CACCTGTAACCCCAGGACTTTGG + Intronic
904589913 1:31607327-31607349 CACCTGTAACCCCAGGACTTTGG - Intergenic
905485188 1:38291122-38291144 CACCTCTAATCTCAGCACCTTGG - Intergenic
907238072 1:53064927-53064949 CATCTCAAACCCCTGGACAGCGG - Intronic
907420994 1:54347226-54347248 CACCTCTAACCCCAGTACTTTGG - Intronic
907441754 1:54482965-54482987 CACCTATAACCTCAGCACTTTGG - Intergenic
909010398 1:70328400-70328422 CACCTATAATCTCAGGACTTTGG + Intronic
909242554 1:73233257-73233279 CACCTGTAATCTCGGCACATTGG - Intergenic
909664117 1:78114778-78114800 GAACTCTAAACTATGGACATTGG + Intronic
912904337 1:113688105-113688127 CACCTGTAACCCCTGCACTTTGG - Intergenic
913033832 1:114940355-114940377 CACCTGTAACCTCAGCACTTTGG - Intronic
913136211 1:115891853-115891875 CACCTATAACTTCAGCACATTGG + Intergenic
913324128 1:117611578-117611600 CAGCTGTAACCTCAGGACTTTGG + Intronic
914831365 1:151173226-151173248 CACCTGTAACCTCAGCACTTGGG - Intronic
915176864 1:154022935-154022957 CACCTGTAACCTCAGCACTTTGG - Intronic
915201481 1:154232964-154232986 CACCTATAACCTCAGCACTTTGG - Intronic
915447437 1:155981964-155981986 CACCTCTCACCACAGGCCATGGG - Intronic
916490974 1:165302175-165302197 CACCTGTAATCTCAGAACATTGG + Intronic
917710358 1:177678149-177678171 CACCTGTAACCCCAGCACATTGG - Intergenic
917868816 1:179223865-179223887 CACCTGTAATCTCAGGACTTTGG + Intronic
918314732 1:183313744-183313766 CACCTGTAATCCCTGCACATTGG - Intronic
918496238 1:185140716-185140738 CACCTGTAATCTCTGCACTTTGG + Intronic
918734125 1:188037473-188037495 CACCTGTAATCTCTGCACTTTGG - Intergenic
919258236 1:195154473-195154495 CACCTATAATCTCAGTACATTGG + Intergenic
919993004 1:202721962-202721984 CTCCTCTAAACTTTGGTCATGGG - Intergenic
920157072 1:203961993-203962015 CACCTATAATCTCAGCACATTGG + Intergenic
920428234 1:205896159-205896181 CACTTCTCACTTCTGGATATAGG + Intergenic
920547297 1:206829107-206829129 CACCTGTAATCTCTGCACTTTGG - Intronic
921651313 1:217681655-217681677 CACCTCTAATCCCAGGACTTTGG - Intronic
922099009 1:222466742-222466764 CACCTGTAATCTCTGCACTTTGG - Intergenic
922206969 1:223456442-223456464 CACCTCTGACCTTGTGACATGGG + Intergenic
922496003 1:226058430-226058452 CACCTCTAATCCCTGCACTTTGG - Intergenic
922500334 1:226092769-226092791 CACCTCTAATCTCAGGACTTTGG + Intergenic
922847481 1:228699170-228699192 CACCTGTAACCTCAGCACTTTGG + Intergenic
922931278 1:229391505-229391527 CACCTGTAACCTCAGCACTTTGG - Intergenic
923722355 1:236477840-236477862 CACCTGTAATCTCAGCACATTGG + Intronic
924758877 1:246966226-246966248 CACCTATAATCTCAGCACATTGG + Intronic
1062864581 10:840889-840911 CACCTGTAATCTCAGGACTTTGG + Intronic
1063507732 10:6616758-6616780 CACCTGTAATCTCTGCACTTTGG + Intergenic
1063572070 10:7224644-7224666 CAGCTCTAAAGTCTGGACACAGG - Intronic
1064382827 10:14861751-14861773 CACCTGTAACCCCAGCACATTGG + Intronic
1064647286 10:17472607-17472629 CACCTGTAACCTCAGCACTTTGG + Intergenic
1065072501 10:22040398-22040420 CACCTGTAATCTCAGGACTTTGG + Intergenic
1065203561 10:23337271-23337293 CACCTGTAACCTCAGCACTTTGG + Intronic
1065514093 10:26507230-26507252 CACCTCTAATCTCAGCACTTTGG + Intronic
1065703021 10:28443938-28443960 CACCTGTAACCTCAGCACCTTGG - Intergenic
1066059515 10:31709400-31709422 CCCCTCTACCCTGTGGACCTAGG - Intergenic
1066399516 10:35061866-35061888 CACCTGTAATCTCTGTACTTTGG - Intronic
1066419305 10:35249200-35249222 CACCTGTAACCTCAGCACTTTGG - Intronic
1067076560 10:43189644-43189666 CACCTGTAATCTCTGCACTTTGG - Intergenic
1067260874 10:44690421-44690443 CGCTTCCAACCTCTGTACATGGG + Intergenic
1068108273 10:52647047-52647069 CACCTGTAATCTCTGCACTTTGG + Intergenic
1068406831 10:56600480-56600502 CACCTCTAATCCCAGGACTTTGG - Intergenic
1069390789 10:67932215-67932237 CACCTGTAACCCCAGGACTTTGG - Intronic
1070119728 10:73564259-73564281 CACCTCTAACCTCAGCACTCTGG - Intronic
1070264093 10:74885989-74886011 CACCTGTAATCCCAGGACATTGG - Intronic
1070359159 10:75670781-75670803 CACCTCCCACCTCAGGACCTAGG - Intronic
1070899633 10:80016975-80016997 CACCTATAACCTCAGCACTTTGG + Intergenic
1071508915 10:86249249-86249271 CAGGTCTAACCCCAGGACATAGG - Intronic
1072101465 10:92233266-92233288 CACCTCTAATCTCAGCACTTTGG + Intronic
1072189789 10:93070013-93070035 CACCTCTAACCCCAGCACTTTGG - Intergenic
1072333279 10:94374308-94374330 CACCTGTAATCTCAGGACTTTGG + Intergenic
1072686148 10:97538229-97538251 CACCTGTAATCTCTGTACTTTGG + Intronic
1073056294 10:100705095-100705117 CACCTCTAACCCCAGCACTTAGG + Intergenic
1073306662 10:102508232-102508254 CACCTGTAATCTCTGCACTTTGG - Intronic
1074005079 10:109413538-109413560 CACCTGTAATCTCAGGACTTTGG - Intergenic
1075093773 10:119457952-119457974 CACCTATAACCTCAGCACTTTGG - Intronic
1075126943 10:119708032-119708054 CACCTGTAATCTCAGCACATTGG + Intergenic
1075699017 10:124456525-124456547 CACCTATAATCTCTGCACTTTGG + Intergenic
1075757787 10:124828632-124828654 CACCTCTAATCTCAGCACTTTGG - Intronic
1076751405 10:132545310-132545332 CCCCTCTAGCCCCTGGACAGAGG - Intronic
1078296477 11:10076435-10076457 CACCTCTCAGTTCTGGCCATAGG - Intronic
1078746495 11:14120443-14120465 CAGCTCCAGCCTCTGGACTTAGG - Intronic
1079403452 11:20125306-20125328 CACCTGTAACCTCAGCACTTTGG - Intergenic
1080165575 11:29232260-29232282 CACCTCAAAGCTCTGGAGTTGGG + Intergenic
1080496626 11:32827122-32827144 CACCTGTAACCTCAGCACTTTGG - Intergenic
1080533733 11:33201282-33201304 CACCTATAACCTCTGCACTTTGG - Intergenic
1080995650 11:37597284-37597306 CACCTGTAATCTCAGGACTTTGG - Intergenic
1081196258 11:40164495-40164517 CACCTGTAATCCCTGCACATTGG - Intronic
1081533939 11:43983853-43983875 CACCTATAATCTCAGGACTTTGG + Intergenic
1082001871 11:47397587-47397609 CACCTGTAATCTCAGCACATTGG + Intergenic
1082182672 11:49139481-49139503 CACCTCTAATCTCGGCACTTTGG - Intergenic
1082247128 11:49936839-49936861 CACCTGTAATCTCAGCACATTGG - Intergenic
1082644196 11:55701758-55701780 CACCTATAAACTCTGGCCTTTGG + Intergenic
1082815101 11:57502608-57502630 CACCTGTAATCTCAGGACTTTGG + Intronic
1083643998 11:64161807-64161829 CACCTGTAACCTCAGCACTTTGG + Intronic
1083644019 11:64161943-64161965 CACCTGTAACCTCAGCACTTTGG + Intronic
1083644040 11:64162079-64162101 CACCTGTAACCTCAGCACTTTGG + Intronic
1083694471 11:64433451-64433473 CACCTCTGATCACTGGACACAGG - Intergenic
1084015834 11:66380742-66380764 CAACTCTTAACTCTGAACATTGG + Intergenic
1084174041 11:67414441-67414463 CACCTGTATTCTCAGGACATTGG + Intronic
1085081841 11:73641475-73641497 CACCTCCCATCTCTAGACATGGG + Intergenic
1085588445 11:77733820-77733842 CACCTATAACCTCAGCACTTTGG - Intronic
1086026222 11:82295035-82295057 CACCTCTAATCTCAGCACTTTGG - Intergenic
1088600546 11:111470654-111470676 CACCTGTAATCTCTGCACTTTGG + Intronic
1088611836 11:111584977-111584999 CACCTCTAATCCCTGCACTTTGG + Intergenic
1089051731 11:115551304-115551326 CACCTGTAACCTCAGCACTTTGG - Intergenic
1090016412 11:123090183-123090205 CACCTCTAATCTCAGCACTTTGG + Intronic
1090711787 11:129392869-129392891 CACCTCTAATCTCAGCACTTTGG - Intronic
1090787630 11:130064201-130064223 GAACTTTAACCTCTGAACATGGG - Intergenic
1091031994 11:132198459-132198481 CACCTGTAATCTCAGCACATTGG - Intronic
1091513915 12:1158711-1158733 CACCTGTAATCCCAGGACATTGG - Intronic
1091794473 12:3289843-3289865 CACCTCTCTCCTCTGCACATAGG - Intergenic
1093468123 12:19471375-19471397 CACCTCTAACCCCAGCACTTTGG - Intronic
1093804007 12:23410139-23410161 CACCTCTAATCTCAGCACTTTGG - Intergenic
1093820270 12:23608007-23608029 CACCTGTAACCTCAGCACTTTGG + Intronic
1093928615 12:24933227-24933249 CACCTGTAATCTCGGCACATTGG - Intronic
1094099691 12:26748317-26748339 CACCTGTAACCTCAGCACTTTGG - Intronic
1094301461 12:28969184-28969206 AATCTCTAACCTCTGGAAAATGG - Intergenic
1094376976 12:29800929-29800951 CACCTGTAATCTCAGGACTTTGG + Intergenic
1094700217 12:32862701-32862723 CACCTCTAATCCCTGCACTTTGG + Intronic
1095973570 12:47923440-47923462 CACCTGTAACCCCAGGACTTTGG + Intronic
1096238863 12:49948766-49948788 CACCTCCAGACTCTGCACATAGG - Intergenic
1096682216 12:53263698-53263720 CACCTGTAATCTCAGGACTTTGG - Intergenic
1097004604 12:55906906-55906928 CACCTGTAATCTCAGGACTTTGG - Intronic
1097588862 12:61548662-61548684 CACCTCTATCCTCTGAACAATGG - Intergenic
1098889333 12:75992922-75992944 CACCTGTAACCTCAGCACTTTGG + Intergenic
1099018953 12:77379797-77379819 GACCTCTAACAGCTAGACATGGG + Intergenic
1099532454 12:83800946-83800968 CACCTGTAATCTCGGGACTTTGG - Intergenic
1100160872 12:91859261-91859283 CACCTGTAATCTCAGCACATTGG - Intergenic
1100500113 12:95165905-95165927 CACCTGTAATCTCAGGACTTTGG - Intronic
1100556254 12:95696907-95696929 CACCTGTAACCTCAGTACTTTGG + Intronic
1100640566 12:96478552-96478574 CACCTGTAATCTCAGGACTTTGG - Intergenic
1101712333 12:107280099-107280121 CACCTGTAACCCCTGCACTTTGG + Intergenic
1102543226 12:113637335-113637357 CACCTCTAACCCCAGCACTTTGG - Intergenic
1102580846 12:113886391-113886413 CACCTCTAATCTCAGCACTTCGG - Intronic
1103712906 12:122926282-122926304 CACCTCTAATCTCAGCACTTTGG + Intronic
1104439081 12:128780604-128780626 CACCTGTAATCTCTGCACTTTGG - Intergenic
1104538266 12:129639120-129639142 CACCTGTAATCTCAGCACATTGG + Intronic
1105408213 13:20149231-20149253 CACCTGTAATCTCTGCACTTTGG + Intronic
1105959515 13:25317813-25317835 TACCTTTTACCTCTGCACATGGG - Intronic
1106938708 13:34752758-34752780 CACCTCTAATCTCAGCACTTTGG + Intergenic
1107145492 13:37057036-37057058 CACCTGTAACCCCAGGACTTTGG + Intronic
1107248410 13:38325911-38325933 CACCTCTAATCTCAGCACTTTGG + Intergenic
1108557569 13:51610021-51610043 CAGCGCTACCCTCTGGACTTGGG - Intronic
1109760087 13:66816660-66816682 CACCTCTAATCTCAGCACTTTGG + Intronic
1111960226 13:94802041-94802063 CACCTGTAATCTCTGCACTTTGG + Intergenic
1112207839 13:97343080-97343102 CACCTGTAACCCCTGGAGTTGGG + Exonic
1112645727 13:101329776-101329798 CACCTGTAATCTCTGCACTTTGG + Intronic
1114225799 14:20737320-20737342 CACCTGTAACCCCAGGACTTTGG - Intronic
1114380152 14:22194568-22194590 CCTCTCTGCCCTCTGGACATAGG + Intergenic
1114952257 14:27770105-27770127 CACCTCTAATCTCAGCACTTTGG + Intergenic
1115225096 14:31094337-31094359 CACCTGTAACCCCTGCACTTTGG + Intronic
1115579394 14:34743308-34743330 CACCTCTAATCTCAGCACTTTGG - Intergenic
1117297044 14:54389980-54390002 CACCTCTAATCCCTGCACTTTGG + Intergenic
1117408791 14:55430655-55430677 CACCTGTAACCTCAGTACTTGGG - Intronic
1118182436 14:63507040-63507062 CACCTGTAACCTCAGCACTTTGG - Intronic
1118784696 14:69036584-69036606 CACCTGTAACCCCAGGACTTTGG - Intergenic
1118815494 14:69310787-69310809 CACCTGTAACCTCAAGACTTTGG + Intronic
1118871326 14:69745186-69745208 CACCTGTAATCTCTGCACTTTGG - Intronic
1120492245 14:85192487-85192509 CACCTGTAATCTCAGCACATTGG + Intergenic
1121706935 14:96003203-96003225 CTCCTGTAACCTCTTGTCATGGG - Intergenic
1121757501 14:96415192-96415214 CACCTGTAACCCCAGCACATTGG + Intronic
1121878073 14:97473102-97473124 CACCTGTAACCTCTGCACTTTGG - Intergenic
1122104804 14:99444596-99444618 CACCTGTAATCCCTGCACATTGG + Intronic
1122667314 14:103340109-103340131 CACCTGTAACCTCAGCACTTTGG - Intronic
1124801378 15:32836119-32836141 CACCTGTAATCTCAGGACTTTGG - Intronic
1125285046 15:38083506-38083528 CACCTCTAATCTCAACACATTGG + Intergenic
1126490969 15:49235023-49235045 CACCTCTAATCTCAGCACTTTGG - Intronic
1126819661 15:52489728-52489750 CACCTGTAACCTCAGCACTTTGG + Intronic
1126822154 15:52515015-52515037 CACCTCTAATCTCAGCACTTTGG + Intronic
1126948130 15:53847624-53847646 CACCTCTAATCTCAGCACTTTGG - Intergenic
1127684804 15:61332738-61332760 CACCTGTTACCTCAGGAAATGGG - Intergenic
1128084927 15:64879262-64879284 CACCTGTAATCTCTGCACTTTGG - Intronic
1128085017 15:64880079-64880101 CACCTGTAATCTCTGCACTTTGG - Intronic
1128219722 15:65959933-65959955 CACCTCTCACCACAGGGCATTGG + Intronic
1129325118 15:74795955-74795977 CACCTGTAATCTCAGCACATTGG + Intronic
1129442437 15:75591460-75591482 CAGCTCTAACTCCTGGCCATAGG + Intergenic
1130522850 15:84676829-84676851 CACCTGTAACCCCAGGACTTTGG + Intronic
1130951957 15:88599022-88599044 CACCTCTAATCTCAGCACTTTGG - Intergenic
1131196151 15:90356455-90356477 CACCTCTAATCTCAGCACTTTGG - Intronic
1131678577 15:94697945-94697967 CAACTCTATTCTCTGGTCATAGG - Intergenic
1133203634 16:4219719-4219741 CACCTGTAACCTCAGCACTTTGG - Intronic
1133253019 16:4496955-4496977 CACCTATAATCTCTGTACTTTGG - Intronic
1133331154 16:4975036-4975058 CACCTCTAATCCCAGGACTTTGG - Intronic
1133794755 16:9036879-9036901 CACCTCTAATCTCAGCACTTTGG + Intergenic
1134258308 16:12629960-12629982 CACCTCTAACCCCAGCACTTTGG + Intergenic
1134745820 16:16587510-16587532 CACCTCTAATCCCAGCACATTGG - Intergenic
1135209409 16:20511499-20511521 CACCTCTAATCTCAGCACTTTGG - Intergenic
1135243746 16:20835785-20835807 CACCTGTAATCTCAGGACTTTGG + Intronic
1135398210 16:22147282-22147304 CACCTATAACCCCAGGACTTTGG - Intronic
1136501644 16:30673230-30673252 CACCTGTAATCCCTGGACTTTGG - Intergenic
1136717920 16:32299869-32299891 CACCTGTAATCTCAGCACATTGG - Intergenic
1136836295 16:33506139-33506161 CACCTGTAATCTCAGCACATTGG - Intergenic
1137500519 16:49007900-49007922 CACCTCTAACCCCGGCACTTTGG - Intergenic
1138488520 16:57362358-57362380 CACCTGTAATCTCAGGACTTTGG + Intronic
1139300540 16:65941931-65941953 CACCTGTAATCTCAGGACTTTGG + Intergenic
1139667425 16:68467484-68467506 CTCCTCTGACCTCTTGTCATCGG + Intergenic
1140106494 16:71965106-71965128 CACCTCTAATCTCAGCACTTTGG - Intronic
1140488582 16:75315010-75315032 CACCTGTAATCTCTGCACTTTGG - Intronic
1140627721 16:76814523-76814545 CGCCTGTAATCTCTGGACTTTGG - Intergenic
1140679470 16:77370487-77370509 CACCTGTAATCTCAGGACTTTGG + Intronic
1140902858 16:79385823-79385845 AACCTCCAACCTCTGGACACAGG - Intergenic
1141014862 16:80439470-80439492 CAGATCTAACCTGTGGACTTCGG + Intergenic
1141721579 16:85758978-85759000 CACCTCTAACCCCAGTACTTTGG + Intergenic
1142381445 16:89734577-89734599 CACCTGTAATCTCTGCACTTTGG - Intronic
1203008508 16_KI270728v1_random:217897-217919 CACCTGTAATCTCAGCACATTGG + Intergenic
1203146474 16_KI270728v1_random:1806432-1806454 CACCTGTAATCTCAGCACATTGG - Intergenic
1142838106 17:2604296-2604318 CACCTGTAACCTCAGCACTTTGG - Intronic
1142873457 17:2836369-2836391 CACCTGTAATCTCAGGACTTGGG + Intronic
1143081948 17:4388368-4388390 CACCTGTAATCTCTGCACTTTGG - Intergenic
1143181869 17:4988372-4988394 CACCACTAGCCTCTCGGCATCGG + Exonic
1144336182 17:14270834-14270856 GACCTCTTACCTCTGGTGATAGG - Intergenic
1144700307 17:17333569-17333591 CACCTGTAACCTCAGCACTTTGG - Intronic
1146276348 17:31518230-31518252 CACCTATAACCCCAGGACTTTGG + Intronic
1146988186 17:37242465-37242487 CACCTGTAACCTCAGCACTTTGG + Intronic
1147130227 17:38403326-38403348 CACCTCTCACCCCTAGACCTAGG - Exonic
1147322798 17:39656374-39656396 TCCCTCAAACCTCTGGACATTGG + Intronic
1147381192 17:40057208-40057230 CACCTCTAATCCCTGCACTTTGG + Intronic
1147501897 17:40973358-40973380 CACCTCTAACCCCAGCACTTTGG - Intergenic
1148187546 17:45655571-45655593 CACCTGTAACCTCAGCACTTTGG + Intergenic
1148274149 17:46288556-46288578 CACCTGTAATCTCAGGACTTTGG - Intronic
1148996985 17:51719319-51719341 CACCTCTCACCACTGAACCTAGG + Intronic
1149963384 17:61136817-61136839 CACCTGTAATCTCAGGACTTTGG - Intronic
1150408908 17:64926010-64926032 CACCTGTAATCTCAGGACTTTGG + Intergenic
1150421822 17:65043545-65043567 CACCTGTAACCTCAGCACTTTGG - Intronic
1151373181 17:73663351-73663373 CACCTATAATCTCTGCACTTTGG - Intergenic
1151965817 17:77430676-77430698 CACTTCTAACCTCTGCCCCTTGG - Intronic
1152022801 17:77789785-77789807 CACCTGTAACCTCAGCACTTTGG - Intergenic
1152661969 17:81546687-81546709 CACCTCGGGCCTGTGGACATGGG - Intronic
1153172085 18:2327899-2327921 CACCTGTAATCTCAGGACTTTGG + Intergenic
1154257333 18:12794881-12794903 CACCTGTAATCTCAGGACTTTGG - Intronic
1155151759 18:23128670-23128692 CACCTGTAACCCCTGCACTTTGG + Intergenic
1156231814 18:35160590-35160612 CACCTGTAATCTCTGCACTTTGG - Intergenic
1161105112 19:2439664-2439686 CACTTCTGACCTCTGGCCACGGG - Intronic
1161538778 19:4836860-4836882 CACCTGTAACCTCAGTACTTTGG + Intergenic
1161587191 19:5111991-5112013 CACCTGTAATCTCTGCACTTTGG + Intronic
1162037325 19:7948456-7948478 CACCTGTAATCTCTGCACTTTGG + Intergenic
1162257751 19:9505922-9505944 CACCTGTAATCTCAGCACATTGG - Intergenic
1162918728 19:13888163-13888185 CACCTGTAATCTCAGGACTTTGG - Intronic
1162978690 19:14224174-14224196 CACCTGTAATCTCTGCACTTTGG - Intergenic
1163337576 19:16683326-16683348 CACCTGTAATCTCTGCACTTTGG + Intronic
1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG + Intronic
1164286980 19:23825847-23825869 CACCTGTAATCTCAGTACATTGG - Intronic
1164290394 19:23863301-23863323 CACCTGTAATCTCAGCACATTGG + Intergenic
1164311533 19:24050418-24050440 CACCTGTAATCTCAGCACATTGG - Intronic
1165166768 19:33862634-33862656 CACCTGTAACCCCAGCACATTGG + Intergenic
1165359933 19:35329966-35329988 CACCATTAATCTCTAGACATGGG - Intronic
1165541136 19:36492657-36492679 CACCTCTAGTCTCTGCACACAGG - Intergenic
1165728996 19:38132297-38132319 CACCTGTAACCTCAGCACTTCGG + Intronic
1165761085 19:38321422-38321444 CACCTGTTCCCTCTGGACCTGGG + Intronic
1165984301 19:39754145-39754167 CACCTATAATCTCAGGACTTTGG + Intergenic
1166191055 19:41176906-41176928 CACCTGTAATCTCAGCACATTGG - Intergenic
1166545136 19:43629875-43629897 CACCTGTAATCCCTGGACTTTGG - Intronic
1166570719 19:43795225-43795247 CACCTGTAATCTCAGCACATTGG + Intergenic
1167022563 19:46889056-46889078 CACCTGTAACCCCTGCACTTTGG + Intergenic
1167891639 19:52544587-52544609 CACCTTTAACCTCAGCACTTAGG - Intronic
1168672984 19:58255437-58255459 CACCTGTAATCTCTGCACTTTGG - Intronic
925240045 2:2317075-2317097 CACCTATAACCTCAGCACTTTGG - Intronic
925372299 2:3355546-3355568 CACCTCTAATCTCAGCACTTTGG + Intronic
926191163 2:10728876-10728898 CACCTATAATCTCAGGACTTCGG + Intronic
927563927 2:24094330-24094352 CACCTGTAATCTCTGTACTTTGG - Intronic
928761722 2:34591191-34591213 CACCTCTAACCCCAGCACTTTGG - Intergenic
929537807 2:42794543-42794565 CACCTCTCTCCTCTGCACACAGG + Intergenic
929582591 2:43092162-43092184 CACCTCTAACCCCAGCACTTTGG - Intergenic
930319456 2:49835963-49835985 CACCTGTAATCTCTGCACTTTGG + Intergenic
930797758 2:55410622-55410644 CGCCTCTAATCTCTGCACTTTGG + Intronic
932106477 2:68947848-68947870 CACCTCTAATCTCAGCACTTTGG - Intronic
933447389 2:82398971-82398993 CACCTATAATCTCAGGACTTTGG - Intergenic
933725282 2:85423491-85423513 CACCTCTAACCCCAGCACTTTGG - Intronic
933823687 2:86139238-86139260 CACCTGTAACCTCAGCACTTTGG + Exonic
934507362 2:94904827-94904849 ATCCTCTTCCCTCTGGACATTGG - Intergenic
935648754 2:105363994-105364016 CACCTGTAATCTCAGGACTTTGG + Intronic
935957714 2:108394749-108394771 CACCTCTAATCCCAGGACTTTGG - Intergenic
936267994 2:111024999-111025021 CACCACTAGCATCTGGATATAGG + Intronic
936518127 2:113195420-113195442 CACCTCTAATCCCTGCACTTTGG - Intronic
936557451 2:113508887-113508909 AACCTCTATCCCCTGGATATTGG + Intergenic
937754398 2:125518285-125518307 CACCTCTAATCTCAGAACTTTGG + Intergenic
938053666 2:128197321-128197343 CACCTGTAACCCCAGGACTTTGG + Intergenic
938923273 2:136014955-136014977 CACCTGTAACCTCAGCACTTTGG + Intergenic
939885874 2:147681224-147681246 CACCTGTAACCTCAGCACTTTGG - Intergenic
940067958 2:149650954-149650976 CACCTCTGACCTCTCTCCATTGG - Intergenic
941678195 2:168366680-168366702 CACCTGTAATCTCAGGACTTTGG + Intergenic
941932146 2:170952934-170952956 CACCTATAATCTCAGGACTTTGG - Intronic
941944186 2:171076637-171076659 CACCTGTAACCTCAGCACTTTGG + Intronic
942283691 2:174392255-174392277 CACCTGTAATCTCTGCACTTTGG - Intronic
943365527 2:186963927-186963949 CACCTCTAATCCCAGCACATTGG - Intergenic
944391837 2:199226436-199226458 CAACTCTAACCATTGGACCTTGG + Intergenic
944562302 2:200952848-200952870 CACCTCTAATCTCAGCACTTTGG + Intronic
944708616 2:202315802-202315824 CACCTATAACCTCAGGACTTTGG + Intergenic
944812722 2:203343867-203343889 CACCTCTAATCTCAGCACTTTGG + Intronic
944919331 2:204394878-204394900 CACCTCCAACCTCTGTAGTTTGG - Intergenic
945973443 2:216252492-216252514 CAACTCTAACCTGTGGAAAAAGG + Intergenic
946062043 2:216950763-216950785 CACCTCTGACCTCTGACCACTGG - Intergenic
946680610 2:222211122-222211144 CACCTATAATCTCAGGACTTTGG - Intronic
948011639 2:234653632-234653654 CACCTATAATCTCTGCACTTTGG - Intergenic
948209510 2:236182204-236182226 CACCTGTAACCTCTGCACTTTGG - Intergenic
948985246 2:241518099-241518121 CACCTCTAACCCCAGCACTTTGG + Intergenic
1169369060 20:5014698-5014720 CACCTGTAATCTCAGGACTTTGG + Intergenic
1169374346 20:5054478-5054500 CACCTCTAATCTCAGCACTTTGG + Intergenic
1169721484 20:8682238-8682260 CGCCTGTAACCTCAGGACTTTGG + Intronic
1169890618 20:10447963-10447985 CACCTGTAATCTCAGGACTTTGG - Intronic
1171979209 20:31615522-31615544 CGCCTGTAATCTCTGCACATTGG - Intergenic
1171992898 20:31709944-31709966 CACCTGTAACCTCAGCACTTTGG - Intronic
1171998547 20:31752872-31752894 CACCTGTAACCTCAGCACTTTGG - Intronic
1172041330 20:32048295-32048317 CACCTGTAATCCCAGGACATTGG - Intergenic
1172449126 20:35009392-35009414 CACCTGTAATCCCTGGACTTTGG + Intronic
1172742737 20:37181677-37181699 CACCTCTAACCCCAGCACTTTGG - Intronic
1173170074 20:40716595-40716617 CACCTCTGACTCCTGGACTTGGG + Intergenic
1173602513 20:44306149-44306171 CACCTCTAATCCCTGCACTTTGG - Exonic
1173929235 20:46804772-46804794 CACCTATAATCTCAGCACATTGG + Intergenic
1174005011 20:47403516-47403538 CACCTGTAACCTCAGCACTTTGG - Intergenic
1174010439 20:47445259-47445281 CACCTGTAACCTCAGCACTTTGG - Intergenic
1175097022 20:56549343-56549365 CACCTGTAACCCCAGCACATTGG + Intergenic
1175829901 20:61958068-61958090 CACCTGTAACCTCAGCACTTTGG + Intronic
1176773233 21:13102749-13102771 CACCTGTAATCTCAGCACATTGG + Intergenic
1176920906 21:14686264-14686286 CACCTGTAATCTCAGCACATTGG - Intergenic
1176978397 21:15351114-15351136 CACCTGTAACCTCAGCACTTTGG + Intergenic
1177163404 21:17573646-17573668 CACCTGTAATCTCTGCACTTTGG + Intronic
1177278567 21:18948670-18948692 CACCTGTAATCCCAGGACATTGG - Intergenic
1177841499 21:26239159-26239181 CACCTGTAACCTCAGCACTTTGG - Intergenic
1177948362 21:27501465-27501487 CACCTGTAACCTCAGCACTTTGG - Intergenic
1178233956 21:30820663-30820685 CACCTGTAATCTCAGCACATTGG - Intergenic
1178303158 21:31469359-31469381 CACCTCTAATCTCAGCACTTTGG - Intronic
1179336195 21:40457249-40457271 CACCTGTAACCTCAGCACTTCGG + Intronic
1179708981 21:43201066-43201088 CAACTGTAACCTCAGCACATTGG - Intergenic
1179806006 21:43837575-43837597 CACCTGTAATCTCAGCACATTGG + Intergenic
1180728409 22:17963010-17963032 CACCTCTAATCTCAGCACTTTGG - Intronic
1181144220 22:20832713-20832735 CACCTGTAATCTCTGCACTTTGG - Intronic
1181749533 22:24979274-24979296 CACCTCTAATCCCAGCACATTGG - Intronic
1182522829 22:30893804-30893826 CTCCTGTCACCTGTGGACATTGG - Exonic
1182788438 22:32928068-32928090 CACCTGTAACCTCAGTACTTTGG + Intronic
1183119723 22:35721004-35721026 CACCTCTAATCCCAGCACATTGG - Intronic
1183860047 22:40663288-40663310 CACCTCTAATCCCAGCACATTGG + Intergenic
1184066016 22:42121424-42121446 CACCTATAATCTCTGCACTTTGG + Intergenic
1184095433 22:42313858-42313880 CGCCTCTAACCTCAGCACTTTGG - Intronic
1184426550 22:44412199-44412221 CTCCTCTGACCTCTGGGCACTGG + Intergenic
949669024 3:6377037-6377059 CACCTGTAATCTCCGGACTTTGG + Intergenic
949996641 3:9622480-9622502 CACCTGTAATCTCTGCACTTTGG - Intergenic
950618024 3:14178196-14178218 CATCTGTATCCTCTGGACAACGG + Intronic
951195449 3:19818661-19818683 CACCTATAATCTCTGCACTTTGG + Intergenic
951878571 3:27457114-27457136 CCCCTCTAACTACTGGACTTGGG + Intronic
952791659 3:37205420-37205442 CACCTCTAATCTCAGCACTTTGG + Intergenic
954049425 3:47961239-47961261 CACCTATAATCCCAGGACATTGG + Intronic
954818191 3:53300906-53300928 CACCTGTAATCTCGGGACTTTGG - Intronic
955139479 3:56255168-56255190 TACCTCTAACTTCTTGACACTGG + Intronic
955288566 3:57669130-57669152 CACCTGTAATCTCAGGACTTTGG - Intronic
955288585 3:57669453-57669475 CACCTCTAATCTCAGCACTTTGG + Intronic
955323870 3:57994767-57994789 CACCTGTAATCTCTGCACTTTGG + Intergenic
955639405 3:61066351-61066373 CACCTATAACCTCAGCACTTTGG + Intronic
955959123 3:64320853-64320875 CACCTCTAATCTCAGCACTTTGG + Intronic
957298747 3:78363826-78363848 CACCTATAATCTCAGCACATTGG - Intergenic
957299100 3:78367646-78367668 CACCTCTAATCTCAGCACTTTGG - Intergenic
959661062 3:108868715-108868737 CACCTCTAACCCCAGCACTTTGG + Intergenic
961145704 3:124591396-124591418 CACCTGTAACCTCAGCACTTTGG - Intronic
961230246 3:125300230-125300252 CACCTCTAATCTCAGCACTTTGG - Intronic
961240715 3:125408589-125408611 CACCTGTAACCTCAGCACTTCGG - Intergenic
961352026 3:126310196-126310218 CACCTCTTAACACTGCACATTGG + Intergenic
961887884 3:130108245-130108267 CACCTGTAATCCCAGGACATTGG - Intronic
962258035 3:133885503-133885525 CTCCCCTATCCTCTGGTCATTGG - Intronic
962305690 3:134284000-134284022 CACCTCTAATCTCGGCACTTTGG + Intergenic
962490968 3:135893852-135893874 CATCTCCACCCTCAGGACATTGG + Intergenic
962790643 3:138808368-138808390 CACCTGTAACCTCAGCACTTTGG + Intronic
963096217 3:141544134-141544156 CACCTATAACCCCAGGACTTTGG - Intronic
963622699 3:147632470-147632492 CACCTGTAATCTCAGCACATTGG + Intergenic
964187074 3:153958931-153958953 TACCTGTAACCTCAGGACTTTGG - Intergenic
964237954 3:154556077-154556099 CACCTGTAATCTCAGGACTTTGG - Intergenic
964678762 3:159314558-159314580 CACCTTCTACCTCTGGACATAGG + Intronic
965139023 3:164812157-164812179 CACCTCTAACCCCAGAACTTTGG + Intergenic
965267120 3:166558200-166558222 CCTCTCTAACTTCTTGACATGGG + Intergenic
967475852 3:189917454-189917476 CACCTCTAATCTCAGAACTTTGG + Intergenic
968945224 4:3660095-3660117 CACCCGCAACCACTGGACATGGG - Intergenic
969716192 4:8869410-8869432 CACCTCTAACCTGTCAACCTGGG - Intronic
969816945 4:9694077-9694099 CACCTGTAATCTCAGGACTTTGG + Intergenic
971193024 4:24445805-24445827 CGCCTCTAATCTCTGCACTTTGG + Intergenic
971845523 4:31913428-31913450 CACCTGTAACCCCAGCACATTGG - Intergenic
972038362 4:34556265-34556287 CACCTCTAATCTCAGCACTTTGG + Intergenic
972111482 4:35565881-35565903 CACCTGTAATCTCAGGACTTTGG - Intergenic
972272975 4:37530309-37530331 CACCTGTAATCTCAGGACTTTGG + Intronic
972389237 4:38597432-38597454 CACCTGTAACCTCAGCACTTTGG - Intergenic
972593955 4:40513977-40513999 CACCTGTAACCTCAGCACTTTGG - Intronic
973984708 4:56339403-56339425 CACCTGTAATCTCTGCACTTTGG - Intronic
974073304 4:57145392-57145414 CACCTGTAACCCCAGCACATTGG - Intergenic
975074489 4:70188111-70188133 CACCTCTAATCTCAGCACTTTGG + Intergenic
975315433 4:72946594-72946616 CTCCTTTATCCTCTGGAAATGGG + Intergenic
975439669 4:74396674-74396696 CACCTGTAATCTCTGCACTTTGG - Intergenic
975561544 4:75713031-75713053 CACCTCTAACCTATGGGAATAGG - Intronic
976151151 4:82093366-82093388 CACCTGTAACCTCAGCACTTTGG + Intergenic
977022269 4:91772845-91772867 CACCTGTAACCCCTGCACTTTGG - Intergenic
978274242 4:106929983-106930005 AACCTCTAACTTCAGCACATAGG - Intronic
978592414 4:110339821-110339843 CAACTCAAACCTCTCGATATAGG + Intergenic
978668512 4:111216235-111216257 CACATTTAACTCCTGGACATGGG + Intergenic
978748793 4:112224122-112224144 CACCTGTAATCTCTGCACTTTGG - Intergenic
979347095 4:119601238-119601260 CACCCCCAACCTCTGGAGAGGGG + Intronic
979855949 4:125635018-125635040 CACCTGTAATCTCAGGACTTTGG + Intergenic
980228741 4:130020594-130020616 CACCTCTGACCTCTGGGAAGGGG - Intergenic
980493716 4:133563238-133563260 CACCTCTAATCCCAGGACTTTGG - Intergenic
981314176 4:143325457-143325479 CACCTATAATCTCTGCACTTTGG + Intergenic
982115510 4:152095482-152095504 CGCCTGTAACCTCAGCACATTGG - Intergenic
982565210 4:156977337-156977359 CACCTTTAAGCCCTGGACTTTGG + Intergenic
983191969 4:164764306-164764328 CACCTGTAACCTCAGCACTTTGG + Intergenic
983607355 4:169603959-169603981 CACCTCTAATCTCAGCACTTTGG - Intronic
983744602 4:171182278-171182300 CACCTCTAATCTCAGCACTTTGG + Intergenic
984859349 4:184222930-184222952 CACCTGTAACCTCAGCACTTTGG + Intergenic
986511224 5:8508380-8508402 CACCACTAAGTTCTGGACAATGG - Intergenic
988781766 5:34529002-34529024 CACCTGTAATCTCTGCACTTTGG + Intergenic
988925380 5:35984731-35984753 CACCTGTAATCTCAGGACTTTGG - Intronic
989049575 5:37306128-37306150 CACCTCTAATCTCAGCACTTTGG + Intronic
989282636 5:39663434-39663456 CATGTCTAAACTCTGTACATGGG + Intergenic
989844097 5:46117484-46117506 CACCTGTAACCCCAGCACATTGG - Intergenic
990763311 5:59154624-59154646 CACCTGTAACCTCAGCACTTTGG + Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991682231 5:69150860-69150882 CACCTGTAACCCCAGCACATCGG + Intergenic
993023815 5:82623825-82623847 CACCTCTAACCCCAGCACTTTGG - Intergenic
993301669 5:86219425-86219447 CACCTGTAATCTCAGGACTTTGG + Intergenic
993380878 5:87205643-87205665 CACCTGTAATCCCTGGACTTTGG - Intergenic
994274936 5:97823812-97823834 CACCTGTAATCTCAGCACATTGG - Intergenic
997098450 5:130940757-130940779 CACCTGTAATCCCAGGACATTGG + Intergenic
997461351 5:134054719-134054741 CACCTGTAATCTCAGCACATTGG - Intergenic
999379793 5:151112569-151112591 CACCTGTAATCCCAGGACATTGG + Intronic
999546997 5:152640663-152640685 CACCTGTAATCTCAGGACTTTGG + Intergenic
999821282 5:155231576-155231598 CACCTCTAACCCCAGCACTTTGG - Intergenic
1000060340 5:157649953-157649975 CACCTGTAACCTCAGTACTTTGG + Intronic
1001332718 5:170773490-170773512 CACCTGTAATCTCTGCACTTTGG + Intronic
1001544040 5:172558936-172558958 CACCTGTAACCTGGGGACAGTGG + Intergenic
1001806657 5:174592505-174592527 CACCTGTAATCTCAGCACATTGG + Intergenic
1003083932 6:3045922-3045944 CATCACTTACCTCTGGACACTGG + Intergenic
1003515844 6:6818157-6818179 CACCTCTAATCTCAGCACTTTGG - Intergenic
1004546644 6:16604228-16604250 CACCTGTAACCTCAGCACTTTGG + Intronic
1005002184 6:21253236-21253258 CACCTGTAACCTCAGCACTTTGG + Intergenic
1005063817 6:21798777-21798799 CACCTGTAATCTCAGCACATTGG - Intergenic
1005679459 6:28191590-28191612 CACCTGTAATCTCAGGACTTCGG - Intergenic
1005890606 6:30134892-30134914 CACCTCTGACCTCTGGGGAGGGG - Intergenic
1006077610 6:31544127-31544149 CACCTCTAATCTCAGCACTTTGG + Intronic
1006118173 6:31786404-31786426 CACCTGTAACCCCAGGACTTTGG + Intronic
1006329943 6:33383208-33383230 CACCTCTAATCTCAGCACTTTGG - Intergenic
1006679879 6:35789232-35789254 CCCTTCTAACTTCTTGACATTGG - Intronic
1006981578 6:38152141-38152163 CCCCTCCATCCTCTGGACAAAGG + Intronic
1007267943 6:40611352-40611374 CACCTGTAATCTCAGGACTTTGG - Intergenic
1008599604 6:53078191-53078213 CACCTCTAATCTCAGCACTTTGG + Intronic
1009037402 6:58134302-58134324 CACCTGTAATCTCAGCACATTGG + Intergenic
1009213196 6:60887922-60887944 CACCTGTAATCTCAGCACATTGG + Intergenic
1009541431 6:64964769-64964791 CACCTGTAATCCCAGGACATTGG + Intronic
1009927299 6:70135340-70135362 CACCTCCAACCTCTGGGGAGGGG - Intronic
1009966434 6:70583371-70583393 CACCTGTAACCTCAGCACTTTGG - Intronic
1010509697 6:76703172-76703194 CACCTCTAATCCCAGGACTTTGG + Intergenic
1010843491 6:80676873-80676895 CACCCCTAAACTCTGTACACTGG - Intergenic
1011276703 6:85638947-85638969 CACCTGTAATCTCAGGACTTTGG + Intronic
1011673274 6:89704838-89704860 CGCCTCTAACCCCAGGACTTTGG - Intronic
1011976600 6:93308832-93308854 GGGCTCTAACCTCTGCACATAGG + Intronic
1012326242 6:97921732-97921754 CACCTAGAACCAGTGGACATGGG - Intergenic
1012645961 6:101681493-101681515 CACCTGTAATCCCTGGACTTCGG - Intronic
1012947932 6:105487695-105487717 CACCTGTAATCTCTGCACTTTGG + Intergenic
1012966543 6:105680647-105680669 CACCTGTAATCTCAGCACATTGG + Intergenic
1013137673 6:107298003-107298025 CACCTGTAATCTCAGGACTTTGG - Intronic
1013215846 6:108026617-108026639 CACCTGTAACCTCAGCACTTTGG + Intergenic
1013787522 6:113798076-113798098 CACCTCTAATCCCAGGACCTGGG - Intergenic
1016920560 6:149289117-149289139 CACCTGTAATCTCAGGACTTTGG - Intronic
1017144592 6:151222835-151222857 CACCTGTAACCTCAGCACTTTGG - Intergenic
1018243938 6:161803961-161803983 CACTTCTGACCTCTACACATCGG - Intronic
1018506119 6:164471400-164471422 CACCTATAACCTCAGCACTTTGG - Intergenic
1018649997 6:165985676-165985698 CACCCCTGCCCTCTGGACACAGG + Intronic
1018780533 6:167059885-167059907 CCCCTCCAACCTCTGGAAAAGGG - Intergenic
1019101235 6:169631924-169631946 CACCTGTAATCTCTGCACTTTGG + Intronic
1019775339 7:2909254-2909276 CACCTCTCACCTCTGGACACGGG - Intronic
1019857728 7:3626198-3626220 CACCTGTAACCTCAGCACTTTGG - Intronic
1019998774 7:4742675-4742697 CACCTGTAACCTCAGCACTTTGG - Intronic
1020131393 7:5560660-5560682 CACCTGTAACCTCAGCACTTCGG - Intronic
1020259380 7:6522087-6522109 CACCTGTAACCTCAGCACTTTGG + Intronic
1020849317 7:13330783-13330805 CACCTGTAACCCCAGCACATTGG - Intergenic
1021979365 7:26039673-26039695 CACCTCTGGGCTCTGGCCATGGG - Intergenic
1022168071 7:27792699-27792721 CACCTATAACCTCAGCACTTTGG + Intronic
1023416954 7:39942246-39942268 CACCTCTAATCTCAGCACTTTGG - Intergenic
1023418639 7:39954880-39954902 CACCTGTAATCCCTGGACTTTGG - Intronic
1023721670 7:43101605-43101627 CACCTGTAATCTCAGGACTTTGG - Intergenic
1024732598 7:52269932-52269954 CACCACAAATATCTGGACATTGG + Intergenic
1026820337 7:73543436-73543458 CACCTGTAACCTCAGCACTTTGG - Intronic
1026842474 7:73677847-73677869 CACCTGTAATCTCTGCACTTCGG - Intergenic
1026992032 7:74591878-74591900 CACCTGTAACCTCAGCACTTTGG - Intronic
1027143241 7:75675716-75675738 CACCTGTAATCCCAGGACATTGG + Intronic
1027612920 7:80384600-80384622 CACCTGTAACCTCAGCACTTTGG - Intronic
1028544982 7:91987909-91987931 CACCTGTAATCTCTGCACTTTGG + Intronic
1029086484 7:98015762-98015784 CACCTCTAATCTCAGCACTTTGG - Intergenic
1029281347 7:99437923-99437945 CACCTGTAACCTCAGCACTTTGG - Intronic
1029684708 7:102138982-102139004 CACCTCTAATCTCAGCACTTTGG + Intronic
1030045919 7:105495491-105495513 CACCTGTAATCTCAGGACTTTGG + Intronic
1030832138 7:114237711-114237733 CACCTCTAATCTCAGCACTTTGG + Intronic
1032347577 7:131131093-131131115 CACCTGTAATCTCAGGACTTTGG + Intronic
1033094936 7:138422369-138422391 CACCTGTAACCTCAGCACTTTGG - Intergenic
1033119693 7:138656780-138656802 CACCTGTAATCTCTGCACTTTGG + Intronic
1033430423 7:141284215-141284237 CATCTCTAACCTCTGGAGACAGG - Intronic
1034134780 7:148756595-148756617 CACCTCTAATCTCAGCACTTTGG - Intronic
1034699358 7:153083146-153083168 CATCTCTTACCCCTGGACAGAGG - Intergenic
1036414971 8:8538444-8538466 CACCTGTAATCTCAGGACTTTGG - Intergenic
1037572993 8:20174171-20174193 CACCTGTAACCCCTGCACTTTGG - Intronic
1038219783 8:25596215-25596237 CACCTGTAACCTCAGCACTTTGG - Intergenic
1038496282 8:28005692-28005714 CACCTGTAACCTCAGAACATTGG + Intergenic
1038869891 8:31482260-31482282 CACCTCTACCCTCCTGACATAGG - Intergenic
1039392108 8:37189628-37189650 CACCTGTAACCTCAGCACTTTGG + Intergenic
1039784682 8:40823396-40823418 CACCTATAACCTCAGCACTTTGG + Intronic
1042203080 8:66300722-66300744 CACCTGTAACCCCAGCACATTGG + Intergenic
1042903393 8:73749220-73749242 CACCTGTAACCTCAGCACTTCGG + Intronic
1043434582 8:80226086-80226108 CACCTCTAATCTCAGCACTTTGG + Intronic
1044293422 8:90499777-90499799 CACCTGTAATCCCTGGACTTTGG + Intergenic
1044680912 8:94776427-94776449 CACCTGTAATCTCAGGACTTTGG - Intronic
1044867571 8:96587182-96587204 CACCTATAACCTCAGCACTTTGG - Intronic
1044971038 8:97620046-97620068 CACCTCTAATCTCAGCACTTTGG + Intergenic
1045577758 8:103444484-103444506 CACCTCTAATCTCAGCACTTTGG - Intergenic
1045716762 8:105056080-105056102 CACCTGTAATCTCTGCACTTTGG - Intronic
1046938124 8:119905066-119905088 CACCTGTAACCTCAGCACTTTGG - Intronic
1047055440 8:121159533-121159555 CACCTCTAACTTCTGCTCACTGG - Intergenic
1047797528 8:128273237-128273259 GACCTCTCACCTCTGGGCTTTGG + Intergenic
1047962372 8:130020133-130020155 CTCCTCACACCTCTGGCCATTGG + Intergenic
1048379545 8:133853178-133853200 CACCCCTATCCTCTGGAGAATGG - Intergenic
1048726439 8:137390571-137390593 CACCTGTAACCTCAGCACTTTGG - Intergenic
1048797598 8:138165378-138165400 CACCTGTAATCTCTGCACTTTGG - Intronic
1049174824 8:141185562-141185584 CACCTCTAATCTCAGCACTTTGG + Intronic
1049429707 8:142555047-142555069 CACCTCCCACCTCTGGGCAGGGG + Intergenic
1049895552 9:108411-108433 AACCTCTATCCCCTGGATATTGG - Intergenic
1050142256 9:2528395-2528417 CACCTGTAATCTCAGGACTTTGG + Intergenic
1050222858 9:3415338-3415360 CGCCTCTAATCTCTGCACTTTGG - Intronic
1050289722 9:4141058-4141080 CACCTATAATCTCTGAACTTTGG - Intronic
1051150047 9:14070296-14070318 CACCTGTAACCTCAGCACTTTGG - Intergenic
1051239862 9:15042726-15042748 CACCTGTAATCTCTGCACTTTGG + Intergenic
1052908630 9:33860065-33860087 CACCTGTAATCTCAGCACATTGG - Intronic
1053854913 9:42329191-42329213 CACCTGTAACCTCAGTACTTTGG + Intergenic
1054569316 9:66792460-66792482 CACCTGTAACCTCAGTACTTTGG - Intergenic
1056628235 9:88271903-88271925 CACCTGTAACCCCTGCACCTTGG + Intergenic
1058382771 9:104396027-104396049 CACCTCTAATCTCAGCACTTTGG - Intergenic
1058788875 9:108421132-108421154 CACCTGTAAACTCAGGACTTTGG + Intergenic
1058908358 9:109498839-109498861 CTTCACTAACCTCAGGACATTGG + Intergenic
1059425393 9:114217781-114217803 CACCTCTGGCCTCTGAACTTTGG - Intronic
1059481627 9:114595126-114595148 CACCTCTAATCCCTGCACTTTGG - Intronic
1059725513 9:117004649-117004671 GACCTCTGACCTCTGCACAGAGG + Intronic
1060512628 9:124244922-124244944 CACCTCTAATCTCAGCACTTTGG - Intergenic
1060610263 9:124957628-124957650 CACCTCTAATCTCAGCACTTTGG - Intronic
1061023384 9:128031581-128031603 CACCTGTAATCTCAGGACTTTGG + Intergenic
1061049909 9:128189059-128189081 CACCTGTAATCTCAGCACATTGG - Intronic
1062300709 9:135866632-135866654 CACCTCTGACTCCTAGACATAGG + Intronic
1186243783 X:7598508-7598530 CACCTGTAACCTCAGCACTTTGG - Intergenic
1186277920 X:7959971-7959993 CACTTCTAACATCTGTACTTGGG + Intergenic
1186328446 X:8506232-8506254 CACCTCTAATCCCAGGACTTGGG - Intergenic
1187164262 X:16790056-16790078 CACCTGTAACCTCAGCACTTTGG - Intronic
1187415384 X:19088728-19088750 CACCTGTAATCTCAGGACTTTGG - Intronic
1187519219 X:19999009-19999031 CACCTGTAACCCCAGGACTTTGG - Intergenic
1190898000 X:54639986-54640008 TGGCTCTAACCTCTGGACAGCGG - Intergenic
1193095740 X:77546742-77546764 CACCTCTAATCTCAGCACTTTGG - Intronic
1193529479 X:82638904-82638926 CACCTGTAACCCCAGGACTTTGG - Intergenic
1195488880 X:105442813-105442835 CACCTGTAACCTCAGCACTTTGG + Intronic
1196043147 X:111227757-111227779 CTCCTGTGACCTCTGGACTTTGG - Intergenic
1196536902 X:116856861-116856883 CACCTGTAACCTCAGCACTTTGG + Intergenic
1196719097 X:118837227-118837249 CACCTCTAATCTCAGCACCTTGG - Intergenic
1196805623 X:119582850-119582872 CACCTGTAACCTCAGCACTTTGG + Intronic
1198183138 X:134229539-134229561 CACCTGTAATCTCTGGACTTTGG + Intergenic
1198547055 X:137703461-137703483 CACCTGTAATCTCTGCACTTTGG - Intergenic
1198755224 X:139975363-139975385 CACCTGTAATCTCAGGACTTTGG - Intergenic
1199744855 X:150766071-150766093 CCTCTCTAACCCCAGGACATTGG + Intergenic
1202348989 Y:23966813-23966835 CACCTGTAACCTCAGGGCTTCGG + Intergenic
1202521786 Y:25703291-25703313 CACCTGTAACCTCAGGGCTTCGG - Intergenic
1202590051 Y:26473165-26473187 CACCTCTAATCTCAGCACTTTGG + Intergenic