ID: 1163725625

View in Genome Browser
Species Human (GRCh38)
Location 19:18921675-18921697
Sequence CCCGGAACTGCTCTGCGATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163725625_1163725631 -4 Left 1163725625 19:18921675-18921697 CCAGATCGCAGAGCAGTTCCGGG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1163725631 19:18921694-18921716 CGGGTCCTGGGGAAGCCTCTAGG 0: 1
1: 0
2: 0
3: 30
4: 297
1163725625_1163725635 20 Left 1163725625 19:18921675-18921697 CCAGATCGCAGAGCAGTTCCGGG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1163725635 19:18921718-18921740 CTGAAAGACTGCATCATCGTCGG 0: 1
1: 0
2: 0
3: 4
4: 64
1163725625_1163725636 23 Left 1163725625 19:18921675-18921697 CCAGATCGCAGAGCAGTTCCGGG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1163725636 19:18921721-18921743 AAAGACTGCATCATCGTCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1163725625_1163725637 28 Left 1163725625 19:18921675-18921697 CCAGATCGCAGAGCAGTTCCGGG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1163725637 19:18921726-18921748 CTGCATCATCGTCGGTGGCATGG 0: 1
1: 0
2: 0
3: 1
4: 47
1163725625_1163725632 -3 Left 1163725625 19:18921675-18921697 CCAGATCGCAGAGCAGTTCCGGG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1163725632 19:18921695-18921717 GGGTCCTGGGGAAGCCTCTAGGG 0: 1
1: 0
2: 1
3: 25
4: 208
1163725625_1163725638 29 Left 1163725625 19:18921675-18921697 CCAGATCGCAGAGCAGTTCCGGG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 1163725638 19:18921727-18921749 TGCATCATCGTCGGTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163725625 Original CRISPR CCCGGAACTGCTCTGCGATC TGG (reversed) Exonic
903807574 1:26016458-26016480 CCAGGAACTGCTCTGCATCCTGG + Intergenic
908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG + Exonic
913793140 1:122565144-122565166 TCAGAAACTGCTCTGCGATGTGG + Intergenic
913796301 1:122621254-122621276 TCAGAAACTGCTCTGCGATGTGG + Intergenic
914807079 1:150999488-150999510 CCAGGAACTGCTCTGCAATCAGG + Exonic
1071526752 10:86363748-86363770 GCCGGGACTGCTCTGCGCTGCGG - Intronic
1073424798 10:103449911-103449933 AGCGGAAGTTCTCTGCGATCAGG + Exonic
1076342242 10:129757362-129757384 CTCGGAACTGCTCTGTGCTCCGG + Intronic
1076745430 10:132510414-132510436 CCCAGGTCTGCTCTGCGACCGGG - Intergenic
1079597042 11:22262777-22262799 CCTGGCACTGGTCTGTGATCAGG + Intronic
1080588262 11:33700308-33700330 CCCGGAGGAGCTCTGCGAGCTGG - Exonic
1081547426 11:44081292-44081314 CCCGGAGCAGCTGTGCCATCTGG - Exonic
1089712670 11:120327184-120327206 CCAGGAACTGCACTCCGAGCTGG - Exonic
1099171251 12:79367366-79367388 CCAGGAGCTGCTCTGGGACCAGG - Intronic
1112173154 13:96994355-96994377 CCCGGGACAGGTCTGCGGTCCGG - Intronic
1112491431 13:99867900-99867922 CCCAGAACTTCTCTGGGAGCTGG + Intronic
1122606329 14:102949033-102949055 CACGGGACTGCTCTGGGCTCAGG - Intronic
1122652028 14:103231407-103231429 CCAGGAACTGCCCTGTGCTCGGG + Intergenic
1124638402 15:31379699-31379721 CCCGAAACTGCTTTGTGACCTGG - Intronic
1132696552 16:1204741-1204763 CCCGGCACTGATCTGGGAGCAGG - Intronic
1139649931 16:68357111-68357133 CCCAGCAGTGCTCTGGGATCTGG - Exonic
1140897986 16:79342123-79342145 CCCTGAACTTCTCTGAGATTCGG - Intergenic
1145830237 17:27910351-27910373 CCAGGCACTGCTCTGGGCTCTGG + Intergenic
1145983074 17:29025703-29025725 CCAGGAATTGCTCTGAGAACCGG - Intronic
1146517223 17:33498641-33498663 CCCGGCACTGCGCTGGGCTCTGG + Intronic
1162080654 19:8215769-8215791 CCTGGCACTCCTCTGTGATCTGG + Intronic
1163725625 19:18921675-18921697 CCCGGAACTGCTCTGCGATCTGG - Exonic
1164696818 19:30251142-30251164 CCAGGGAGTGCTCTGTGATCAGG - Intronic
934531412 2:95091530-95091552 CCAGGTACTGCTCTGGGCTCTGG - Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
942036201 2:172013155-172013177 CCCGGAAATGCTCTGTGGCCTGG - Intronic
945587943 2:211690484-211690506 CCCGAAACTGCTCTGAAATTGGG - Intronic
1168981481 20:2007633-2007655 CCCGTTACTGCTCTTCAATCTGG - Intergenic
1181275823 22:21686977-21686999 CCTGGAGCTGCACTGCGACCTGG + Exonic
1182785907 22:32907493-32907515 CCAGGAACTGCTCTAAGCTCTGG + Intronic
1184586630 22:45452476-45452498 CCAGGAACTGCCCTGAGACCAGG + Intergenic
1185030970 22:48442727-48442749 CCAGGACCTGCTCTGGGCTCTGG + Intergenic
1185385152 22:50528505-50528527 CCCGTACCTGCTCTGGGCTCTGG + Exonic
950429406 3:12942198-12942220 CCAGGCACTGCTCTGGGCTCTGG - Intronic
966449004 3:180036778-180036800 CCGGGAACTGTTCTCCGCTCGGG + Exonic
968512868 4:1003118-1003140 GCCGGAACTGCTCTGCCGTGGGG - Exonic
978391813 4:108235203-108235225 CCAGTAGCTGCTCTGAGATCTGG - Intergenic
982128146 4:152202136-152202158 CCCAGAACTACTCTTCGATAGGG - Intergenic
985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG + Exonic
991295295 5:65074013-65074035 CACGAAACAGCTCTGTGATCTGG + Intergenic
996644646 5:125799071-125799093 CTCAGAACTGCTTTGCTATCTGG - Intergenic
1019338326 7:495443-495465 CCAGCAACTGCTCTGCGCACTGG + Intergenic
1026944568 7:74307372-74307394 CCCCGAACTTCTCTGCACTCGGG + Intronic
1029439188 7:100577861-100577883 CCCGGGCCAGCTCTGAGATCCGG + Exonic
1058828241 9:108793876-108793898 CCTGAAACTGCCCTGGGATCTGG - Intergenic
1190318549 X:49166085-49166107 CCAGGATCTGGGCTGCGATCTGG - Exonic
1192990809 X:76454230-76454252 CCTGGAACAACTCAGCGATCTGG + Intergenic
1197892142 X:131278575-131278597 CCCGGACCTGCTCTGAGGCCGGG + Exonic
1199574824 X:149303733-149303755 CCCAGCACTGATCTGCTATCTGG - Intergenic