ID: 1163726912

View in Genome Browser
Species Human (GRCh38)
Location 19:18928254-18928276
Sequence CGTCCACCCAGGACACCGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163726912 Original CRISPR CGTCCACCCAGGACACCGTC TGG Exonic
900655305 1:3753956-3753978 CCCACACCCAGGACACCGTGTGG - Intronic
902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG + Exonic
918446646 1:184623581-184623603 CATCCACCCATGACACCATGAGG - Exonic
921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG + Intronic
1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG + Exonic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1079709374 11:23662415-23662437 TGTCCAGCCAGGACACTGTTGGG - Intergenic
1087087087 11:94230737-94230759 CGTCTCCCTAGGACACAGTCCGG - Intergenic
1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG + Intronic
1092278462 12:7081005-7081027 CGTCCACCCGGACTACCGTCAGG - Exonic
1104809845 12:131613439-131613461 CGTCCACCCAAGACAGCCACTGG - Intergenic
1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG + Intronic
1111648974 13:91066030-91066052 CGTGCACCCATGACAGCCTCAGG - Intergenic
1115758521 14:36554229-36554251 CATCCACCCAGGATACCACCTGG - Intergenic
1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG + Intergenic
1133038156 16:3046201-3046223 CTTCCCCCCAGGACCCCGTGGGG - Intergenic
1139766883 16:69238080-69238102 TGTCCACGCAGGTCAGCGTCCGG - Intronic
1141630787 16:85286953-85286975 CTTCCACCCTGGAAAGCGTCGGG + Intergenic
1141879358 16:86847581-86847603 CGTCCAGCCAGGAGACCTCCAGG - Intergenic
1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG + Exonic
1149046318 17:52249788-52249810 CGTCTGCCCAGGAGACCTTCAGG - Intergenic
1152224885 17:79088102-79088124 CGTCCACCCAGGACAGTCCCCGG - Intronic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG + Intergenic
1160523964 18:79524721-79524743 CGGCCACCCAGGTTCCCGTCGGG - Intronic
1161265365 19:3361127-3361149 CCTCCAGCCAGGACCCCCTCGGG - Intronic
1162909305 19:13840773-13840795 TGTCCACCCAGGACACCAGGAGG + Intergenic
1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165063744 19:33217615-33217637 CGTCCTCTCAGGACCCGGTCTGG - Intronic
925045728 2:771740-771762 TGTCCACCCAGGAGCCCGTGTGG - Intergenic
925045838 2:772532-772554 TGACCACCCAGGACACCAGCTGG + Intergenic
929992564 2:46802298-46802320 CCTCCAAGCAGGGCACCGTCTGG - Intergenic
948257413 2:236578204-236578226 CGTCCACCCTGGAGGCAGTCTGG + Intronic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
1176335053 21:5588787-5588809 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176392704 21:6232161-6232183 TGTTCACTCAGGACATCGTCAGG + Intergenic
1176468715 21:7084013-7084035 TGTTCACTCAGGACATCGTCAGG - Intronic
1176492276 21:7465791-7465813 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176508366 21:7672592-7672614 TGTTCACTCAGGACATCGTCAGG + Intergenic
1179189340 21:39109397-39109419 TGTCCACCCTGGACACAGTCGGG - Intergenic
1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG + Intergenic
1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG + Intergenic
1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG + Intronic
961569505 3:127787664-127787686 CCTCCAGCGAGGACACCCTCAGG - Intronic
962811117 3:138960411-138960433 CCTCCACCCAGGAACCCGGCCGG - Intergenic
965272703 3:166638806-166638828 CTTCCACCCAGGAACCTGTCTGG - Intergenic
966928865 3:184662907-184662929 GTTCCCCCCAGCACACCGTCGGG - Intronic
970294173 4:14610646-14610668 TGTCCTCCCAGGACATCATCTGG + Intergenic
975823202 4:78292622-78292644 GGTCCACCCAGGGCACAGCCAGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
987876924 5:23691170-23691192 CGTCCACCCAGAACTCCAGCTGG - Intergenic
990020117 5:51116403-51116425 TGTCCACTCAGGAGACCTTCAGG + Intergenic
997858868 5:137398042-137398064 AGACTACCCAGGACACCGTCTGG + Intronic
1004505719 6:16245301-16245323 CATTCACCCAGGACGCCTTCTGG + Intronic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG + Exonic
1023621173 7:42074669-42074691 CGTCCACCCAGGGCCCTGCCAGG + Intronic
1028774882 7:94665118-94665140 CGTCTACCCAGATCACCGCCTGG + Exonic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1039891026 8:41685521-41685543 TGTCCTCTCAGGACACAGTCTGG - Intronic
1040311288 8:46238137-46238159 AGCCCACCCAGGACACCCTGGGG - Intergenic
1049590930 8:143462141-143462163 GGGCCACCCAGGACACTGCCAGG + Intronic
1062066974 9:134533878-134533900 TGTCTACCCAGGACCACGTCCGG - Intergenic